ID: 901055593

View in Genome Browser
Species Human (GRCh38)
Location 1:6447473-6447495
Sequence AAGGGTCTGAGGCCACCGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 3, 1: 0, 2: 0, 3: 12, 4: 137}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901055590_901055593 -6 Left 901055590 1:6447456-6447478 CCAGGTCGGGCGGGGTGAAGGGT 0: 3
1: 0
2: 0
3: 4
4: 90
Right 901055593 1:6447473-6447495 AAGGGTCTGAGGCCACCGCAGGG 0: 3
1: 0
2: 0
3: 12
4: 137
901055580_901055593 24 Left 901055580 1:6447426-6447448 CCTGCGGTGTCGCATTTCCTGCA 0: 1
1: 2
2: 0
3: 5
4: 54
Right 901055593 1:6447473-6447495 AAGGGTCTGAGGCCACCGCAGGG 0: 3
1: 0
2: 0
3: 12
4: 137
901055583_901055593 7 Left 901055583 1:6447443-6447465 CCTGCAACGTGAGCCAGGTCGGG 0: 3
1: 0
2: 0
3: 7
4: 55
Right 901055593 1:6447473-6447495 AAGGGTCTGAGGCCACCGCAGGG 0: 3
1: 0
2: 0
3: 12
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901055593 Original CRISPR AAGGGTCTGAGGCCACCGCA GGG Intronic
901055593 1:6447473-6447495 AAGGGTCTGAGGCCACCGCAGGG + Intronic
901923040 1:12549420-12549442 AAGGCCCGGAGGCCACCCCAGGG - Intergenic
901923672 1:12552828-12552850 AAGGCCCGGAGGCCACCCCAAGG - Intergenic
902478797 1:16701164-16701186 AAGGGTCTGAGGCCACCGCAGGG - Intergenic
903173743 1:21568890-21568912 AAGGGCCAGAGGCCACTCCAAGG - Intronic
903367779 1:22815566-22815588 AAGGGCCTGGGGCCAATGCAGGG - Intronic
904612374 1:31732633-31732655 CTGGGCCTGAGGCCACTGCAGGG + Intronic
905629407 1:39510529-39510551 AGGGGTCTGAGGGCAGGGCAGGG - Intronic
905668351 1:39775664-39775686 AGGGGTCTGAGGGCAGGGCAGGG + Intronic
905918717 1:41704507-41704529 AAGGGTCTGTAGCCACCACAGGG - Intronic
906323202 1:44829204-44829226 CAAGGCCTGAGGCCACCGCCAGG + Exonic
909189859 1:72538477-72538499 AAGGGTCTGATACCACCATAAGG - Intergenic
913535407 1:119767383-119767405 AAGGGGCAGTGGCCACGGCAGGG + Intronic
917922039 1:179758784-179758806 AAGGGGCTGAGGCAGCCCCAGGG - Intronic
921347773 1:214204676-214204698 AAGGGCCTGTGGCCACTGCATGG - Intergenic
1066290951 10:34014016-34014038 CTGGGTCTCAGGCCAACGCAAGG - Intergenic
1069766433 10:70863947-70863969 AAGGGTCTGGTGCCACCTCAGGG + Intronic
1071920699 10:90346741-90346763 AAGGGTCTGAAGCCATCTTAAGG - Intergenic
1075645815 10:124095321-124095343 AAGGGTCTGTGGAAACAGCAAGG + Intergenic
1075690332 10:124389713-124389735 CAGGGTCTGAGGCCCCCGGCAGG - Intergenic
1076527790 10:131123340-131123362 GAGGGTCTGAGACCATCACAAGG + Intronic
1076719270 10:132386160-132386182 CAGGGCCTGAGGCCAACACAGGG - Intergenic
1078222583 11:9364168-9364190 GAGGAGCTGAGGCCTCCGCACGG - Intergenic
1080590692 11:33720856-33720878 AAGGGTCTCAGGACCCTGCAGGG - Intronic
1081961718 11:47142704-47142726 AAGGGTCTGAGGAGACAGCTGGG - Intronic
1084426386 11:69086664-69086686 ATGGGCCTGAGGCCACCGGCCGG + Intronic
1085173529 11:74467680-74467702 AAGGGTCGGAGCCCACAGCCGGG - Intronic
1087939159 11:104074188-104074210 AAGTGTCTGTGGCCACTGGATGG - Intronic
1089219495 11:116858878-116858900 AAGGGACTGAGGGCACTGCGTGG + Intronic
1089511157 11:118998131-118998153 CAGGGTCAGAGGCCGCCGGATGG + Exonic
1090208726 11:124900332-124900354 AACGGTCTGTGTGCACCGCAGGG + Intergenic
1091346264 11:134856438-134856460 CAGGGGCTGAGGCCACAGAATGG + Intergenic
1095279030 12:40327734-40327756 AAAGCTCTGAGGCCACCAAATGG + Intronic
1103732432 12:123036796-123036818 CAGGGCCTGGGGCCACCCCAAGG - Intronic
1106410490 13:29507990-29508012 CAGGGTCTGAGGCTGCAGCAGGG - Intergenic
1107021475 13:35756697-35756719 AAGGGAGTGGGGCCAGCGCAAGG - Intergenic
1107997247 13:45872980-45873002 AAGGGTCTGAGACCTACCCAGGG + Intergenic
1111407620 13:87829709-87829731 AAGGATCTGAGGCCACTGAGAGG + Intergenic
1113457662 13:110460174-110460196 AAGGATCTGAGCCCACAGCATGG + Intronic
1120185832 14:81393009-81393031 AAGGGTCTCAGGAGACAGCAAGG + Intronic
1121319316 14:92981820-92981842 AAGGCACTGAGGCCCACGCAGGG + Intronic
1122397075 14:101441377-101441399 TGGGAGCTGAGGCCACCGCAGGG - Intergenic
1122509947 14:102258327-102258349 AAGGCCCTGAGGCCACCGTGAGG - Intronic
1122864634 14:104597989-104598011 AGGGGTCTGAGGCCTCTGCCAGG + Intronic
1124154942 15:27217587-27217609 AAAATTCTGAGGCCACAGCACGG - Intronic
1126789153 15:52204759-52204781 AGGGGTTTGACGCCACAGCAGGG + Intronic
1127959607 15:63881009-63881031 TACGGTCCGAGGCCATCGCATGG + Intergenic
1128760821 15:70215037-70215059 ACCTGTCTGATGCCACCGCACGG + Intergenic
1129832670 15:78680957-78680979 ATGGGTCAGAGGCCACAGGAAGG - Intronic
1130537817 15:84799539-84799561 AAGGGCCTGGGGCCACCCCAAGG - Intronic
1132398400 15:101490069-101490091 AGGCGTCTGAGGCCCCCGCCAGG - Intronic
1132475001 16:130496-130518 AAGGCTCTGCGGCCACTTCAGGG - Intronic
1132799007 16:1742308-1742330 TAGGGACTGAGCCCACAGCAGGG + Intronic
1132914774 16:2338022-2338044 ACGGGACTGAAGCCACGGCAAGG - Intronic
1133120464 16:3603539-3603561 AGGAGTCTCAGGCCACCCCAGGG - Intronic
1136267708 16:29130976-29130998 CAGGGTCTGAGGCCACCAAATGG - Intergenic
1137767775 16:50991262-50991284 AAGGAGCTCAGCCCACCGCAAGG - Intergenic
1138249223 16:55489594-55489616 AAGAGTCTGAGGCTACCACCAGG - Intronic
1138503121 16:57461004-57461026 CAAGGTCTGACGCCACCTCAAGG + Exonic
1141436067 16:84000637-84000659 GTGGGTCTCAGGCCACCCCAGGG + Intronic
1146835096 17:36104520-36104542 GAGGGTCTGAGCCCACTGAAAGG - Exonic
1146849711 17:36211768-36211790 GAGGGTCTGAGCCCACTGAAAGG - Exonic
1147537802 17:41332325-41332347 AATGACCTGAGGCCACTGCAAGG - Intergenic
1147646710 17:42038538-42038560 AAAGGTCTGAGGCAAGGGCAGGG + Intronic
1151547897 17:74804653-74804675 AAGGGTCTTGAGCCACCGCAGGG + Intronic
1152094287 17:78263946-78263968 AAGGGCCTGAAGCCAGCGCCAGG + Intergenic
1152512856 17:80802120-80802142 GAGGTTCAGAGGCCACCCCAGGG + Intronic
1152648076 17:81479375-81479397 GAGGGCCCGAGGCCACCGCTGGG + Intergenic
1152685308 17:81690916-81690938 AAGGGCCTGATGCCACTGCCTGG + Intronic
1157564032 18:48667840-48667862 CAGTGTCTGTGGCCACCTCATGG + Intronic
1157804666 18:50649222-50649244 CAGAGTCTGAGGACACCTCAAGG - Intronic
1161686907 19:5707462-5707484 AAGGCTATGAAGCCACCGAAAGG + Intronic
1165476060 19:36031894-36031916 TAGGGGCTGGGGCCACAGCAGGG - Intronic
1166789775 19:45391961-45391983 AGGGATCTGAGGCCAGGGCAGGG - Exonic
1168288969 19:55347766-55347788 AAGGGGCAGGGGCCACCCCACGG + Exonic
1202712816 1_KI270714v1_random:26995-27017 AAGGGTCTGAGGCCACCGCAGGG - Intergenic
926397170 2:12455134-12455156 AAGGGTATCAGGCCATCCCAGGG + Intergenic
928317764 2:30259072-30259094 AAGGCTCTGAGTCCACCTCTTGG - Exonic
928593529 2:32840057-32840079 GAGGGTGTGAGGCCACAGCTTGG - Intergenic
932129755 2:69177339-69177361 CAGGGTCTGAGGACAGCACAGGG + Intronic
932277344 2:70461471-70461493 AAGGGTCTGTGGCCAGGGCCAGG + Intronic
934122904 2:88857291-88857313 AAGGGTCAGAGGCCAAAGGATGG + Intergenic
938900624 2:135796223-135796245 AAGTGTCAGAGGCCTCAGCAGGG - Intronic
947473221 2:230416260-230416282 CAGGCTCTGAGGCCCACGCAGGG + Exonic
947872028 2:233444596-233444618 GAGGGTCTGAGGACTCCGCGAGG - Intronic
1173659562 20:44723927-44723949 TAGGCTCTGAGCCCACCGGAGGG + Intronic
1173788305 20:45811248-45811270 ACGTGGCTGAGGCCACCGCTGGG + Exonic
1174278200 20:49419154-49419176 CAGGGTTTGAAGCCAGCGCAGGG - Intronic
1175396893 20:58670934-58670956 AAAGCTCTGAGGCCATAGCAGGG - Intronic
1175923694 20:62461887-62461909 CAGGGTCAGAGGGCACAGCACGG - Intergenic
1175966382 20:62661978-62662000 CAGCGTCTGAGGCCCCAGCACGG + Intronic
1176061282 20:63174005-63174027 CAGGGCCTGGGGCCTCCGCATGG - Intergenic
1176107150 20:63394840-63394862 GAGGGTCTGGGGCCACCGCCTGG + Intergenic
1179584791 21:42367670-42367692 TAGGGTCTGGGGCCACCTCAAGG - Intergenic
1180791790 22:18578640-18578662 GAGGGGCTGCGGCCACCGGAAGG - Intergenic
1181229946 22:21416669-21416691 GAGGGGCTGCGGCCACCGGAAGG + Intergenic
1181248703 22:21518197-21518219 GAGGGGCTGCGGCCACCGGAAGG - Intergenic
1181690083 22:24554530-24554552 AAGGGGCTCAGGCTACCGCGTGG + Intronic
1182872125 22:33657128-33657150 AAGGGTCTGAGCCCCCTTCATGG - Intronic
1183305373 22:37080201-37080223 AAGGGCCTGAGGCCTCAGCTGGG + Intronic
1183309045 22:37099341-37099363 AAGGAGCTGGGGCCTCCGCAGGG + Intronic
950838113 3:15940070-15940092 AAGGCTCTGAGGCCAGAACATGG - Intergenic
967428060 3:189350401-189350423 AAGTGTCTGAGGCCAACTTAAGG - Intergenic
969414484 4:7049782-7049804 AAGAGCCAGGGGCCACCGCATGG + Intronic
978624351 4:110667413-110667435 AAGGGTTTGAGGGCACCTCCCGG + Intergenic
981898670 4:149835525-149835547 ACAAGTCTGAGGCCACCACAGGG - Intergenic
985738155 5:1597296-1597318 AAGCTTCTGAGGCCTCCTCATGG - Intergenic
986562227 5:9072258-9072280 AAGGTTCCCAGGCCACAGCATGG + Intronic
986728865 5:10620078-10620100 AAGGGTCTAAGCCCAATGCAAGG + Intronic
987204097 5:15607248-15607270 AAGGGGCTGAGGCCTCCACCTGG + Intronic
999144149 5:149381593-149381615 AAGGATCTGGGGCCCCCACAAGG - Intronic
999736732 5:154518569-154518591 AAGGCTCTGTGGCCCCAGCACGG - Intergenic
999748541 5:154609779-154609801 AGGGGTCTGAAGCCAGCCCAAGG - Intergenic
1000014586 5:157266149-157266171 AGGGGCCTGAGGCTACCGCAGGG - Exonic
1000345193 5:160308369-160308391 ATGGCACTGAGGCCCCCGCAAGG + Intronic
1001426726 5:171627838-171627860 AAGGGTTGGAGGCCAGCCCAAGG + Intergenic
1002140027 5:177132837-177132859 GAGGGGCTGTGGGCACCGCAGGG + Intergenic
1005212226 6:23479928-23479950 AATGCTCTGAAGCCACAGCAAGG - Intergenic
1005280384 6:24267758-24267780 AAAGGTCTGAGGACTCCACAAGG + Intronic
1005585969 6:27276914-27276936 AAGGGGCTGAGGGGACAGCACGG + Intergenic
1007391170 6:41550139-41550161 AAGGAACTGAGGCCTCCCCAGGG + Intronic
1007485391 6:42177796-42177818 GAGGGGCTGAGGCCCCCGGAAGG - Intronic
1008415312 6:51233124-51233146 AATTGTCTGAGGCCACCAGAAGG - Intergenic
1015227731 6:130876913-130876935 AAGGGTCTGATGCCATGCCAAGG - Intronic
1016528978 6:145037406-145037428 ACGGGTCTGAGGCTTCCCCAAGG + Intergenic
1018673692 6:166200769-166200791 AAAGTTCTGAGACCACCCCAAGG + Intergenic
1019587814 7:1814471-1814493 ATGGGGCTGTGGCCACCCCAGGG + Intergenic
1020078590 7:5274606-5274628 GAGGGCCTGAGGCCAGTGCAAGG - Intronic
1021902172 7:25296888-25296910 AAGAATCTGAGGCCAACACAGGG - Intergenic
1023221084 7:37920784-37920806 AAGCGGCAGAGGCCACCGAAGGG + Exonic
1023968741 7:44976972-44976994 ATGGGCCTGAGGCCATCGCCAGG - Exonic
1023998546 7:45176790-45176812 CAGGGGCTGAGGCCACTGCAGGG - Intronic
1026889716 7:73974823-73974845 AAGGGTCTGTGGGCTCCCCAAGG + Intergenic
1029729358 7:102429423-102429445 CAGGGTCTGAGGCCATGGCAGGG - Intergenic
1034560680 7:151877512-151877534 AAGCGGCTGCGGCCGCCGCAGGG - Intergenic
1035237454 7:157508165-157508187 CAGGGTCTGTGAGCACCGCAGGG + Intergenic
1035333751 7:158112839-158112861 AGAGGTCAGAGGCCACAGCAGGG + Intronic
1046631080 8:116623724-116623746 AAGAGTCAGAGACCACCCCAGGG + Intergenic
1049821390 8:144635800-144635822 TAGGATCTGAGGCTACCGCCAGG + Intergenic
1056285054 9:85079292-85079314 AATGGTGTGAGGCCACAGCTGGG + Intergenic
1057787095 9:98095548-98095570 GAGGGGGTGTGGCCACCGCAGGG + Intronic
1057909312 9:99005403-99005425 AAGGGTCAGAGGGCACGGCCAGG + Intronic
1059497757 9:114723697-114723719 AAAGCTCTGAGACCACAGCATGG - Intergenic
1060243674 9:121926240-121926262 AATGGTCTGTGGGCAGCGCAGGG - Intronic
1060658152 9:125387039-125387061 AAGGGTCTCAGGGCACTGAAGGG + Intergenic
1061286800 9:129628191-129628213 AAGAGTCTGAGGGAACAGCAAGG - Intronic
1062240611 9:135535692-135535714 AGGGGGCTGGGGCCACCCCAGGG + Intergenic
1062400534 9:136370735-136370757 ACGGGTCTGCGGTCACCGCCTGG - Intronic
1062662504 9:137645763-137645785 AAGGGTCTGAGGCCCACGTGGGG - Intronic
1062670948 9:137709090-137709112 AAGGGGCTGACACCACCGCTTGG + Intronic
1062684824 9:137806374-137806396 AAGGGAGTGAGGCCAGCGGAAGG - Intronic
1199566836 X:149224159-149224181 AAGGGTCTGAACTCACAGCATGG + Intergenic