ID: 901055592

View in Genome Browser
Species Human (GRCh38)
Location 1:6447472-6447494
Sequence GAAGGGTCTGAGGCCACCGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 3, 1: 0, 2: 0, 3: 13, 4: 155}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901055580_901055592 23 Left 901055580 1:6447426-6447448 CCTGCGGTGTCGCATTTCCTGCA 0: 1
1: 2
2: 0
3: 5
4: 54
Right 901055592 1:6447472-6447494 GAAGGGTCTGAGGCCACCGCAGG 0: 3
1: 0
2: 0
3: 13
4: 155
901055590_901055592 -7 Left 901055590 1:6447456-6447478 CCAGGTCGGGCGGGGTGAAGGGT 0: 3
1: 0
2: 0
3: 4
4: 90
Right 901055592 1:6447472-6447494 GAAGGGTCTGAGGCCACCGCAGG 0: 3
1: 0
2: 0
3: 13
4: 155
901055583_901055592 6 Left 901055583 1:6447443-6447465 CCTGCAACGTGAGCCAGGTCGGG 0: 3
1: 0
2: 0
3: 7
4: 55
Right 901055592 1:6447472-6447494 GAAGGGTCTGAGGCCACCGCAGG 0: 3
1: 0
2: 0
3: 13
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901055592 Original CRISPR GAAGGGTCTGAGGCCACCGC AGG Intronic
901055592 1:6447472-6447494 GAAGGGTCTGAGGCCACCGCAGG + Intronic
901411272 1:9085913-9085935 GAAGGGTCTGATCCCATCTCTGG + Intronic
901445614 1:9306160-9306182 GCAGGGACTGAGGGCACCTCAGG + Intronic
901923041 1:12549421-12549443 GAAGGCCCGGAGGCCACCCCAGG - Intergenic
902478798 1:16701165-16701187 GAAGGGTCTGAGGCCACCGCAGG - Intergenic
902554421 1:17238641-17238663 GAAGAGTTTGAGGCAAGCGCTGG - Exonic
903367780 1:22815567-22815589 GAAGGGCCTGGGGCCAATGCAGG - Intronic
903740244 1:25554467-25554489 GAGGGGTCTGAGGCCACCAAGGG - Intronic
903957925 1:27037930-27037952 GGAGGGTCTGAGAGCACCTCTGG - Intergenic
904612373 1:31732632-31732654 GCTGGGCCTGAGGCCACTGCAGG + Intronic
905629408 1:39510530-39510552 GAGGGGTCTGAGGGCAGGGCAGG - Intronic
905668350 1:39775663-39775685 GAGGGGTCTGAGGGCAGGGCAGG + Intronic
905918718 1:41704508-41704530 GAAGGGTCTGTAGCCACCACAGG - Intronic
913535406 1:119767382-119767404 GAAGGGGCAGTGGCCACGGCAGG + Intronic
917922040 1:179758785-179758807 GAAGGGGCTGAGGCAGCCCCAGG - Intronic
918379915 1:183943642-183943664 GAAGGGTCTGAGGCTGATGCAGG - Intronic
920260352 1:204684632-204684654 GGTGGCTCTGAGCCCACCGCAGG - Intronic
921708845 1:218353282-218353304 GAAGTGTCAGAGGCCACCTAAGG - Intronic
922867089 1:228869371-228869393 GAGGGGTCTGAGGCCTCTGAGGG - Intergenic
923989873 1:239424405-239424427 GGAGGGTGTGAGGTCACCTCAGG + Intronic
1066059044 10:31706277-31706299 GAAGGGGAGGAGGCCCCCGCTGG - Intergenic
1067555210 10:47264842-47264864 GAAGAGTCTGACGCCCCCGGGGG + Intergenic
1067687793 10:48478201-48478223 GAAAGGTCTGAGCCCACCCAGGG - Intronic
1069766432 10:70863946-70863968 GAAGGGTCTGGTGCCACCTCAGG + Intronic
1070314021 10:75294286-75294308 AAAGGGGCTGAGGCCAGGGCTGG + Intergenic
1075848729 10:125568388-125568410 AAAGGGTTTGAGCACACCGCGGG + Intergenic
1076697011 10:132251800-132251822 GGAGGGTCTGAGGCCCCAGGAGG - Intronic
1076697027 10:132251855-132251877 GGAGGGTCTGAGGCCCCAGGAGG - Intronic
1076697041 10:132251910-132251932 GGAGGGTCTGAGGCCCCAGGAGG - Intronic
1076697057 10:132251965-132251987 GGAGGGTCTGAGGCCCCAGGAGG - Intronic
1081961719 11:47142705-47142727 GAAGGGTCTGAGGAGACAGCTGG - Intronic
1084191304 11:67500175-67500197 GATGGGCCTGAGGCCCCCCCAGG - Exonic
1084277482 11:68061612-68061634 GAAGGGACTGAGGTCAGAGCTGG + Intronic
1085173530 11:74467681-74467703 GAAGGGTCGGAGCCCACAGCCGG - Intronic
1086659070 11:89392276-89392298 GAAGGCTCTGAGTCCATTGCAGG - Intronic
1087022390 11:93616361-93616383 TAAGAGTTTGAGGCCACCCCGGG + Intergenic
1089329586 11:117680311-117680333 GGAGGGTCAGGGGCCACAGCAGG - Intronic
1092137842 12:6161877-6161899 GAAGGGGCGGAGGCAACCTCTGG - Intergenic
1097063020 12:56300103-56300125 GGTGGGGCTGAGGCGACCGCAGG - Intronic
1100431654 12:94536258-94536280 AAAGGGACTGAGGCCGGCGCTGG - Intergenic
1103377852 12:120470288-120470310 GCAGAGTCTGAGGCCACAGAGGG + Intronic
1104448689 12:128853059-128853081 GAAGGGACTGTGGTCACCGCTGG + Intergenic
1104448701 12:128853096-128853118 GGAGGGACTGTGGTCACCGCTGG + Intergenic
1104448726 12:128853206-128853228 GGAGGGACTGTGGTCACCGCTGG + Intergenic
1104448747 12:128853280-128853302 GAAGGGACTGTGGTCACCGCTGG + Intergenic
1104821764 12:131681433-131681455 GGAGGGTCTGGGGTCACAGCTGG - Intergenic
1104919976 12:132285636-132285658 GCAGTGACTGAGGCCACAGCAGG + Intronic
1106410491 13:29507991-29508013 GCAGGGTCTGAGGCTGCAGCAGG - Intergenic
1106416200 13:29548109-29548131 GAAGTGTCTCAGGACACCACCGG - Intronic
1107997246 13:45872979-45873001 GAAGGGTCTGAGACCTACCCAGG + Intergenic
1111588026 13:90307599-90307621 GAAGCCTCTGAGGGGACCGCTGG + Intergenic
1117955783 14:61122744-61122766 GAAGAGTCTGAGTCCATGGCAGG + Intergenic
1121312135 14:92940975-92940997 GAGGGGTCTGTGGCCTCCTCTGG + Exonic
1121319315 14:92981819-92981841 GAAGGCACTGAGGCCCACGCAGG + Intronic
1122207233 14:100153880-100153902 GAAGGGTCTGAGGTCAAGGGAGG + Intronic
1122386136 14:101349388-101349410 GAAGGGGCTGAGGTCACAGGAGG + Intergenic
1122397076 14:101441378-101441400 GTGGGAGCTGAGGCCACCGCAGG - Intergenic
1122768429 14:104086373-104086395 CAGGGCTCTGAGGCCACCTCGGG - Intronic
1126099410 15:45110764-45110786 GAAGGGTCTGAGCCCAAGGACGG + Intronic
1126104120 15:45136274-45136296 GAAGGGTCTGAGCCCAAGGACGG - Intronic
1128972190 15:72117772-72117794 GAAGAGGCCGAGGCCACCGAGGG + Exonic
1132598846 16:765037-765059 GTAGGGGCTGGGGCCAGCGCGGG + Intronic
1133120465 16:3603540-3603562 GAGGAGTCTCAGGCCACCCCAGG - Intronic
1133232850 16:4374552-4374574 GAAGGGGCTGGGGCGGCCGCTGG + Intronic
1138349690 16:56339881-56339903 GCAGGTTCTCAGGGCACCGCTGG + Intronic
1141436066 16:84000636-84000658 GGTGGGTCTCAGGCCACCCCAGG + Intronic
1142879028 17:2870063-2870085 GAAGGTTCTGAGGCCATGCCGGG - Intronic
1143659524 17:8315946-8315968 GATGGGACCGAGGCCACAGCAGG + Intronic
1145258100 17:21338570-21338592 GAGGGGCCTGAGGCCCCCACAGG - Intergenic
1146274581 17:31508609-31508631 GGAGGGTCTGAGGCCGACCCGGG - Intronic
1146790209 17:35746662-35746684 GAAGGATCTGAAGTCACCTCAGG - Intronic
1151054894 17:71019700-71019722 GGAGGGTCTGAGGTCAGGGCTGG - Intergenic
1151347474 17:73510970-73510992 CCAGGGTCTTAGGCCACCTCTGG + Intronic
1151371125 17:73646770-73646792 GAAGGGCCTGAGCTCACAGCTGG - Intergenic
1151547896 17:74804652-74804674 GAAGGGTCTTGAGCCACCGCAGG + Intronic
1151995769 17:77608033-77608055 GAAGGGGCTGAGGACACAGTGGG + Intergenic
1152632262 17:81415561-81415583 GAAGGGGCTGGGGCCAGCACAGG - Intronic
1152648075 17:81479374-81479396 TGAGGGCCCGAGGCCACCGCTGG + Intergenic
1152758602 17:82097366-82097388 GAGGGGGCGGAGGCCAGCGCTGG + Intronic
1154042870 18:10875669-10875691 GAAGCAGCTGAGGCCACAGCTGG - Intronic
1155978653 18:32158503-32158525 GAAGGACGTGAGGCCACCTCAGG - Intronic
1158536801 18:58315675-58315697 GCAGGGTTTGAGGGCACAGCTGG - Intronic
1159894181 18:73980842-73980864 GGAGGGTCTGAAGCTGCCGCAGG + Intergenic
1160813050 19:1021217-1021239 GTAGGGGGTGAGGCCTCCGCGGG - Intergenic
1160971188 19:1768489-1768511 GAAGGGACTGAGGCCTCCAAGGG + Intronic
1161722331 19:5910054-5910076 GAAAGGTCGGAGGCCACCCACGG + Exonic
1161948774 19:7455531-7455553 GAGGGGACTGAGACCACCCCTGG + Intronic
1164861732 19:31567025-31567047 GAAGAGTCTGAGACCAGCCCAGG + Intergenic
1165138965 19:33687928-33687950 GTAGCCTCTGAGGCCACAGCTGG - Intronic
1165412385 19:35670165-35670187 AAAGGCTCTGAGGCCAGAGCGGG + Intronic
1165823574 19:38692826-38692848 GCAGCGTCAGAGGCCACAGCAGG + Intronic
1166789776 19:45391962-45391984 GAGGGATCTGAGGCCAGGGCAGG - Exonic
1167080063 19:47272140-47272162 GAAGGGTCTGAGGCAACTCCAGG + Intergenic
1167638166 19:50667116-50667138 GGAGGGGCTGCGGCCACAGCCGG + Exonic
1202712817 1_KI270714v1_random:26996-27018 GAAGGGTCTGAGGCCACCGCAGG - Intergenic
925068681 2:950304-950326 GAAAGGTCTGAGGACGCGGCCGG + Intergenic
926397169 2:12455133-12455155 GAAGGGTATCAGGCCATCCCAGG + Intergenic
926970869 2:18466118-18466140 GATGGGGCTGAAGGCACCGCTGG - Intergenic
927841639 2:26448848-26448870 GCAGGTTCTGAGGCCTCTGCTGG + Intronic
929952841 2:46429309-46429331 GAAGGATCAGTGGCCATCGCGGG + Intronic
931672970 2:64665575-64665597 GTAGGGTCTGGGGCCAGGGCTGG - Intronic
933093229 2:78146498-78146520 GAGGGGCCTGAGGCCACAGGGGG - Intergenic
941811095 2:169756781-169756803 GAAGGGTCTGACTCTGCCGCAGG - Intronic
942278879 2:174342043-174342065 GAGGGGTCTGCGTCCACAGCTGG - Intergenic
944134432 2:196383281-196383303 GAGGGGTCTGAGGCCAATCCAGG + Intronic
944316701 2:198292448-198292470 GAAGGTTATGAGGCCATGGCAGG - Intronic
946313699 2:218896629-218896651 GCAGGGGCTGGGGCGACCGCAGG - Intronic
946908404 2:224437671-224437693 GAAGGGGCTGAGGCTTCCCCAGG - Intergenic
947611965 2:231530256-231530278 GAAGGGTCCGAGGGCTCCGTCGG - Intronic
948655568 2:239474985-239475007 TAAGGGTCAGAGGCCACATCAGG - Intergenic
948993045 2:241564345-241564367 CCAGGCTCTGAGGCCACCCCAGG - Intronic
1171087208 20:22248685-22248707 AGAGGGTCTTAGGCCACTGCTGG + Intergenic
1171229936 20:23476035-23476057 GAAGGCTGTGTGCCCACCGCAGG - Intergenic
1173788304 20:45811247-45811269 CACGTGGCTGAGGCCACCGCTGG + Exonic
1176238131 20:64063636-64063658 GAGGGGTCTGAGTCCAGAGCGGG - Intronic
1177404273 21:20645619-20645641 GAAGGGTCTGAGGCAGCAGGGGG - Intergenic
1180953220 22:19730123-19730145 GAAGAGTCTGAGGTCACAGAGGG - Intergenic
1181078414 22:20396943-20396965 GTAGGGTCTGAGGCCCGCACAGG - Intronic
1181760048 22:25052059-25052081 GAAGGGCCTGGGGCCAAGGCTGG - Intronic
1182194899 22:28506090-28506112 GGAGTGGCTGAAGCCACCGCAGG - Intronic
1183305372 22:37080200-37080222 CAAGGGCCTGAGGCCTCAGCTGG + Intronic
1184766209 22:46573844-46573866 CACGGGTCTGAGGGCCCCGCTGG + Intergenic
950579111 3:13851150-13851172 GAAGGGGCTGTGGCCACGGTTGG - Intronic
951359116 3:21703487-21703509 GAAGGGTTTGAGGCAACCAAGGG - Intronic
954462930 3:50638009-50638031 GAAGTGTCTGTGGCCACAGGTGG + Intronic
957459439 3:80497643-80497665 GAGGGGTCTGAGGCAGCAGCCGG + Intergenic
959106290 3:102068750-102068772 GGAGTGTCTGAGACCACCGGAGG + Intergenic
968602538 4:1517137-1517159 GCTGTGTCTGAGGCCACCGCTGG + Intergenic
970549442 4:17164295-17164317 GGAGGGTCTGTGGCCCCCTCGGG + Intergenic
971901539 4:32665475-32665497 TAAGGGTCTGAGGTCATCTCTGG + Intergenic
974986013 4:69026755-69026777 GGAGTGTCTGAGGCAACCGAGGG - Intronic
981566972 4:146112015-146112037 GACGTGACTAAGGCCACCGCTGG - Intergenic
981898671 4:149835526-149835548 GACAAGTCTGAGGCCACCACAGG - Intergenic
983085598 4:163440682-163440704 TAAGGGTCTGAGACCATCCCGGG + Intergenic
985602905 5:844127-844149 GCAGGGTTTGAGGCCAGCGTTGG - Intronic
986275031 5:6266485-6266507 CAAGGGGCTGTGGCCACCGTTGG - Intergenic
989240056 5:39193507-39193529 GAAGGTTCTGGTGCCACCGGAGG + Intronic
992582715 5:78198230-78198252 CAAGAGTCTCAGGCCACAGCAGG - Intronic
998049983 5:139024079-139024101 GAAGGGTGTGAGTCCACAGGAGG - Intronic
1000014587 5:157266150-157266172 GAGGGGCCTGAGGCTACCGCAGG - Exonic
1001519001 5:172377414-172377436 GATGGTTCTGGGGCCACAGCAGG - Intronic
1002438892 5:179253744-179253766 GAAGGGTCTGAACTCACTGCTGG - Intronic
1006525139 6:34597851-34597873 GAAGGCTCAGAGGCAACCACAGG - Intronic
1012569361 6:100702598-100702620 AAAGGGTCTAAGGCCACGCCTGG + Intronic
1015434668 6:133172377-133172399 GAGGGGGCTGAGGCCACAGGGGG - Intergenic
1017544762 6:155438767-155438789 GCAGAGTCGGAGGCCACCTCCGG + Intronic
1018915361 6:168129495-168129517 GGAGTGTCTGAGGCCTCAGCTGG + Intergenic
1018968672 6:168509196-168509218 GAAGGGCCTGGGGCCACCGTGGG + Intronic
1019159823 6:170062463-170062485 GAAGGGCATGAGGCCACCTTTGG - Intergenic
1021851028 7:24808788-24808810 GATGGGTCTGAACCCACTGCAGG + Intronic
1023998547 7:45176791-45176813 CCAGGGGCTGAGGCCACTGCAGG - Intronic
1024225434 7:47322855-47322877 GCAGGGTCCGTGGCCACCGAGGG - Intronic
1024319742 7:48052902-48052924 GAAGGTCCTGAGGACACCCCAGG + Exonic
1025850416 7:65239446-65239468 GCAGGGTCTGTGGACACCACGGG + Intergenic
1029729359 7:102429424-102429446 ACAGGGTCTGAGGCCATGGCAGG - Intergenic
1035227244 7:157440488-157440510 GAAGGGTCTGCCGCCAGTGCTGG + Intergenic
1035567448 8:650806-650828 CAAGGGGCTGCAGCCACCGCAGG + Intronic
1036482440 8:9150859-9150881 GTAGGCTCTCAGGCCACCGAGGG - Intronic
1042033071 8:64498944-64498966 GAAGGGTCTGCTGCTACTGCGGG - Intergenic
1049554237 8:143274253-143274275 GAAAGGTCTGGGGCCAAGGCAGG + Intronic
1054925625 9:70585899-70585921 GAAGGGTCTGAGGAGACAGACGG - Intronic
1056285053 9:85079291-85079313 CAATGGTGTGAGGCCACAGCTGG + Intergenic
1059157208 9:112000939-112000961 GGTGGGACTGAGGCTACCGCTGG + Intergenic
1060184165 9:121553643-121553665 GAAGGCTCTGAGGCCAGCAGTGG - Intergenic
1061985582 9:134128484-134128506 GAAGGGCCTGAGGCTGCCCCAGG - Intergenic
1062098974 9:134718221-134718243 GATGGGTCGGCGGCCACGGCGGG - Intronic
1062601079 9:137318833-137318855 CAGGGGTCTGTGGCCACCGCCGG - Intronic
1062662505 9:137645764-137645786 CAAGGGTCTGAGGCCCACGTGGG - Intronic
1190209073 X:48429992-48430014 GAAAGGTCAGAGGCCACAGATGG - Intergenic
1193498094 X:82238436-82238458 GGAGTGTCTGAGGCCACCAGAGG - Intergenic
1193817971 X:86126230-86126252 GGAGAGTCTGAGGCAACCGGGGG - Intergenic