ID: 901055588

View in Genome Browser
Species Human (GRCh38)
Location 1:6447454-6447476
Sequence AGCCAGGTCGGGCGGGGTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 248
Summary {0: 3, 1: 0, 2: 0, 3: 13, 4: 232}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901055580_901055588 5 Left 901055580 1:6447426-6447448 CCTGCGGTGTCGCATTTCCTGCA 0: 1
1: 2
2: 0
3: 5
4: 54
Right 901055588 1:6447454-6447476 AGCCAGGTCGGGCGGGGTGAAGG 0: 3
1: 0
2: 0
3: 13
4: 232
901055578_901055588 19 Left 901055578 1:6447412-6447434 CCCAGAAAACAAATCCTGCGGTG 0: 1
1: 2
2: 0
3: 16
4: 117
Right 901055588 1:6447454-6447476 AGCCAGGTCGGGCGGGGTGAAGG 0: 3
1: 0
2: 0
3: 13
4: 232
901055579_901055588 18 Left 901055579 1:6447413-6447435 CCAGAAAACAAATCCTGCGGTGT 0: 1
1: 2
2: 0
3: 6
4: 103
Right 901055588 1:6447454-6447476 AGCCAGGTCGGGCGGGGTGAAGG 0: 3
1: 0
2: 0
3: 13
4: 232

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901055588 Original CRISPR AGCCAGGTCGGGCGGGGTGA AGG Intronic
900109413 1:999249-999271 AGCGAGGCCGGGCGGCGGGAGGG + Exonic
901055588 1:6447454-6447476 AGCCAGGTCGGGCGGGGTGAAGG + Intronic
901438084 1:9261723-9261745 GGCCAGGCAGGGCGGGGCGAGGG + Intronic
901667342 1:10833928-10833950 AGCCAGGTCAGGCTGGGAGAAGG - Intergenic
902478802 1:16701183-16701205 AGCCAGGTCGGGCGGGGTGAAGG - Intergenic
902586197 1:17439815-17439837 GGCCAGGCCGGGCGGGGCGGGGG - Intergenic
902802106 1:18836952-18836974 TGCCAGGTAGGGCGGAGGGAAGG + Intergenic
903024460 1:20417641-20417663 GGCAAGGGCTGGCGGGGTGATGG - Intergenic
903336504 1:22627822-22627844 AGCCATCTAGGGAGGGGTGAGGG - Intergenic
904047094 1:27615399-27615421 AGCCTGGTCGGGCGGGATTCGGG - Intronic
904625124 1:31798174-31798196 AGCCCAGTCGGGATGGGTGAGGG - Intronic
905809049 1:40898735-40898757 AGTCAGGTTGGGTGGGGAGAAGG + Intergenic
907335444 1:53696605-53696627 AGCATGGCCGGGTGGGGTGAGGG - Intronic
909959867 1:81826666-81826688 AGCCAGGATGGGAAGGGTGAAGG + Intronic
913099729 1:115551958-115551980 ATCCAGGTCAGGTGTGGTGAGGG - Intergenic
913238254 1:116803896-116803918 GGGCAGTTGGGGCGGGGTGATGG - Intergenic
915564831 1:156707468-156707490 AGCGGGGTGGGGCGGGGTGGGGG + Intergenic
924436803 1:244049231-244049253 TGCGGGGTCGGGCGGGGTGCGGG + Intronic
1063641999 10:7839208-7839230 AGCCAGGGTGGGCATGGTGATGG - Intronic
1064173406 10:13053774-13053796 AGCCATGTGGGCAGGGGTGAAGG + Intronic
1064832849 10:19490494-19490516 AGCCAAGTGGGGCGGGGGGGGGG + Intronic
1068157561 10:53221941-53221963 AGCCAGGTGTGGAGTGGTGAGGG + Intergenic
1070257593 10:74825410-74825432 GGCCAGGCCGGGCGGGCTGGCGG + Intergenic
1070844769 10:79513170-79513192 AGCCAGGCCAGGCTGGGGGAGGG - Exonic
1070929035 10:80247141-80247163 AGCCAGGCCAGGCTGGGGGAGGG + Intergenic
1073132439 10:101198240-101198262 AGCCAGGTCTGGTGGAGTGGGGG + Intergenic
1074690765 10:116002155-116002177 AGCCAGGGCCGGCAGGGGGATGG + Intergenic
1075086098 10:119415392-119415414 AAGCAGGTCGGGCAGGGTGTTGG + Intronic
1075627469 10:123973040-123973062 CGCCAGGCCGGGGCGGGTGATGG + Intergenic
1076786926 10:132754517-132754539 AGCCAGGGGTGGAGGGGTGAGGG - Intronic
1077094867 11:795046-795068 CGCCAGGCCAGGCGGGGTGGAGG + Exonic
1077222224 11:1422814-1422836 AGCCAGGACCGAGGGGGTGACGG + Intronic
1077228462 11:1448418-1448440 AGCCAGGGCAGGCAGAGTGAGGG - Intronic
1077429195 11:2507636-2507658 AGCCAGGTGAGGTGGGTTGAAGG + Intronic
1079076597 11:17388735-17388757 AGGCAGGCTGGGCGGGGAGAAGG - Intronic
1081163809 11:39785010-39785032 AGCCAGCTGGGGAGCGGTGAGGG + Intergenic
1082793300 11:57362300-57362322 GGCCAGGTCGGGAGGAGTCAAGG + Intronic
1083488181 11:62996449-62996471 AGGCAGGTGGGGCTGGGGGAGGG + Intronic
1083733627 11:64667429-64667451 AGCCAGGGCCGGCGGGCTGGGGG - Exonic
1083771328 11:64869337-64869359 AGCCAGGTGGGGCGAGCAGAGGG + Intronic
1084311531 11:68319045-68319067 AGCCAGGCACGGTGGGGTGAGGG - Intronic
1085423918 11:76386230-76386252 AGCAAGGTAGGGTGGGGTGATGG - Intronic
1085460002 11:76687871-76687893 AGACAGGGTGGGCAGGGTGAGGG + Intergenic
1085642583 11:78201861-78201883 AGGCAGGTTGGGTGGGGTGAAGG + Intronic
1089497400 11:118914565-118914587 GGCCAGGCCGGGAGGGGTGGGGG + Intronic
1092182798 12:6457640-6457662 AGTGAGGCCGGGCAGGGTGAGGG - Exonic
1094199297 12:27780327-27780349 AGCCATGTCGGCCGAGGAGATGG + Exonic
1096037539 12:48485835-48485857 TGACAGGTTAGGCGGGGTGAAGG + Intronic
1102016940 12:109654375-109654397 AGCCAGGTCAGGCTGGGAGTTGG - Intergenic
1103614060 12:122141181-122141203 AGCCAGGTGGGGCCGGGGCAGGG + Intronic
1104906036 12:132214018-132214040 TGCCAGGTCAGGCGTGGGGATGG + Intronic
1105331530 13:19421210-19421232 AGCCAGGTCAGGGGGAGTAAAGG + Intergenic
1105544005 13:21338825-21338847 AGGCAGGTCGGGTGGGGGGAGGG + Intergenic
1105880253 13:24599340-24599362 AGCCAGGTCAGGGGGAGTAAAGG - Intergenic
1105919578 13:24949526-24949548 AGCCAGGTCAGGGGGAGTAAAGG + Intergenic
1110410574 13:75200091-75200113 AGCCAGGGCAGGAGGGGAGAAGG + Intergenic
1110850658 13:80241222-80241244 AGCCAGGTGCGGAGTGGTGAGGG + Intergenic
1114365826 14:22026301-22026323 AGCTAGGTGGGGCTGGGTCAGGG - Intergenic
1114646572 14:24259512-24259534 AGCCAGGAAAGGCGGGGTGGGGG + Intronic
1118521899 14:66595502-66595524 AGCCAGGTACGGAGTGGTGAGGG + Intronic
1120990182 14:90368598-90368620 AGCGGGGGCGGGCGGGGTGGGGG + Intergenic
1121495192 14:94387505-94387527 ATCAAGGTCGGGTGGGGTGAGGG + Intronic
1122856144 14:104561092-104561114 AGCCAGGTGGGGATGGGTGAGGG + Intronic
1122911448 14:104830179-104830201 AGCCAGGTGTGGTGGGGTGGCGG + Intergenic
1202854768 14_GL000225v1_random:43462-43484 AGCCAGGCCGGGCTGGCAGATGG + Intergenic
1127019234 15:54727404-54727426 AGCCAGGTGTGGAGTGGTGAGGG - Intergenic
1127252602 15:57256555-57256577 AACAAGGTGGGGCGGGGTGGGGG - Intronic
1128217052 15:65941855-65941877 AGCCCTGTCTGGAGGGGTGAAGG - Intronic
1129264075 15:74384670-74384692 AGCCAGATGGGGTGGGGTGGGGG - Intergenic
1129570362 15:76676262-76676284 AGCCAGTGCAGGCTGGGTGAAGG - Intronic
1129699661 15:77760319-77760341 AGCCTGGTGGGGCTGGGGGACGG - Intronic
1131038703 15:89243157-89243179 AGCCAGGTGGGGCGGACCGAAGG - Intergenic
1131542683 15:93288232-93288254 GGGCAGGGTGGGCGGGGTGAGGG + Intergenic
1132240626 15:100254839-100254861 AGCCGGGGGAGGCGGGGTGAAGG + Intronic
1132805912 16:1775084-1775106 AGCCAGGTGGGGCCGGGCGGTGG - Exonic
1133613060 16:7451081-7451103 TGCCAGGTAGGGCAGGCTGAGGG + Intronic
1136365160 16:29806375-29806397 AGCCTGGCGGGGCGGGGTGGGGG - Intronic
1136429367 16:30187832-30187854 GGCCTCGTCGGGCGGGGTGGGGG + Intronic
1138091265 16:54176576-54176598 GGCCAGGTCGGCAGGGGTCAGGG + Intergenic
1141992631 16:87619407-87619429 AGCCAGGTGGGCTGGGGTGCAGG - Intronic
1142287352 16:89176882-89176904 TGCCATGTCGGGCAGGGGGACGG - Intronic
1142585128 17:967365-967387 AGACAGGCGGGGCGGGGAGATGG + Intronic
1142597615 17:1037125-1037147 ATCCAGGTGGGGCTGGGAGAGGG + Intronic
1142847450 17:2689108-2689130 GGCCAGGTGGGGAGGGGTGCTGG - Intergenic
1142848678 17:2694094-2694116 GGCCAGGTGGGGCTGGGTGGAGG - Intronic
1142898146 17:2995494-2995516 GCCCAGGGCGGGCGAGGTGAGGG + Intronic
1145811224 17:27765476-27765498 AGCCAGGTGGGGCGGCCAGAGGG + Intronic
1146330953 17:31926802-31926824 AGTCAGGCCAGGCGTGGTGATGG - Intergenic
1147758523 17:42783183-42783205 AGCCAGGTGGGGAGAGGTTAAGG - Intronic
1148752230 17:49951906-49951928 AGCCAGGACGGCGGGGGTGGAGG + Intergenic
1148778013 17:50106608-50106630 AGCCAGGGCTGGAGGGGTCAGGG + Intronic
1150284849 17:63948901-63948923 AGCCAGATGGAGCTGGGTGAGGG - Intronic
1151460203 17:74249803-74249825 AGCCAGGTGGGGGGGTGGGAGGG + Intronic
1151760752 17:76101391-76101413 AGCCAGGTCAGGCTGGGGCATGG + Intronic
1152374694 17:79913118-79913140 AGCCAGGGTGGGCGTGGTTATGG - Intergenic
1152546818 17:81004316-81004338 AGCCAGGAAGGGCGGGGGGGCGG - Intronic
1152584572 17:81183294-81183316 AGCCAGGTGGGGCTGGGAGATGG - Intergenic
1152659693 17:81536552-81536574 GTCCAGGCCGGGCGGGGTGGGGG - Exonic
1153758731 18:8310024-8310046 AGCCAGCTTGGGGTGGGTGATGG - Intronic
1154161758 18:11985712-11985734 TGCCAGGTGGGTCGGCGTGATGG + Intronic
1156268860 18:35512993-35513015 ACCCAGGTCAGGCAAGGTGATGG - Intergenic
1157619551 18:49008478-49008500 ACCCAGGTGGGGCAGGGAGAGGG - Intergenic
1158130811 18:54150587-54150609 AGCAGGGTGGGGTGGGGTGATGG - Intergenic
1158718360 18:59900262-59900284 ACCCAGGCCGGGCGGGGTCGGGG + Intronic
1158826903 18:61231765-61231787 AGCCAGGTGGGTGGTGGTGATGG - Intergenic
1160849211 19:1182014-1182036 ACCCAGGGCAGGCTGGGTGAAGG + Intronic
1161868731 19:6854102-6854124 AGGCAGGCAGGGCTGGGTGACGG + Intronic
1162968185 19:14165576-14165598 GGGCAGGGCGGGTGGGGTGACGG - Intronic
1162971153 19:14182343-14182365 AGCCAGGCCCTGCGGGGTGCTGG + Intronic
1163414525 19:17178048-17178070 AGCCAGGTCGGCAGGGCTGCGGG + Intronic
1163573866 19:18099199-18099221 AGCCAGGTCGGGAGTGGTCAGGG + Intronic
1164229609 19:23275915-23275937 AGCCAGGTTGGGCCTGGGGATGG - Intergenic
1165431860 19:35777496-35777518 TGGCAGGTCGGGGGAGGTGAGGG - Intronic
1165904833 19:39187524-39187546 AGCCAGGTCGGGAGGGGGCAGGG - Intergenic
1166389636 19:42401853-42401875 AGCCGGGCCGAGCGGGGAGACGG - Exonic
1166702648 19:44891207-44891229 GGCTAGGTGGGGCGGGGCGACGG + Intronic
1166705849 19:44907636-44907658 AGCCATGGTGGGCAGGGTGAGGG - Intronic
1166741941 19:45119824-45119846 AGCAAGGTTGTGCGGGGTGCTGG - Intronic
1166946440 19:46399908-46399930 AGACAGGCCGGGCGTGGTGGCGG + Intergenic
1168064280 19:53910202-53910224 AGCCAGGGTGGCCAGGGTGATGG + Intronic
1168064560 19:53911665-53911687 AGCCAGGGTGGCCAGGGTGATGG + Intronic
1168713904 19:58516369-58516391 AGCCAGGGCGGGGGAGGAGAGGG - Intronic
1202712821 1_KI270714v1_random:27014-27036 AGCCAGGTCGGGCGGGGTGAAGG - Intergenic
924996450 2:366004-366026 AGCCAGGGCGGCCGATGTGAGGG + Intergenic
925296963 2:2783650-2783672 AGACAGGCAGGGCAGGGTGAAGG - Intergenic
925607472 2:5673494-5673516 AGCCAGGTGGGGCGGGGCGTGGG - Intergenic
926994765 2:18722508-18722530 AGCCAGGAGGGGCTGGTTGATGG - Intergenic
927122205 2:19976370-19976392 AGCCAGATTGGGAGGGGTTAAGG - Intronic
927147918 2:20179073-20179095 AGCCTGGCAGGGCTGGGTGATGG + Intergenic
927544502 2:23940667-23940689 CGCCGCGTCCGGCGGGGTGAGGG + Intronic
927718744 2:25369604-25369626 AGGCAGGGAGGGTGGGGTGAAGG + Intergenic
928424842 2:31169369-31169391 AGACAGGTAGGGTGGGGTGTTGG - Intergenic
929078212 2:38095993-38096015 AGCTAGGTGGGGAGGGGTGCAGG - Intronic
929520651 2:42647512-42647534 AGGCAGGTGGGGTGGGGGGATGG - Intronic
929550432 2:42887231-42887253 AGCCAGGTCAGCCTTGGTGAAGG - Intergenic
929591974 2:43153537-43153559 CGCCAGGGTGGGGGGGGTGAGGG - Intergenic
931517817 2:63059894-63059916 GGCCAGGCCCGGCAGGGTGAGGG + Intergenic
932644506 2:73487244-73487266 AGCCAGGTGTGGAGTGGTGAGGG + Intronic
933750437 2:85599580-85599602 AGCCAGGTCCAGCGGGGCGGTGG + Exonic
933780847 2:85799848-85799870 AGGCAGGTGGGGCGGGGCCAGGG - Intergenic
934473830 2:94579395-94579417 AGCCAGGACCGGCCAGGTGATGG + Intergenic
934733285 2:96672862-96672884 AGCCAGGGCTGGCTGGGTGGAGG + Intergenic
936441478 2:112557732-112557754 AGCCAGAGGGGGTGGGGTGAGGG - Intronic
937251602 2:120527505-120527527 TGCCAGGGAGAGCGGGGTGAGGG - Intergenic
937853445 2:126656195-126656217 GGCCAGGCCGGGCCGGGGGAGGG - Exonic
938072923 2:128317887-128317909 CGGCAGGTCGGGAGGGGTGCCGG + Intronic
946400955 2:219468278-219468300 ATCCAGGGTGGGCAGGGTGAGGG + Intronic
947327124 2:228991592-228991614 AGCCAGGTGTGGAGTGGTGAGGG + Intronic
948050369 2:234975323-234975345 AGCCAGGCCTGGCGAGGTGCAGG + Intronic
948603059 2:239118348-239118370 AGCCAGGTCCAGCCGGGTGCAGG + Intronic
948884113 2:240874476-240874498 AGCCAGGCCGGGCAGGGGGTAGG + Intronic
1170247123 20:14233545-14233567 AGCCAGGTGGGGTGTGGTGGCGG + Intronic
1170889143 20:20364471-20364493 GGCCGGGCCGGGCGGGGTGGCGG + Intergenic
1172794676 20:37528407-37528429 AGCCGGGTCGGGGTGGGCGAGGG - Intergenic
1172867883 20:38113657-38113679 AGCCTGGTGGGGCGGGGTTAGGG + Intronic
1172899809 20:38326311-38326333 AGACAGGTGTGGCGGGGTGGAGG - Exonic
1173821482 20:46022694-46022716 AGCCAGCTCAGGCGGGGTTGGGG + Intronic
1175388144 20:58610419-58610441 AGCCAGGTCAGGCATGGAGAGGG - Intergenic
1177459868 21:21396574-21396596 AACCAGGTGGGGAGTGGTGAGGG + Intronic
1179484936 21:41704119-41704141 AGCCAGGCTGGGCGGGGGCATGG - Intergenic
1179819883 21:43930606-43930628 GGGCAGGCCTGGCGGGGTGAGGG + Intronic
1180932026 22:19598669-19598691 TCCCAGGAAGGGCGGGGTGAGGG + Intergenic
1181420481 22:22794409-22794431 GGCCAGTTCTGGCAGGGTGAGGG + Intronic
1183116305 22:35695187-35695209 AGCCAGGGCGGGAGGGGGGGTGG + Intergenic
1183117197 22:35701221-35701243 AGCCAGGGCGGGAGGGGGGGTGG + Intergenic
1183487476 22:38097303-38097325 AGCTAGGATGGGCCGGGTGATGG - Intronic
1183685761 22:39360602-39360624 AGAGAGGACGAGCGGGGTGAGGG - Intronic
1183735560 22:39642990-39643012 AGCCAGGACAGCCGGGATGAGGG + Intronic
1184115776 22:42421304-42421326 AGCCAGGTGTGGTGGGGTGGTGG + Intronic
1184689428 22:46110713-46110735 AGCCAGCCAGGGTGGGGTGAGGG - Intronic
950450632 3:13063153-13063175 AGCCAGGCTGGGCGTGGTGTCGG - Intronic
952860162 3:37806463-37806485 AGCCAGGTGGGGCGGCCAGAAGG - Intronic
954124290 3:48519586-48519608 AGCCAGGTGGGCTGGGGTGGGGG + Exonic
957083099 3:75655558-75655580 GGCCAGCTCGGGCTGGGGGAGGG + Intergenic
957744204 3:84317698-84317720 AGCCAGGTGGGCCTTGGTGAGGG + Intergenic
958977540 3:100683594-100683616 AGCCAGGTGTGGAGCGGTGAGGG - Intronic
959616946 3:108359339-108359361 GGCCAGGTGGGGCTGGGGGAGGG + Intronic
959745891 3:109776390-109776412 AGCCAGGTCAGCCTTGGTGAGGG + Intergenic
963179524 3:142339104-142339126 AGCCAGGTATGGCGGGCTGTGGG + Intronic
969408897 4:7015048-7015070 AGCCAGGTCTGGTGGGGTAGAGG + Intronic
971422929 4:26490508-26490530 GGGGAGGTGGGGCGGGGTGAAGG - Intergenic
972788320 4:42347289-42347311 AGCCAGGCCCGGAGTGGTGAAGG - Intergenic
978897534 4:113907026-113907048 AGCCTGGTGGGGCAGGTTGAGGG - Intronic
980110738 4:128634511-128634533 AGCCAGTTCAGGCTGAGTGAAGG + Intergenic
983027527 4:162756174-162756196 AGCCAGGTCAGCCTTGGTGAGGG - Intergenic
987192848 5:15497036-15497058 AGCCAGGTGGGGGTGGGTGTTGG + Intergenic
988204432 5:28115678-28115700 AGGCAGGGCGGGGTGGGTGAGGG - Intergenic
996405435 5:123098825-123098847 GGACAGGTGGGGCGGGGTGGGGG - Intronic
996871867 5:128201225-128201247 AGGCAGGTGGTGGGGGGTGAAGG - Intergenic
1000283038 5:159798816-159798838 AGGCAGATGGGGTGGGGTGAGGG - Intergenic
1002344410 5:178537403-178537425 GGCCGGGTGGGGCTGGGTGAAGG + Intronic
1002678137 5:180935731-180935753 AGCCAGGTGGGGCTGGGAGGGGG - Intronic
1002776058 6:328335-328357 AGCCAGTACGGGCTGGGTTATGG - Intronic
1002792463 6:446340-446362 AGCCAGGTTGGGCTGGGGGAGGG - Intergenic
1004731163 6:18360609-18360631 AGACAGGTGGGGTGGGGTGGGGG - Intergenic
1005251953 6:23956802-23956824 AGCCAGGAAGGGCTGGGTGCGGG - Intergenic
1005327848 6:24720152-24720174 AGCTAGGGCGGGGTGGGTGACGG + Exonic
1006472953 6:34238251-34238273 GGCCAGGGCGCGCGGGGGGAGGG - Intronic
1010534701 6:77012302-77012324 AGCCAGGTATGGAGTGGTGAGGG - Intergenic
1011818605 6:91223580-91223602 AGGCAAGTGGGGCAGGGTGAGGG + Intergenic
1012122487 6:95385192-95385214 AGCCAGGTATGGAGTGGTGAGGG - Intergenic
1012958214 6:105593459-105593481 TGCCAGCTGGGGCCGGGTGAGGG + Intergenic
1017123141 6:151042989-151043011 AGCCAGGACCGGCCAGGTGATGG - Intronic
1017898806 6:158703366-158703388 AGCCAGACCGGGCAGGGTGGTGG + Intronic
1018384656 6:163291447-163291469 GGCCAGCTCGGGCGGGCAGAGGG - Intronic
1018998694 6:168729401-168729423 GGCGAGGGGGGGCGGGGTGAGGG + Intergenic
1019345231 7:526511-526533 AGCCAGGCCGAGCGGGGCTAGGG + Intergenic
1019631923 7:2053998-2054020 AGGCAGGGCGGGAGGGGTCAGGG + Intronic
1019776409 7:2914158-2914180 AGCCAGGGCCAGCGGGGTGGGGG + Intronic
1021723892 7:23531703-23531725 AGCGCGGTCGGGCGGGGTTGCGG - Intronic
1026891117 7:73983301-73983323 AGCCAGGTTGGAGGGGATGAAGG + Intergenic
1026936598 7:74260081-74260103 GGCCAGATCGTGCAGGGTGAAGG + Intergenic
1029371792 7:100155148-100155170 CCCCAGGTCGGGCAGTGTGATGG - Exonic
1029730182 7:102433631-102433653 AGCCGAGCCGGGCGGGGCGAGGG + Exonic
1037953781 8:23037277-23037299 AGCCAGGTTGGCCTTGGTGAGGG - Intronic
1039388545 8:37158455-37158477 AGCAAGGTGGGGTGGGGTGCAGG + Intergenic
1039987756 8:42462161-42462183 AGACAGGAGGGGAGGGGTGAAGG + Intronic
1041965368 8:63669491-63669513 AGCCAGGTGTGGAGTGGTGAGGG + Intergenic
1042462181 8:69082324-69082346 AGCTAAGTCGGGCGTGGTGGCGG - Intergenic
1048986844 8:139739287-139739309 AGCCAGGGCGGGGCGGGTGGAGG - Intronic
1049182656 8:141231003-141231025 AGAGAGGCCGGGCGGGGTGGGGG - Intronic
1049327657 8:142031953-142031975 AGCCAGCTCCGGTGTGGTGAGGG + Intergenic
1049337890 8:142096204-142096226 AGCCAGGCCAGGTGGGGTGCAGG - Intergenic
1049664929 8:143838787-143838809 AGCCAGGTCAGGCATGGGGAAGG + Intronic
1051771200 9:20582133-20582155 AGCCAGGTAGAGTGGGGAGAGGG - Intronic
1053284764 9:36842939-36842961 AGCCAGGTTGGACGAGGTGTGGG + Intronic
1053367298 9:37532235-37532257 AGCCAGGTAGGGCCTGGAGATGG - Intronic
1053684499 9:40509114-40509136 AGCCAGGACCGGCCAGGTGATGG - Intergenic
1053934469 9:43137401-43137423 AGCCAGGACCGGCCAGGTGACGG - Intergenic
1054279226 9:63115838-63115860 AGCCAGGACCGGCCAGGTGATGG + Intergenic
1054297596 9:63344581-63344603 AGCCAGGACCGGCCAGGTGATGG - Intergenic
1054395610 9:64649087-64649109 AGCCAGGACCGGCCAGGTGATGG - Intergenic
1054430255 9:65154287-65154309 AGCCAGGACCGGCCAGGTGATGG - Intergenic
1054500126 9:65867245-65867267 AGCCAGGACCGGCCAGGTGATGG + Intergenic
1055044424 9:71910526-71910548 AGCCCGGGCCGGCGGGGGGAGGG - Intronic
1056349860 9:85739422-85739444 GGCCAGGACGGGCGTGGTGGCGG + Intronic
1057995850 9:99821443-99821465 AGCCAGGGCGAGGGGGGTAAGGG - Intergenic
1059457651 9:114409819-114409841 AGCAAGGTGGAGTGGGGTGAGGG - Intronic
1061091879 9:128431141-128431163 ACACAGGTGTGGCGGGGTGAGGG - Intronic
1061396142 9:130344147-130344169 CTGCAGGTCGGGAGGGGTGATGG - Intronic
1062194853 9:135267274-135267296 AGCCAGGGAGGGAGGGGTGGTGG - Intergenic
1062349667 9:136132753-136132775 AGCCAGGTTCGCCGGGGTGCAGG - Intergenic
1062629310 9:137456597-137456619 AGCCAGGGCGGGTGGGGGGAGGG + Intronic
1190264332 X:48818290-48818312 AGCCAGATCGGCCGGGCTGCGGG + Exonic
1192167358 X:68834378-68834400 AGCCAGGTGGGGCAGAGGGAAGG + Intronic
1195675024 X:107501516-107501538 AGACAGGCCGGGCGCGGTGGCGG - Intergenic
1200092540 X:153642642-153642664 AGCCAGGCCGGGTGGGGGGTGGG - Intronic
1200829128 Y:7673407-7673429 AGCCGGGGCTGGCGGGGGGAGGG - Intergenic