ID: 901055591

View in Genome Browser
Species Human (GRCh38)
Location 1:6447462-6447484
Sequence CGGGCGGGGTGAAGGGTCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 258
Summary {0: 3, 1: 0, 2: 0, 3: 25, 4: 230}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901055578_901055591 27 Left 901055578 1:6447412-6447434 CCCAGAAAACAAATCCTGCGGTG 0: 1
1: 2
2: 0
3: 16
4: 117
Right 901055591 1:6447462-6447484 CGGGCGGGGTGAAGGGTCTGAGG 0: 3
1: 0
2: 0
3: 25
4: 230
901055579_901055591 26 Left 901055579 1:6447413-6447435 CCAGAAAACAAATCCTGCGGTGT 0: 1
1: 2
2: 0
3: 6
4: 103
Right 901055591 1:6447462-6447484 CGGGCGGGGTGAAGGGTCTGAGG 0: 3
1: 0
2: 0
3: 25
4: 230
901055580_901055591 13 Left 901055580 1:6447426-6447448 CCTGCGGTGTCGCATTTCCTGCA 0: 1
1: 2
2: 0
3: 5
4: 54
Right 901055591 1:6447462-6447484 CGGGCGGGGTGAAGGGTCTGAGG 0: 3
1: 0
2: 0
3: 25
4: 230
901055583_901055591 -4 Left 901055583 1:6447443-6447465 CCTGCAACGTGAGCCAGGTCGGG 0: 3
1: 0
2: 0
3: 7
4: 55
Right 901055591 1:6447462-6447484 CGGGCGGGGTGAAGGGTCTGAGG 0: 3
1: 0
2: 0
3: 25
4: 230

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901055591 Original CRISPR CGGGCGGGGTGAAGGGTCTG AGG Intronic
900393605 1:2444184-2444206 GGTGCGGGGTGAGGGATCTGGGG + Intronic
900552320 1:3263099-3263121 CAGGCAGGCTGCAGGGTCTGTGG - Intronic
900624816 1:3603299-3603321 CCTGCGGGGGGAAGGGTCAGAGG + Intronic
900643563 1:3698588-3698610 GGGACGTGGAGAAGGGTCTGGGG + Intronic
900833849 1:4985021-4985043 CGGGCGGGGAGGACGGACTGTGG + Intergenic
900951086 1:5858616-5858638 CGGGCGGCGCTGAGGGTCTGAGG - Intergenic
901055591 1:6447462-6447484 CGGGCGGGGTGAAGGGTCTGAGG + Intronic
902393289 1:16118741-16118763 GGGGAGGGGTGCAGAGTCTGGGG + Intergenic
902478799 1:16701175-16701197 CGGGCGGGGTGAAGGGTCTGAGG - Intergenic
903879135 1:26496969-26496991 CGGGCGGGGTGGGGGGTGTTGGG - Intergenic
903907560 1:26697057-26697079 CGGGCGGGGGGTAGGCGCTGCGG - Exonic
903929706 1:26855160-26855182 TGGGTGGGGTGATGGCTCTGGGG + Exonic
904037913 1:27568681-27568703 CGGCCGGGGGAAAGGGTCCGGGG - Intronic
904889866 1:33771722-33771744 TGAGCCGGGTGAAGGATCTGAGG + Intronic
906102192 1:43270855-43270877 GGGGCGGGGTGGAGGTTCTCAGG - Intronic
906430339 1:45750746-45750768 CGGGCGGTGGGAAGGGACTTCGG + Intergenic
906684829 1:47756557-47756579 GGGACGGGGTGAAGGGTGAGAGG + Intergenic
907197422 1:52698099-52698121 CGGGCGGGGGACGGGGTCTGTGG - Intronic
911647523 1:100352417-100352439 AGGGCGGGGAGGAAGGTCTGGGG + Intronic
913559890 1:120007044-120007066 TGGGAGGGGTGAAGAGGCTGTGG - Intronic
914280476 1:146166463-146166485 TGGGAGGGGTGAAGAGGCTGTGG - Intronic
914541519 1:148617403-148617425 TGGGAGGGGTGAAGAGGCTGTGG - Intronic
914625120 1:149453844-149453866 TGGGAGGGGTGAAGAGGCTGTGG + Intergenic
915309352 1:154999593-154999615 CGGGGGGCGTGGGGGGTCTGCGG + Intergenic
915530004 1:156497922-156497944 CGGTAGAGGAGAAGGGTCTGAGG + Intronic
917107240 1:171504723-171504745 CTGGCGGGGTGGAGGGTAGGGGG + Intronic
918229577 1:182515558-182515580 GGGGCGGGGTGGAGGGCGTGGGG + Intronic
920071694 1:203307018-203307040 AGGGCGGGGTGGAGGGTCAAGGG - Intronic
923519276 1:234723383-234723405 AGGGTGGGGTGGAGGGGCTGGGG + Intergenic
923733006 1:236571385-236571407 AGGGCATGGTGATGGGTCTGCGG + Exonic
924296572 1:242592918-242592940 GGGGCGGGGTGGGGGGTGTGGGG + Intergenic
924952270 1:248896014-248896036 CGGGGCGGGGGAAGGGTCGGAGG - Intergenic
1063089811 10:2853487-2853509 AGGGCTGGCTGCAGGGTCTGTGG - Intergenic
1066370665 10:34815608-34815630 CGGGCGGGGTGAAGGGGGCTGGG - Intergenic
1069015102 10:63420607-63420629 GGGGCGCGGGGCAGGGTCTGAGG + Intronic
1070769199 10:79072453-79072475 CGGGAGGGGTGAAGGGATTTAGG + Intronic
1070831823 10:79422424-79422446 GGGGAGGGGTGCAGGGGCTGGGG + Intronic
1073181881 10:101588347-101588369 CGGGCTGGTTGGAGAGTCTGCGG + Exonic
1073216651 10:101840239-101840261 GGGGCGGGGTGCAGGGTGCGGGG - Intronic
1075197695 10:120375278-120375300 GGGGCTGGGGGCAGGGTCTGTGG + Intergenic
1076096735 10:127738858-127738880 GGGGAGGGGTTAAGGGTCTGGGG - Exonic
1076553450 10:131304374-131304396 CAGACGTGGAGAAGGGTCTGGGG - Intronic
1076946683 10:133656465-133656487 CAGGGTGGGTGAAGGGCCTGGGG - Intergenic
1077377203 11:2210663-2210685 AGTGCAGGGTGATGGGTCTGTGG - Intergenic
1077714572 11:4568776-4568798 CTGCAGGGGTGAAGGATCTGAGG - Intergenic
1079024962 11:16939858-16939880 TGTGTGGGGTGAAGGGACTGGGG + Intronic
1079665152 11:23095216-23095238 TGGGGGGGGTGAAGGGTTTGGGG + Intergenic
1084273219 11:68039763-68039785 TGGGCGGGGGGAAAGGTGTGGGG - Intronic
1084410156 11:69002252-69002274 AGGGTGGGGTGAAGGGGCAGGGG - Intergenic
1084488304 11:69463879-69463901 GGGGCGGGGGGATGGCTCTGGGG - Intergenic
1084615835 11:70235238-70235260 CAGGCTGGGTGAAGGGACTAAGG + Intergenic
1087159377 11:94934237-94934259 CTGGTGGGGTGAAAGGGCTGAGG + Intergenic
1089173444 11:116532214-116532236 CGGGCGTGGGGAAGGGACGGGGG - Intergenic
1090660801 11:128880454-128880476 CAGGCGGGGTCAGGGGCCTGGGG + Intergenic
1094502909 12:31036559-31036581 GGCATGGGGTGAAGGGTCTGTGG - Intergenic
1096718025 12:53502577-53502599 CGGGCGGGGGGAGGAGTCGGGGG - Intronic
1098741528 12:74178961-74178983 CGGCTGGGGTTAAGTGTCTGTGG + Intergenic
1099739062 12:86607837-86607859 CTGGCGGGGTGCAGGGTTGGGGG + Intronic
1100985700 12:100199988-100200010 CGGGCGGGGGCAAGGGCCAGCGG - Intronic
1102602537 12:114043012-114043034 GAGGCTGGGTGAAGGGTATGTGG - Intergenic
1103918427 12:124387699-124387721 CGGGCGGAGGGAAAGGTCAGGGG - Intronic
1103954406 12:124568141-124568163 CGGGCTGGGTCTCGGGTCTGGGG - Intergenic
1104135845 12:125937664-125937686 CGGGCTGGGTGAAGGTTGTCTGG - Intergenic
1104849191 12:131863227-131863249 AGGGAGGGGTGAAGGGTCGGGGG + Intergenic
1109378321 13:61525607-61525629 GGGGCGGGGTGAGGGGTGGGGGG - Intergenic
1109515614 13:63439699-63439721 GGGGCGGGGGGAATGGTCAGTGG + Intergenic
1114176377 14:20324120-20324142 GGGGCGGGGTGAAGGTAATGAGG + Intronic
1114470359 14:22957037-22957059 CGGGCCGGGCGCAGGGGCTGGGG + Exonic
1117913898 14:60657494-60657516 CGCGCGGCGGGAAGGGTCTGGGG + Intronic
1118008917 14:61590282-61590304 CAGGCAGGGAGAAGAGTCTGAGG + Intronic
1119744431 14:77033962-77033984 CCGGCGGGGTGGAGGGTCCGGGG - Intergenic
1122754769 14:103969820-103969842 GGGGCGGGGTGGGGGGGCTGTGG + Intronic
1202920766 14_KI270723v1_random:29019-29041 CAGGGTGGGTGAAGGGCCTGGGG - Intergenic
1202924150 14_KI270724v1_random:8562-8584 CAGGGTGGGTGAAGGGCCTGGGG + Intergenic
1124623933 15:31297481-31297503 GGGGTGGGGAGAAGGGTATGCGG + Intergenic
1126965254 15:54044553-54044575 CAGGCGGGGTGGGGGGTGTGGGG + Intronic
1127940340 15:63688881-63688903 GGGGCTGGGGGAAGGGTTTGAGG + Intronic
1128453797 15:67821885-67821907 CAGGCCTGGTGAAGGGACTGAGG - Intronic
1128511011 15:68313916-68313938 CAGGCAGCGGGAAGGGTCTGAGG + Intronic
1129035493 15:72646261-72646283 TGGGAGGGATGAGGGGTCTGGGG + Intergenic
1129214391 15:74090955-74090977 TGGGAGGGATGAGGGGTCTGGGG - Intergenic
1129266002 15:74393396-74393418 CAGGCAGGGTGAAGGGAATGTGG + Intergenic
1129391020 15:75220974-75220996 CGGGAGGGATGAGGGGTCTGGGG + Intergenic
1129473289 15:75766903-75766925 CGGGAGGGATAAGGGGTCTGGGG - Intergenic
1129731531 15:77935301-77935323 CGAAAGGGATGAAGGGTCTGGGG - Intergenic
1132484163 16:181525-181547 CGGGCGGCGTTAAGGGCCCGGGG + Intergenic
1132943640 16:2520576-2520598 CGGGCGGGGTGCAGGGTGCGGGG + Intronic
1132943655 16:2520607-2520629 CGGGCGGGGTGCAGGGTGCGGGG + Intronic
1132943669 16:2520638-2520660 AGGGCGGGGTGCAGGGTGCGGGG + Intronic
1132943684 16:2520669-2520691 CGGGCGGGGTGCAGGGTGCGGGG + Intronic
1132943699 16:2520700-2520722 CGGGCGGGGTGCAGGGTGCGGGG + Intronic
1132991878 16:2799588-2799610 CGGGTGGGGTGATGGGGGTGCGG + Intergenic
1133286797 16:4694370-4694392 GGGGTGGGGAGAGGGGTCTGGGG + Intronic
1135048005 16:19169605-19169627 CCGGCAGGCTGAAGCGTCTGAGG - Intronic
1135247086 16:20866432-20866454 GGGGCGGGGTGAGTGGCCTGGGG - Intronic
1135834772 16:25815270-25815292 GGGGCTGGGTGCAGGGTTTGTGG + Intronic
1136382495 16:29901969-29901991 CTGGCGGAGAGAAGGGTCTGGGG - Intronic
1137825725 16:51493212-51493234 AGGCCTGGGTGAAGGGTTTGGGG - Intergenic
1138401976 16:56753935-56753957 GGGGCTGGGTGATGGGTATGAGG + Intronic
1138686923 16:58734055-58734077 CGGGAGGGGTGAATGTCCTGGGG + Intronic
1138835146 16:60425734-60425756 GGGGCGGGGGGTAGTGTCTGTGG - Intergenic
1139599895 16:67980206-67980228 CCGGCGTGGTGAAGAGGCTGGGG + Exonic
1140473860 16:75228977-75228999 CGGGGTGGGTGACGGTTCTGGGG - Intronic
1141766103 16:86060903-86060925 AGGGAGGGGTGAAGGGGCTGAGG + Intergenic
1143563809 17:7709682-7709704 CGGGAGGAGTGAAGGGGCTGGGG - Exonic
1145370484 17:22302957-22302979 CGGCAGGGGAGAAGGGGCTGCGG - Intergenic
1147185836 17:38712747-38712769 CGGGCGGGGTGAGGATGCTGGGG - Exonic
1148328394 17:46797498-46797520 CGGGCGGGAAGAAGGGCCTTGGG + Intronic
1148748840 17:49932986-49933008 CTGGAGGGGTGAGGGGTGTGGGG - Intergenic
1152477336 17:80526762-80526784 CTGGCGGGGGGCAGGGGCTGAGG - Intergenic
1152613932 17:81329452-81329474 CTGGCGGGGTGAGTGGGCTGAGG - Intronic
1152677309 17:81648249-81648271 CGGGCGGGGCGCCGGGGCTGGGG - Exonic
1152782330 17:82231843-82231865 CGGGCTGCGCGAGGGGTCTGCGG + Intronic
1152870951 17:82752629-82752651 CGCACGGGGTGAAGCCTCTGCGG + Intronic
1154092587 18:11379070-11379092 AGGGTGGGGTGGAGGGCCTGAGG - Intergenic
1157118970 18:44890243-44890265 GGGGTGGGGTGAGGGGTTTGAGG - Intronic
1157386211 18:47261472-47261494 AGGGTGGGGTGATGGGGCTGGGG - Intergenic
1157867293 18:51197495-51197517 AGGGCGGGGTGGAGGGGCAGGGG + Intronic
1157880914 18:51320340-51320362 CTGGCTGGGTGAAGGGGCTCAGG - Intergenic
1158652631 18:59301271-59301293 CACACGGGGTGAAGAGTCTGTGG - Intronic
1160663393 19:311949-311971 CGGCCGGGGAGAACGGTCAGTGG + Intronic
1160767207 19:813896-813918 CTGTCGGGGAGAGGGGTCTGGGG + Intronic
1161337366 19:3721801-3721823 CGGGCTGGGGGAGGGGGCTGAGG - Exonic
1161479699 19:4504379-4504401 GGGGCGGGGAGAAAGTTCTGAGG + Exonic
1161564268 19:4991207-4991229 GGGGCTGGGTGAGGGGCCTGGGG - Intronic
1161808901 19:6460246-6460268 CGGGCGGGAAGAAGGGACAGTGG - Intronic
1162111981 19:8404376-8404398 CGGGCGGGGTGACGGGGACGGGG - Exonic
1163103182 19:15109580-15109602 CTGGCGGGGAGGAGGGTGTGAGG - Intronic
1163969246 19:20776474-20776496 CGAGAGAGGTGAAGTGTCTGTGG + Intronic
1165420841 19:35721212-35721234 CGGGGGAGGTGGAGGGGCTGGGG - Exonic
1165436429 19:35797705-35797727 AGGGCTGGGGGAAGGGTCTGAGG + Intergenic
1165744683 19:38223904-38223926 CTGGCGGGGTGGAGGGCGTGGGG - Intronic
1166039066 19:40191463-40191485 CGGGCGGGGGGCAGGGGCTGGGG + Intergenic
1167638743 19:50668843-50668865 CAGGCGGGGTGGAGGGTCGTCGG + Exonic
1167738674 19:51311700-51311722 GGGGCGGGGGGAGGGGGCTGGGG - Intergenic
1202712818 1_KI270714v1_random:27006-27028 CGGGCGGGGTGAAGGGTCTGAGG - Intergenic
924971670 2:133690-133712 TGGGAGGGGTGCAGGGTCTGTGG + Intergenic
925893958 2:8457194-8457216 CGGGCGGGGTAAACGGGCTGGGG + Intergenic
927429492 2:23015215-23015237 AGGGCAGGGTGAGGGGTGTGGGG - Intergenic
928606410 2:32947825-32947847 CGGGCGGGCGGAAGGGGGTGTGG - Intronic
929491416 2:42399967-42399989 CAGGCTGGGTGCAGTGTCTGTGG + Intronic
933724852 2:85420880-85420902 GGGACGGGGTGAGGGGACTGTGG + Intronic
935116824 2:100144006-100144028 CGGACGGGAAGAAGGATCTGAGG - Intergenic
936152668 2:110030189-110030211 CAGGCGGGAGGAAGGGGCTGTGG + Intergenic
936192012 2:110341223-110341245 CAGGCGGGAGGAAGGGGCTGTGG - Intergenic
936278872 2:111121448-111121470 CGGGCCTGGTGAAGGGTCGTAGG + Intronic
937870786 2:126784619-126784641 AGGGGGAGGTGAAGGGGCTGGGG + Intergenic
945003450 2:205376800-205376822 TGGGTGAGGTGGAGGGTCTGGGG + Intronic
946851353 2:223909787-223909809 CGGCCTGGGTGAAGGGACAGTGG - Intronic
947591642 2:231389195-231389217 CGGGTGGTGTTAAGGGTTTGTGG + Intergenic
947611891 2:231530036-231530058 CGGGCGGGAGGAAGGGTGTGGGG - Intronic
948123301 2:235546632-235546654 CTGGCGTGGTGACGGGTGTGTGG + Intronic
948763981 2:240210243-240210265 GGGGCGGGGTGGCGGGGCTGTGG - Intergenic
948771875 2:240255354-240255376 CTAGCGGGATGCAGGGTCTGGGG - Intergenic
948806002 2:240453628-240453650 CGGGCGGGGAGAGGGGGCTGCGG - Intronic
1168867262 20:1098006-1098028 TGGGTGGGGTGAAGGGTAAGGGG + Intergenic
1171379346 20:24722309-24722331 TGGGCAGGGTGAGGGGTATGAGG + Intergenic
1172109405 20:32536476-32536498 CGGGCGGGGGGCAGGGGCGGGGG + Intronic
1172357649 20:34291087-34291109 CGATCGGGGTGAAGGGCTTGTGG - Intronic
1172366035 20:34350262-34350284 AGGCCGAGGTGAAGGGTCGGTGG + Intergenic
1172776969 20:37413533-37413555 GGGGCCGGGTGATGGGTGTGGGG - Intergenic
1176414996 21:6468946-6468968 CAGGCTGGCTGAAGGCTCTGAGG - Intergenic
1178865189 21:36320724-36320746 GGGGCGGGGGGACGGGGCTGCGG + Intronic
1179502665 21:41819894-41819916 CTGGAGGGGTGAGGGGGCTGGGG + Intronic
1179690496 21:43077278-43077300 CAGGCTGGCTGAAGGCTCTGAGG - Intergenic
1179874198 21:44259396-44259418 CCAGGGGGGTGAAGGGGCTGAGG - Intronic
1179889051 21:44326628-44326650 CGGGGGGGGTGGGGGGGCTGGGG + Intronic
1180056356 21:45361153-45361175 GGGGCAGGGTGAGGGGTCTGGGG + Intergenic
1180064855 21:45407077-45407099 CGGGCTGGGGGAGGGGTGTGTGG - Intronic
1181235452 22:21445557-21445579 CTGGCGGGGAGGCGGGTCTGGGG + Exonic
1181452065 22:23029705-23029727 GGGGCTGGGTGAAGGGCCTCAGG - Intergenic
1183106349 22:35617777-35617799 CTGGCTGGGTGAGGGGTCTCTGG - Intronic
1183302176 22:37063807-37063829 CAGGGTGGGTGGAGGGTCTGGGG - Intergenic
1184413280 22:44338021-44338043 CGGGCAGGGTGAGGGGGCTCCGG + Intergenic
1184717776 22:46291569-46291591 TGGGTGGTGTGAAGGGGCTGGGG - Intronic
1185283108 22:49983998-49984020 CGGGCGGTGTGGACGGGCTGCGG - Intergenic
950655261 3:14432546-14432568 GGGGCTGGGTGAAGGGTCAGAGG - Intronic
954539542 3:51384664-51384686 CGTGCGGGGTGGACGGACTGCGG - Intergenic
957080773 3:75633945-75633967 CAGGGTGGGTGAAGGGCCTGGGG + Intergenic
958878016 3:99637968-99637990 CGGGCGGTGGGACGGGGCTGAGG + Intergenic
959359342 3:105368676-105368698 CTGGCGGGGAGAGGGGTTTGGGG + Intronic
961468015 3:127093047-127093069 CTGCAGGGGTGAGGGGTCTGTGG + Intergenic
964358464 3:155870978-155871000 CGGGCTGGGGGAAGGGGGTGGGG - Intronic
965171123 3:165265695-165265717 CGGGAGGGGTGAAGGGAGGGGGG - Intergenic
966411826 3:179653074-179653096 CGGGCGGGGAGAGCGGGCTGCGG - Exonic
966977334 3:185096644-185096666 CTGACAGTGTGAAGGGTCTGCGG + Intronic
966985484 3:185175971-185175993 CGGGGGGAGTGAAGAGCCTGGGG - Intergenic
967272608 3:187743726-187743748 CGGGCGGGGAGAAAGGGCGGGGG - Intronic
968434163 4:576354-576376 CGGGCGGGGTGGGGGGTTGGGGG - Intergenic
968541447 4:1170450-1170472 CGGGAGGGATGAAGGCCCTGGGG + Exonic
968656537 4:1780730-1780752 CGGTCTGGGAGAAGGGACTGAGG + Intergenic
973774144 4:54230163-54230185 CGGGCGTGGGCAAGGGTTTGGGG + Intronic
976297339 4:83485208-83485230 GGGGCGGGGCGAGGGGGCTGAGG + Intronic
983931488 4:173457847-173457869 GGGGTGGGGTGCAGGGACTGGGG - Intergenic
985450139 4:190057264-190057286 CAGGGTGGGTGAAGGGCCTGGGG - Intergenic
985984597 5:3504197-3504219 AGGGTGGGGTGAAGTGCCTGGGG - Intergenic
986338564 5:6772130-6772152 GGGGCGGGGTGAAGGGTGCTGGG + Intergenic
987020356 5:13864009-13864031 CTGGCTGGGTGAAGGGAGTGTGG - Intronic
991144399 5:63283839-63283861 CGGGGAGGGTGGAGGGTCAGTGG + Intergenic
992610548 5:78504790-78504812 GGGCTGGGGTGAAGGGTGTGTGG - Intronic
992716120 5:79513571-79513593 CGGGGGGCGGGAAGGGGCTGAGG - Exonic
993168243 5:84384094-84384116 CGAGCGGGGAGAAGGGTGCGGGG - Intronic
996097215 5:119411629-119411651 CGGGCGGGGGGTAGGGGGTGGGG - Intergenic
998039410 5:138943086-138943108 CTGGCGGGATGCAGGGTGTGGGG - Intergenic
1000240510 5:159404241-159404263 TGGGAGCTGTGAAGGGTCTGGGG + Intergenic
1001269743 5:170302313-170302335 GGGGCTGGGGGAAGGGTCTGGGG + Intergenic
1001392214 5:171388214-171388236 CGAGCGGCCTGAAGCGTCTGGGG + Intronic
1001971357 5:175957432-175957454 GGCGGGGGGTGTAGGGTCTGGGG - Intronic
1002139745 5:177131978-177132000 CGGGCTGGGGGAAGGGCCCGAGG + Intergenic
1002246085 5:177886345-177886367 GGCGGGGGGTGTAGGGTCTGGGG + Intergenic
1002416181 5:179122019-179122041 CGGGCAGGGTGCAGGGGCAGAGG - Intronic
1002606398 5:180385337-180385359 GGGGCGGGGAGAAGGCTGTGGGG + Intergenic
1004216633 6:13710758-13710780 GGGTCGCGGTGAAGGGTCCGAGG - Intronic
1006052286 6:31354434-31354456 TGGGTGGGGTGGCGGGTCTGGGG - Intronic
1006455679 6:34130519-34130541 AGGGTGGGGTGAGGGGCCTGGGG - Intronic
1006665268 6:35688855-35688877 TGGGCGGGCTGAAGGGTTAGCGG - Intronic
1006795576 6:36730471-36730493 CAGCCGGGGTGAAGGGACAGTGG + Intronic
1010161098 6:72856877-72856899 CGGGGGAGGGGCAGGGTCTGGGG - Intronic
1013482822 6:110566790-110566812 AGGGTGGGGTGAAATGTCTGAGG - Intergenic
1017820905 6:158048443-158048465 AGGGCTGGGTCAAGGGCCTGTGG + Intronic
1018998822 6:168729999-168730021 CGTGCCAGGTGAAGGGTCTTAGG + Intergenic
1019729903 7:2623962-2623984 CGGGCAGGCTGCTGGGTCTGGGG - Intergenic
1020106939 7:5426605-5426627 CGGCCGGGGAGCAGGGCCTGGGG + Intergenic
1022502232 7:30889041-30889063 GGGGCGGGGTGAAGGGGCCTGGG + Intronic
1024359575 7:48454588-48454610 GGGGCGGGGTGCAGGGACGGTGG + Intronic
1029066314 7:97852292-97852314 CGTGCGGGCAGAAGGGTCAGTGG + Exonic
1029364769 7:100109634-100109656 CGGGAGTGGTGACGTGTCTGTGG - Intronic
1029471693 7:100758673-100758695 CGGCCTGGGGGGAGGGTCTGTGG + Intronic
1032472872 7:132190927-132190949 GGGGTGGGGTGCAGGGCCTGTGG + Intronic
1033654080 7:143361924-143361946 CGGGTGGAGGGAAGGGGCTGGGG - Intronic
1034264041 7:149772901-149772923 CGGGCAGGGTGAGGGCTGTGGGG - Intronic
1034349654 7:150407652-150407674 GGGACGGGGAGGAGGGTCTGGGG + Intronic
1035092869 7:156329182-156329204 AGGGTGTGGAGAAGGGTCTGGGG - Intergenic
1035122634 7:156581048-156581070 CGGACGTGGTGAAGCATCTGTGG + Intergenic
1035231445 7:157468416-157468438 CGGGCGGGCAGATGGGTCTGAGG - Intergenic
1035592065 8:823820-823842 CGGGGGAGGTCAAGAGTCTGCGG + Intergenic
1036706688 8:11052091-11052113 CAGAGGGGGTGAGGGGTCTGGGG - Intronic
1038726044 8:30083207-30083229 TGGGCGGGGCCAAGGGCCTGGGG + Exonic
1043866701 8:85383093-85383115 GGGGCAGGGTGCAGGGTGTGAGG - Intronic
1045244657 8:100432565-100432587 GTGGCAGGGTGAAGGGTCTGGGG - Intergenic
1049214654 8:141402146-141402168 CGCCCTGGGTGACGGGTCTGAGG + Intronic
1053739535 9:41124835-41124857 CGGGGGGGGTGGGGGGGCTGGGG + Intergenic
1055855972 9:80689190-80689212 CAGATGGGGTGAAGGGGCTGTGG - Intergenic
1056143415 9:83707133-83707155 CGGGCGGGGTGGAGGCTGGGCGG - Intronic
1057040601 9:91844880-91844902 GGGGCGGGGGGAAGGGGGTGCGG + Intronic
1061180550 9:129022815-129022837 AGGGCAGGGAGTAGGGTCTGGGG + Intronic
1061246018 9:129401656-129401678 AGGGAGGGGTGAAGTGTCTCTGG - Intergenic
1062093416 9:134690362-134690384 CAGGTGGGGTGAAGGTTCTCAGG + Intronic
1062097224 9:134709710-134709732 TGGGCTGGGAGATGGGTCTGTGG - Intronic
1062220494 9:135412644-135412666 CGGGCCGGGCGAGGGGTTTGCGG + Intergenic
1062600117 9:137315792-137315814 TGGGCGGGGAGTGGGGTCTGGGG - Intronic
1203773571 EBV:61148-61170 CGGCCGGGAAGAAGGGGCTGTGG + Intergenic
1185593691 X:1294612-1294634 AGGAAGAGGTGAAGGGTCTGTGG + Intronic
1195405846 X:104512417-104512439 GGGGCCTGGTGAAGGGTCGGGGG - Intergenic
1197446057 X:126552953-126552975 CGGGCGGGGTGAAGGCTGGGAGG + Intergenic
1200350557 X:155490036-155490058 CGGGTGGGGGGCAGGGTATGAGG - Intergenic
1201771427 Y:17620515-17620537 GGGGGGAGGTGAAGGGCCTGGGG - Intergenic
1201830128 Y:18285471-18285493 GGGGGGAGGTGAAGGGCCTGGGG + Intergenic