ID: 901055589

View in Genome Browser
Species Human (GRCh38)
Location 1:6447455-6447477
Sequence GCCAGGTCGGGCGGGGTGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 3, 1: 0, 2: 0, 3: 8, 4: 138}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901055579_901055589 19 Left 901055579 1:6447413-6447435 CCAGAAAACAAATCCTGCGGTGT 0: 1
1: 2
2: 0
3: 6
4: 103
Right 901055589 1:6447455-6447477 GCCAGGTCGGGCGGGGTGAAGGG 0: 3
1: 0
2: 0
3: 8
4: 138
901055580_901055589 6 Left 901055580 1:6447426-6447448 CCTGCGGTGTCGCATTTCCTGCA 0: 1
1: 2
2: 0
3: 5
4: 54
Right 901055589 1:6447455-6447477 GCCAGGTCGGGCGGGGTGAAGGG 0: 3
1: 0
2: 0
3: 8
4: 138
901055578_901055589 20 Left 901055578 1:6447412-6447434 CCCAGAAAACAAATCCTGCGGTG 0: 1
1: 2
2: 0
3: 16
4: 117
Right 901055589 1:6447455-6447477 GCCAGGTCGGGCGGGGTGAAGGG 0: 3
1: 0
2: 0
3: 8
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901055589 Original CRISPR GCCAGGTCGGGCGGGGTGAA GGG Intronic
900204428 1:1426030-1426052 GCAACGTGGGGCGGGGTTAAAGG + Intergenic
900582032 1:3414162-3414184 GCCAGTTAGGCCGGGGTGCACGG + Intronic
901055589 1:6447455-6447477 GCCAGGTCGGGCGGGGTGAAGGG + Intronic
901438085 1:9261724-9261746 GCCAGGCAGGGCGGGGCGAGGGG + Intronic
901987401 1:13086760-13086782 GCCAAGTCAGGTGGGGGGAATGG + Intergenic
901994411 1:13140007-13140029 GCCAAGTCAGGTGGGGGGAATGG - Intergenic
902478801 1:16701182-16701204 GCCAGGTCGGGCGGGGTGAAGGG - Intergenic
902802107 1:18836953-18836975 GCCAGGTAGGGCGGAGGGAAGGG + Intergenic
903024459 1:20417640-20417662 GCAAGGGCTGGCGGGGTGATGGG - Intergenic
906867882 1:49441934-49441956 GCCAGGTCAGCCGTGGTGAGTGG - Intronic
910370766 1:86513043-86513065 GCCAGGTCAGCCTTGGTGAATGG - Intergenic
920244738 1:204579056-204579078 GCCAGGAAGGAGGGGGTGAAGGG + Intergenic
921898388 1:220424507-220424529 GGCAGGTGGGGAGGAGTGAAAGG - Intergenic
922801849 1:228368109-228368131 GCCAGGTGAGGCGGGGTGGCAGG - Intronic
923766129 1:236893835-236893857 GCCATGTGGGGTGGGGTCAAGGG - Intronic
1064737688 10:18399513-18399535 GCCAGGTGGGGAGGGAGGAAGGG + Intronic
1066370669 10:34815615-34815637 TGCTGGGCGGGCGGGGTGAAGGG - Intergenic
1067416379 10:46106318-46106340 GCCAGGTCGCGCGGGGAGGGAGG + Intergenic
1070257594 10:74825411-74825433 GCCAGGCCGGGCGGGCTGGCGGG + Intergenic
1072906267 10:99457014-99457036 GGAAGGTAGGGCGGGGTGACTGG - Intergenic
1075627470 10:123973041-123973063 GCCAGGCCGGGGCGGGTGATGGG + Intergenic
1076883856 10:133252434-133252456 GCAGGGTGGGGCGGGGTGCAGGG - Intergenic
1077062535 11:624177-624199 GCCGGGTGGGGCGGGGAGAGCGG + Intronic
1079076596 11:17388734-17388756 GGCAGGCTGGGCGGGGAGAAGGG - Intronic
1082873224 11:57962706-57962728 GGCAGGTCGGGGGCGGGGAATGG + Intergenic
1083448430 11:62726729-62726751 GCCGGGTCAGGCGGGGTAAATGG - Exonic
1084657703 11:70528767-70528789 GCCAAGTGGGGGAGGGTGAAAGG + Intronic
1085642584 11:78201862-78201884 GGCAGGTTGGGTGGGGTGAAGGG + Intronic
1089653781 11:119932645-119932667 GCCAGGTCGGGAAGGGGGCAGGG + Intergenic
1096037540 12:48485836-48485858 GACAGGTTAGGCGGGGTGAAGGG + Intronic
1096771461 12:53938596-53938618 TCGAGGTGGGGCGGGGCGAAAGG - Intergenic
1096778099 12:53975863-53975885 GCAAGGTGGGGCGGGGTAGAGGG - Exonic
1097437705 12:59571368-59571390 GCCAGGTCGGCCTTGGTGAGTGG + Intergenic
1100338989 12:93660130-93660152 GCAAGATAGGGCAGGGTGAATGG - Intergenic
1104906037 12:132214019-132214041 GCCAGGTCAGGCGTGGGGATGGG + Intronic
1106567396 13:30898112-30898134 GCAAGGCAGGGCAGGGTGAATGG + Intergenic
1114259179 14:21025185-21025207 GGCAGTCTGGGCGGGGTGAAAGG - Intronic
1117805366 14:59484710-59484732 CCGAGGGCGGGCGGGGTCAAGGG - Exonic
1121495193 14:94387506-94387528 TCAAGGTCGGGTGGGGTGAGGGG + Intronic
1122030497 14:98908260-98908282 GGCAGGTGGGGCGGGGTGGCAGG - Intergenic
1122645220 14:103189413-103189435 CGCGGGCCGGGCGGGGTGAAGGG + Intergenic
1123041815 14:105493335-105493357 GCCAGGCCCGACGGGGTGAGAGG - Intronic
1126353084 15:47765227-47765249 GCTAGGGCGAGGGGGGTGAATGG + Intronic
1126670442 15:51110884-51110906 GCCAGGGCGGGCTAGGTGGAAGG - Intergenic
1127147168 15:56036118-56036140 GCCAGGTGGTGCTGGGTGAGAGG - Intergenic
1128217051 15:65941854-65941876 GCCCTGTCTGGAGGGGTGAAGGG - Intronic
1132844285 16:1992790-1992812 GCCCGGGAGGGCGGGGCGAAGGG + Intronic
1132885254 16:2179566-2179588 GCCAGCCAGGGTGGGGTGAAGGG - Intronic
1134291214 16:12903638-12903660 GTCCGGGCGGGCGGGGTGGAAGG + Intronic
1140712250 16:77689387-77689409 GGGAGGTGGGGTGGGGTGAAGGG - Intergenic
1141992630 16:87619406-87619428 GCCAGGTGGGCTGGGGTGCAGGG - Intronic
1142287351 16:89176881-89176903 GCCATGTCGGGCAGGGGGACGGG - Intronic
1142847449 17:2689107-2689129 GCCAGGTGGGGAGGGGTGCTGGG - Intergenic
1143183062 17:4996072-4996094 GCCAGTTGGGGTGGGGAGAAAGG + Intronic
1143370492 17:6435998-6436020 GCAAGGTCTGGCTGGGGGAAGGG + Intergenic
1144790625 17:17856627-17856649 TCCAGGTGGGGTGGGGTGAGAGG - Intronic
1148752231 17:49951907-49951929 GCCAGGACGGCGGGGGTGGAGGG + Intergenic
1150294089 17:63998663-63998685 GCCAGGTGGGGTGGGGGGAATGG - Intronic
1152584571 17:81183293-81183315 GCCAGGTGGGGCTGGGAGATGGG - Intergenic
1152627961 17:81396894-81396916 GCCAGGTCGGGCTGAGGTAAGGG - Intronic
1159961525 18:74559067-74559089 GGCAGGACGGGCTGGGAGAAAGG - Intronic
1161129419 19:2579340-2579362 GCCAGGGCGGGCGGGCAGGAGGG + Intronic
1161397577 19:4052612-4052634 CCCAGGGCGGGCGGGGGGCAGGG + Intronic
1162057305 19:8072203-8072225 GCCAGGATGGGCAGGGTGGAGGG + Intronic
1162452167 19:10761780-10761802 GCCAGGTTGGGCGGGGCCAGAGG - Intronic
1162968184 19:14165575-14165597 GGCAGGGCGGGTGGGGTGACGGG - Intronic
1163167566 19:15508478-15508500 GCACGGCCGGGCGGGGTTAAAGG + Exonic
1163187980 19:15653006-15653028 CCCAGGTAGGGAGGGGAGAAGGG + Intronic
1165904832 19:39187523-39187545 GCCAGGTCGGGAGGGGGCAGGGG - Intergenic
1166121756 19:40690878-40690900 GCCAGGACGGACCGGGGGAAAGG - Intronic
1167951747 19:53033125-53033147 GCCAGGTCAGCCTTGGTGAATGG - Intergenic
1202712820 1_KI270714v1_random:27013-27035 GCCAGGTCGGGCGGGGTGAAGGG - Intergenic
925714478 2:6772000-6772022 GCCAGGGAGGGCCCGGTGAAAGG - Intergenic
927122204 2:19976369-19976391 GCCAGATTGGGAGGGGTTAAGGG - Intronic
928194963 2:29209050-29209072 CCCAGGTCGGGCAGGATGCAGGG - Intronic
929550431 2:42887230-42887252 GCCAGGTCAGCCTTGGTGAAGGG - Intergenic
931304762 2:61017639-61017661 GCAAGGGTGGGCGGGGTGGACGG + Intronic
934733286 2:96672863-96672885 GCCAGGGCTGGCTGGGTGGAGGG + Intergenic
937251601 2:120527504-120527526 GCCAGGGAGAGCGGGGTGAGGGG - Intergenic
938746382 2:134282278-134282300 GCCATGCCGGGCTGGGTGTACGG + Intronic
941245058 2:163085960-163085982 GCGAGGTCTGGCGGAGTCAAAGG - Intergenic
948438090 2:237967290-237967312 GCGAGGCCGAGCGGCGTGAATGG + Intronic
948884114 2:240874477-240874499 GCCAGGCCGGGCAGGGGGTAGGG + Intronic
1169116933 20:3072052-3072074 GCGGGGACGGGCGGGGTGAGCGG - Intronic
1169118738 20:3083181-3083203 GCGGGGACGGGCGGGGTGAGCGG + Intronic
1170889035 20:20364055-20364077 GCCCGGGCGGGCGGCGGGAAGGG - Intergenic
1171949217 20:31406001-31406023 GACAGGTTGGGCTGGGAGAATGG - Intronic
1172070367 20:32252265-32252287 GCAAGGTTGGGCAGGATGAAGGG + Intergenic
1172149536 20:32780284-32780306 GCCAGAATGGGTGGGGTGAAAGG - Intronic
1172789253 20:37491165-37491187 GCCAGTTTGGGTGGGGGGAATGG - Intergenic
1172867884 20:38113658-38113680 GCCTGGTGGGGCGGGGTTAGGGG + Intronic
1181162170 22:20965471-20965493 GCAAGGTCTGGCGGGGGCAACGG + Intronic
1184066533 22:42124778-42124800 GCCAGGTCAGCTGTGGTGAAAGG - Intergenic
1184069001 22:42136930-42136952 GCCAGGTCAGCTGTGGTGAAAGG - Intergenic
950720138 3:14876902-14876924 GGCAGGTCGGGAGGGGTCCAGGG - Intronic
950793388 3:15491509-15491531 GCCAGGTCGTGCGGTGTCCACGG + Intronic
954374823 3:50188726-50188748 GCCAGGCGGGGAGGGGAGAAGGG - Exonic
954540953 3:51392585-51392607 GCCATGTCGGGCCGAGTGATTGG + Exonic
954652926 3:52176249-52176271 TCCTGGTGGGGCGGGGTGCAAGG - Intergenic
957083100 3:75655559-75655581 GCCAGCTCGGGCTGGGGGAGGGG + Intergenic
961055981 3:123789323-123789345 GCCTGGGGGGGCGGGGTCAAAGG - Intronic
962071051 3:132034318-132034340 CCCAGGTGGGGTGGGGCGAATGG - Intronic
963331684 3:143922489-143922511 GCCAGGTCAGGCTTGGTGAGTGG + Intergenic
965171128 3:165265702-165265724 GGGAGGACGGGAGGGGTGAAGGG - Intergenic
966411829 3:179653081-179653103 GCCGGGGCGGGCGGGGAGAGCGG - Exonic
968435780 4:588233-588255 GCCAGGTGGGGCGGGGGATATGG + Intergenic
968565705 4:1311551-1311573 GCCAGGCCGGGCAGGGACAAGGG - Intronic
968653248 4:1768112-1768134 GCCAGGTGGGGGGTGGGGAAGGG - Intergenic
968736139 4:2297434-2297456 GCCAGGTGGGGCGCGGTGGGTGG + Intronic
968956496 4:3722299-3722321 GTCAGGTGGGGCCGGGTGGAGGG + Intergenic
969758378 4:9165258-9165280 GACAGGCCTGGCGGGGTGGAGGG - Intergenic
972788319 4:42347288-42347310 GCCAGGCCCGGAGTGGTGAAGGG - Intergenic
986402665 5:7395692-7395714 GCCAGGTGGGGCGGGGGGAGTGG + Intergenic
989307378 5:39973738-39973760 GCCAGGTCAGCCTTGGTGAATGG + Intergenic
993319941 5:86459464-86459486 GCCAGGTCAGTCTTGGTGAATGG - Intergenic
994539630 5:101077795-101077817 GCCAGGTCAGCCTTGGTGAATGG - Intergenic
996871866 5:128201224-128201246 GGCAGGTGGTGGGGGGTGAAGGG - Intergenic
998977755 5:147667172-147667194 GCGGGGTGGGGCAGGGTGAAGGG + Intronic
1001173731 5:169445525-169445547 GCCAGGTCAGCCTTGGTGAATGG - Intergenic
1002139991 5:177132765-177132787 GCCGGGCCGTGCGGGGTGAGCGG - Intergenic
1002344411 5:178537404-178537426 GCCGGGTGGGGCTGGGTGAAGGG + Intronic
1002801197 6:522749-522771 GCCAGGTCTGAGGGGATGAAAGG + Intronic
1002978654 6:2112030-2112052 GCCAGAGCGGGCGTGGGGAAGGG - Intronic
1003791354 6:9550933-9550955 GCCAGGTCAGCCTTGGTGAATGG - Intergenic
1004007457 6:11650331-11650353 GCAAGGTTGGGGGAGGTGAAGGG - Intergenic
1006001674 6:30969959-30969981 GCCAGGTCAGCCTTGGTGAATGG - Intergenic
1006472952 6:34238250-34238272 GCCAGGGCGCGCGGGGGGAGGGG - Intronic
1012288690 6:97424048-97424070 GCCAGGTCAGGCTTGGTGAATGG + Intergenic
1012958215 6:105593460-105593482 GCCAGCTGGGGCCGGGTGAGGGG + Intergenic
1013098368 6:106966805-106966827 GCCAGGTTGGCCACGGTGAATGG - Intergenic
1018384655 6:163291446-163291468 GCCAGCTCGGGCGGGCAGAGGGG - Intronic
1027236970 7:76303878-76303900 GCCAGGTCGGGGTGGGTGGGTGG + Intronic
1032391564 7:131558077-131558099 GCCAGATGGGGCTGGGTGGAGGG + Intronic
1035632100 8:1116013-1116035 GCCACGTCTGACGGAGTGAATGG - Intergenic
1039388546 8:37158456-37158478 GCAAGGTGGGGTGGGGTGCAGGG + Intergenic
1049081139 8:140444435-140444457 GCCAGGACGGAGGCGGTGAAGGG + Intronic
1049337889 8:142096203-142096225 GCCAGGCCAGGTGGGGTGCAGGG - Intergenic
1049664930 8:143838788-143838810 GCCAGGTCAGGCATGGGGAAGGG + Intronic
1053010325 9:34629101-34629123 GGCAGGGCGGGCGGGGCGCATGG + Intergenic
1060183878 9:121552180-121552202 GCCAGACAGGGCTGGGTGAAGGG - Intergenic
1186090987 X:6048840-6048862 GTCAGGGAGGGCGGGGGGAAGGG + Intronic
1192167359 X:68834379-68834401 GCCAGGTGGGGCAGAGGGAAGGG + Intronic
1192898832 X:75472789-75472811 GCCAGGTCGACCGTGGTGAGTGG - Intronic
1194179487 X:90695046-90695068 GCCAGGTCAGCCTGGGTGACTGG + Intergenic
1197415488 X:126167050-126167072 CCCAGGGCGGGTGGAGTGAAGGG + Intergenic
1197420002 X:126227214-126227236 GCCAGGTCAGCCTTGGTGAATGG - Intergenic
1199724740 X:150568884-150568906 GCCACCTTGGGCGGGGAGAACGG - Intronic
1200440410 Y:3206117-3206139 GCCAGGTCAGCCTTGGTGAATGG + Intergenic
1200526150 Y:4277219-4277241 GCCAGGTCAGCCTGGGTGACTGG + Intergenic