ID: 901055587

View in Genome Browser
Species Human (GRCh38)
Location 1:6447448-6447470
Sequence AACGTGAGCCAGGTCGGGCG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 3, 1: 0, 2: 1, 3: 18, 4: 171}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901055580_901055587 -1 Left 901055580 1:6447426-6447448 CCTGCGGTGTCGCATTTCCTGCA 0: 1
1: 2
2: 0
3: 5
4: 54
Right 901055587 1:6447448-6447470 AACGTGAGCCAGGTCGGGCGGGG 0: 3
1: 0
2: 1
3: 18
4: 171
901055578_901055587 13 Left 901055578 1:6447412-6447434 CCCAGAAAACAAATCCTGCGGTG 0: 1
1: 2
2: 0
3: 16
4: 117
Right 901055587 1:6447448-6447470 AACGTGAGCCAGGTCGGGCGGGG 0: 3
1: 0
2: 1
3: 18
4: 171
901055579_901055587 12 Left 901055579 1:6447413-6447435 CCAGAAAACAAATCCTGCGGTGT 0: 1
1: 2
2: 0
3: 6
4: 103
Right 901055587 1:6447448-6447470 AACGTGAGCCAGGTCGGGCGGGG 0: 3
1: 0
2: 1
3: 18
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901055587 Original CRISPR AACGTGAGCCAGGTCGGGCG GGG Intronic
901000917 1:6148367-6148389 AACAGGAGCCAGGTCTGGGGTGG + Intronic
901055587 1:6447448-6447470 AACGTGAGCCAGGTCGGGCGGGG + Intronic
901627829 1:10633697-10633719 AGCATGTGCCAGCTCGGGCGTGG - Intergenic
901953213 1:12764912-12764934 AACGTACACCAGGTCAGGCGCGG + Intergenic
902478803 1:16701189-16701211 AACGTGAGCCAGGTCGGGCGGGG - Intergenic
903053792 1:20620861-20620883 AAAGAAAGCCAGGCCGGGCGTGG - Intergenic
904363092 1:29991158-29991180 AAGGTGCGCGAGGGCGGGCGGGG + Intergenic
905399286 1:37690273-37690295 AAGCTGAGGCAGGCCGGGCGCGG - Intronic
906410829 1:45577601-45577623 AACATGCTCCAGGCCGGGCGCGG + Intergenic
906426220 1:45715349-45715371 AATGTGGGCTAGGCCGGGCGCGG + Intronic
908320124 1:62970820-62970842 TAAGAGGGCCAGGTCGGGCGTGG + Intergenic
908588268 1:65598222-65598244 AACCTGAGCCTGGTCAGGCATGG - Intronic
909443598 1:75724414-75724436 AAAGAGAGCCAGGGCGGGGGAGG - Intronic
910472694 1:87572215-87572237 AACCTGAGCCTGGACGGGCAGGG + Intergenic
911028159 1:93456970-93456992 CACCTGAGCCAGGTAGGTCGAGG - Intronic
914810081 1:151021162-151021184 AAAATTAGCCAGGCCGGGCGTGG + Intronic
914810237 1:151022398-151022420 AAAATTAGCCAGGCCGGGCGTGG - Intronic
915556334 1:156662941-156662963 AACATGGGCCAGGCCAGGCGAGG - Intergenic
915615010 1:157030940-157030962 AAAGTGGGCCAGGGCGGGGGCGG - Intronic
916070650 1:161167851-161167873 AATGGAAGGCAGGTCGGGCGTGG - Intronic
916430968 1:164728032-164728054 GAGGTGAGCCAGGCTGGGCGTGG + Intronic
917323535 1:173809048-173809070 AAAATGGGCCAGGTCAGGCGTGG + Intronic
917405150 1:174697607-174697629 AACTGTAGCCAGGCCGGGCGCGG - Intronic
922478946 1:225925164-225925186 AGCAAGAGACAGGTCGGGCGCGG - Intergenic
1064393476 10:14960734-14960756 AACGTGCCCGAGGCCGGGCGTGG + Intronic
1064765273 10:18664240-18664262 AAAGTTAGCCAGGTCAGGCATGG - Intronic
1067110843 10:43398628-43398650 AACGTAAAACAGGCCGGGCGCGG - Intronic
1069730608 10:70609453-70609475 AACCTGAGGCAGGCCGGGCACGG - Intergenic
1070178200 10:73990387-73990409 AATGTGAACCCGGCCGGGCGCGG - Intergenic
1071238391 10:83676514-83676536 ATCCTCAGCCAGGTCGGGTGAGG - Intergenic
1077151361 11:1074481-1074503 AACGTGAGCCTGATCAGGCCTGG + Intergenic
1080917716 11:36676695-36676717 AATGTGTCCCAGGCCGGGCGCGG - Intergenic
1085532779 11:77201794-77201816 AACCTGTGCCAGGTGGGGAGGGG + Intronic
1088189957 11:107217480-107217502 AAAGAGAGACAGGCCGGGCGTGG + Intergenic
1089419718 11:118322468-118322490 AATGTGTTCCAGGCCGGGCGCGG - Intergenic
1089497396 11:118914559-118914581 CACGTGGGCCAGGCCGGGAGGGG + Intronic
1095870185 12:47018328-47018350 AACCTGAGCCAGGTGGGACTTGG - Intergenic
1096817299 12:54209625-54209647 AAGGAGGGCCAGGCCGGGCGCGG + Intergenic
1102024873 12:109708693-109708715 AACGTCATCCAGGCCGGGCGCGG + Intergenic
1102087565 12:110155600-110155622 CATGTGATCCAGGCCGGGCGCGG - Intronic
1102357002 12:112245839-112245861 AATGTGACCTAGGCCGGGCGTGG + Intronic
1103314610 12:120042512-120042534 AACCTAAGTCAGGCCGGGCGTGG + Intronic
1103691089 12:122774797-122774819 AATGTGAAACAGGCCGGGCGCGG + Intronic
1103940441 12:124498542-124498564 AACGTGGCTCAGGTCGGGAGGGG - Intronic
1107775061 13:43830164-43830186 AAAGCAAGCCAGGTTGGGCGCGG - Intronic
1112174903 13:97012361-97012383 TACGTGAGCTTGGCCGGGCGTGG - Intergenic
1115982761 14:39071941-39071963 AATGTGAGGGAGGCCGGGCGGGG + Intronic
1116709930 14:48355245-48355267 AAAGTGAGCTAGGCCGGGCGCGG - Intergenic
1118021530 14:61720949-61720971 AACATGACTCAGGCCGGGCGCGG + Intronic
1122730709 14:103795226-103795248 AACATGATACAGGTCGGGCACGG - Intronic
1122926457 14:104905319-104905341 ACCGCGAGCCAGGACGGGCAGGG + Intergenic
1122926467 14:104905362-104905384 ACCGCGAGCCAGGACGGGCAGGG + Intergenic
1122926477 14:104905405-104905427 ACCGCGAGCCAGGACGGGCAGGG + Intergenic
1122926529 14:104905663-104905685 ACCGCGAGCCAGGACGGGCAGGG + Intergenic
1122926539 14:104905706-104905728 ACCGAGAGCCAGGACGGGCAGGG + Intergenic
1122926549 14:104905749-104905771 ACCGTCAGCCAGGACGGGCAGGG + Intergenic
1122926567 14:104905835-104905857 ACCGCGAGCCAGGACGGGCAGGG + Intergenic
1122926577 14:104905878-104905900 ACCGTCAGCCAGGACGGGCAGGG + Intergenic
1122926605 14:104906007-104906029 ACCGCGAGCCAGGACGGGCAGGG + Intergenic
1122926658 14:104906265-104906287 ACCGCGAGCCAGGACGGGCAGGG + Intergenic
1122926684 14:104906394-104906416 ACCGCGAGCCAGGACGGGCAGGG + Intergenic
1122926735 14:104906614-104906636 ACCATGAGCCAGGACGGGCAGGG + Intergenic
1122926745 14:104906657-104906679 ACCGCGAGCCAGGACGGGCAGGG + Intergenic
1122926797 14:104906877-104906899 ACCATGAGCCAGGACGGGCAGGG + Intergenic
1122926807 14:104906920-104906942 ACCGCGAGCCAGGACGGGCAGGG + Intergenic
1122961609 14:105096433-105096455 GACGGGAGCCAGGTGGGGTGTGG - Intergenic
1126004381 15:44242505-44242527 AAGATGAGCTAGGCCGGGCGTGG - Intergenic
1131177761 15:90220657-90220679 GATGTGAGCCTGGCCGGGCGCGG - Intronic
1132543572 16:522732-522754 AAGGTGGGGCAGGTGGGGCGGGG + Exonic
1139848154 16:69934966-69934988 AAAGTGAGCCAGTTCTGGGGAGG + Intronic
1140513899 16:75528836-75528858 AATGTGTGCCAGGCCGGGTGCGG - Exonic
1140726975 16:77822406-77822428 AACATCAGCCAGGCCAGGCGTGG - Intronic
1141038148 16:80646498-80646520 AACAAGACCCAGGTCGGGCGTGG + Intronic
1141588776 16:85053177-85053199 AATTTGATCCAGGTCGGGCGTGG - Intronic
1142746204 17:1959851-1959873 AACCTGAGCCTGGCTGGGCGCGG - Intronic
1143523018 17:7456342-7456364 AACGAAAGCGAGGCCGGGCGCGG - Intronic
1143828974 17:9635880-9635902 AACGAATGCAAGGTCGGGCGTGG + Intronic
1144687086 17:17233305-17233327 AAAATTAGCCAGGCCGGGCGCGG + Intronic
1147182998 17:38698520-38698542 AAAATTAGCCAGGGCGGGCGCGG + Intergenic
1148215818 17:45833622-45833644 AAAGAGGGCCAGGTCGGGGGAGG - Intronic
1149322813 17:55498706-55498728 AATGTTAAACAGGTCGGGCGTGG + Intergenic
1150586991 17:66527905-66527927 AACATGATACAGGTTGGGCGCGG + Intronic
1151072900 17:71236451-71236473 AAGATGAGCAAGGCCGGGCGCGG - Intergenic
1152146271 17:78570567-78570589 AACAAGACCCAGGCCGGGCGTGG + Intronic
1152392903 17:80013347-80013369 CAGGTGAGCCAGGGCAGGCGAGG - Exonic
1153201278 18:2650117-2650139 AACGTGATGCAGGCCGGGTGCGG + Intergenic
1153653864 18:7264891-7264913 AACAAGACCCAGGCCGGGCGCGG + Intergenic
1155362364 18:25016002-25016024 AATGTGAACCAGGCCTGGCGGGG + Intergenic
1155594775 18:27472984-27473006 AACTTGAGCCGGGTGGGGAGTGG + Intergenic
1155947972 18:31877320-31877342 AAAGTGAGCCTGGCCGGGCGCGG + Intronic
1160137553 18:76285477-76285499 AACGTGTGCTTGGTTGGGCGCGG - Intergenic
1161183941 19:2903500-2903522 AACTTAATCCAGGCCGGGCGCGG - Intronic
1161263401 19:3350606-3350628 AATGTGTTTCAGGTCGGGCGTGG + Intergenic
1161348509 19:3779522-3779544 CACGTGAGCAAGGTGGGGCGGGG - Exonic
1162218219 19:9154042-9154064 AAGGAGAGCCAGGTAGTGCGAGG + Intronic
1162896020 19:13765034-13765056 AACATCAGCCAGGTCGCGGGCGG - Exonic
1163082252 19:14952629-14952651 AAGGTGATCCAGGCCGGGTGCGG - Intronic
1163629487 19:18410420-18410442 AAACTGAACCAGGCCGGGCGCGG - Intergenic
1163691921 19:18742982-18743004 AACGTGAACCAGATCGGGAGTGG + Exonic
1164135162 19:22407778-22407800 AACATCCACCAGGTCGGGCGCGG + Intronic
1164905411 19:31963740-31963762 AACTTGGGCCTGGTTGGGCGAGG - Intergenic
1165571793 19:36781504-36781526 ACCGTAAGCTAGGTCGGGCGTGG + Intergenic
1166206869 19:41275810-41275832 AACATCAGCCAGGCCGGGCGTGG + Intronic
1166335006 19:42100458-42100480 AATGTAAGCCAGGCCGGGTGTGG + Intronic
1166932803 19:46311572-46311594 AACGTTAGGCAGGCCGGGCGAGG + Intronic
1167590292 19:50400984-50401006 AAAGTTAGCCAGGCCGGGCGCGG - Intronic
1168486723 19:56768739-56768761 AAAGTCACCCAGGCCGGGCGCGG - Intergenic
1202712822 1_KI270714v1_random:27020-27042 AACGTGAGCCAGGTCGGGCGGGG - Intergenic
925313494 2:2904862-2904884 AACGGAAGCAAGGTCGGGCCTGG - Intergenic
926902912 2:17775843-17775865 AGCTTGAGCTAGGTGGGGCGTGG + Intronic
927333183 2:21890345-21890367 AAAGTGAGCCAGGGAGGGAGAGG - Intergenic
927932114 2:27051907-27051929 CGCGTAAGCCAGGTCGGGAGCGG - Intronic
930529192 2:52570817-52570839 AACGTGAACCAGATCGGGAGTGG + Intergenic
936511748 2:113153989-113154011 AAAGGGACCCTGGTCGGGCGCGG + Intergenic
937395529 2:121531303-121531325 AATGTAATCCAGGTCGGGCGCGG + Intronic
937929457 2:127193083-127193105 GTCGTGATCCAGGTAGGGCGTGG - Exonic
938405741 2:131032216-131032238 AACAAGAGCCAGGTCCGGCCTGG + Intronic
943029759 2:182671476-182671498 AGCGTGATCCAGGCCGGGTGTGG - Intergenic
943050159 2:182904121-182904143 ATCGAGAGAGAGGTCGGGCGCGG + Intergenic
943699243 2:190972001-190972023 AACATCAGCCAGGCCGGGCGCGG - Intronic
945789850 2:214291593-214291615 AACATGATCTAGGCCGGGCGCGG - Intronic
1172289927 20:33768711-33768733 CACTTGATCCAGGCCGGGCGTGG - Intronic
1172316988 20:33963465-33963487 AACAGGAACCAGGCCGGGCGCGG - Intergenic
1172543490 20:35741322-35741344 AACGTTTACCAGGCCGGGCGCGG - Intronic
1172958341 20:38778451-38778473 AACCTGATGCAGGCCGGGCGCGG - Intergenic
1174357845 20:50010158-50010180 AACGTGAGCCGGGCTGGGGGCGG + Intergenic
1174611394 20:51801317-51801339 AGCGTGGGCCAGGTCAGCCGCGG + Intronic
1175751818 20:61503940-61503962 AACATGAGCCAGGTCGGCCAAGG + Intronic
1176243617 20:64086355-64086377 AATGTGAGCCAGGTAGGCCCTGG - Intronic
1177819210 21:26012682-26012704 AACGTGTGCCCGGTTGGGTGTGG + Intronic
1179457273 21:41508161-41508183 AGCGAGAGCCAGGGCGGGCCGGG - Intronic
1181381006 22:22504141-22504163 AACTTGTGCCAGGCCGGGCATGG + Intronic
1181978599 22:26750497-26750519 AACCTGAGCCAGGCTGGGCACGG - Intergenic
1183493832 22:38130709-38130731 AAAGTAAGCCAGGCCGGGCACGG + Intronic
1183786711 22:40033373-40033395 AACCTTAGCCAGGCTGGGCGTGG - Exonic
949487496 3:4553889-4553911 AATGTTAGCCAGGCTGGGCGTGG - Intronic
953068475 3:39496951-39496973 AAAATTAGCCAGGCCGGGCGAGG - Intronic
953974101 3:47369777-47369799 AACGGGACGCAGGCCGGGCGCGG + Intergenic
956631631 3:71322573-71322595 AACAGGAGCCAGGTGGAGCGAGG + Intronic
957763447 3:84590171-84590193 AACCTGAACCTGGCCGGGCGCGG - Intergenic
957998516 3:87722599-87722621 AACGTATTCAAGGTCGGGCGTGG - Intergenic
962530556 3:136276566-136276588 AACTTGGGCCAGGGCGGGGGTGG + Intronic
971662186 4:29433415-29433437 AAGTTGAGCCAGGGAGGGCGAGG - Intergenic
974103646 4:57443734-57443756 ACCGTGGGCCAGGCCTGGCGGGG - Intergenic
976208118 4:82641097-82641119 AAGGTGAACAAGGCCGGGCGTGG + Intronic
984422253 4:179538493-179538515 GAAATGAGCCAGGCCGGGCGCGG - Intergenic
986116007 5:4775309-4775331 AAAGTAAACCAGGCCGGGCGCGG - Intergenic
986298045 5:6455820-6455842 AGTGTGAGCCAGGTGGGGTGGGG - Intronic
987907154 5:24091503-24091525 AAACTGAGGCAGGCCGGGCGCGG + Intronic
989612972 5:43313182-43313204 ACCGTGAGCGGGGCCGGGCGGGG - Intronic
989770915 5:45144151-45144173 ACAGTGGGCCAGGCCGGGCGTGG - Intergenic
992798079 5:80271099-80271121 AACAGGAGACAGGTCGGGCGTGG + Intergenic
999599898 5:153251025-153251047 AACAAGATCCAGGCCGGGCGCGG - Intergenic
1001027039 5:168233035-168233057 AACATGAAGCAGGCCGGGCGTGG + Intronic
1001999963 5:176191955-176191977 AGCGTGAGCCGGGGTGGGCGAGG - Intergenic
1002655403 5:180742528-180742550 AACCAGAAGCAGGTCGGGCGCGG - Intergenic
1002905817 6:1448139-1448161 AACCTGATACAGGCCGGGCGTGG - Intergenic
1003917454 6:10800547-10800569 AATGTAATCCTGGTCGGGCGCGG + Intronic
1004582358 6:16966299-16966321 AAGTTGATCCAGGCCGGGCGCGG - Intergenic
1006086253 6:31597727-31597749 AAAATGAGCCAGGCTGGGCGCGG - Intergenic
1006612719 6:35304235-35304257 CACCTGAGCCAGGGCGGTCGAGG + Intronic
1013120227 6:107134446-107134468 AAAGTGAACCAGGCTGGGCGTGG + Intergenic
1013217886 6:108046633-108046655 AACCAGAGACAGGCCGGGCGCGG - Intronic
1017109550 6:150919513-150919535 ACTGTGAGCCAGGTCAGGCGCGG - Intronic
1017848316 6:158279230-158279252 AACTATAGCCAGGCCGGGCGCGG - Intronic
1019320437 7:412918-412940 AACCACAGCCAGGCCGGGCGCGG + Intergenic
1019646420 7:2131764-2131786 AGCCTGAGCCAGCTCGGGCCAGG - Intronic
1028518101 7:91699540-91699562 AACCTCATCCAGGCCGGGCGCGG + Intronic
1030514580 7:110523897-110523919 AATGTAAGCCAGGCCGGGCGCGG - Intergenic
1030983321 7:116210953-116210975 AGCGCGAGCGAGGGCGGGCGCGG + Intronic
1032831636 7:135633047-135633069 CACTTGAGCCAGGTAGGTCGAGG - Intronic
1034486102 7:151364130-151364152 AAGGTAAGCCTGGCCGGGCGCGG + Intronic
1035027996 7:155838566-155838588 AACATAAGAAAGGTCGGGCGCGG - Intergenic
1035239409 7:157520172-157520194 CACGTGAGGCAGGTCGGTGGTGG + Intergenic
1036744796 8:11399074-11399096 AACCTGAGGCTGGCCGGGCGAGG - Intronic
1037368117 8:18144523-18144545 AACATGGGCCGGGCCGGGCGTGG - Intergenic
1042462183 8:69082330-69082352 AAAGTCAGCTAAGTCGGGCGTGG - Intergenic
1042821158 8:72931719-72931741 AACCTGAGGCAGGTGGGGCATGG + Intronic
1043223165 8:77692300-77692322 AAAGTGTTCCAGGCCGGGCGCGG + Intergenic
1043375496 8:79644862-79644884 AACGTGAGCCAGGCCGGGTGTGG + Intronic
1043663120 8:82772099-82772121 AAAGTAAGACAGGTTGGGCGCGG + Intergenic
1043679961 8:83011063-83011085 AACTTGAGCTTGGCCGGGCGCGG + Intergenic
1043828532 8:84959894-84959916 AAAATGGGCCAGGTCGGGCACGG + Intergenic
1044430695 8:92103273-92103295 AGAGTGAGCGAGGGCGGGCGAGG - Intronic
1047809360 8:128391393-128391415 AAAGTGAATGAGGTCGGGCGTGG + Intergenic
1061346907 9:130033695-130033717 AAAGTTAGCCAGGCCGGGCTGGG + Intronic
1062678100 9:137760124-137760146 AACGTGGGCTAGGGCGGGAGAGG + Intronic
1186805976 X:13140275-13140297 AGGGTGAGCCAGGTGGGGAGTGG - Intergenic
1187406288 X:19007224-19007246 AACCCGAGCCAGGTGGGGAGAGG - Exonic
1190856566 X:54300950-54300972 AAAGGGAGGCAGGTTGGGCGTGG + Intronic
1190864538 X:54373699-54373721 AAAATTAGCCAGGCCGGGCGCGG + Intergenic
1197206417 X:123794684-123794706 AACATGAAACAGGCCGGGCGCGG + Intergenic
1198383805 X:136108399-136108421 ATGGTGAACCAGGCCGGGCGTGG - Intergenic