ID: 901058369

View in Genome Browser
Species Human (GRCh38)
Location 1:6460203-6460225
Sequence TCCACCAGGGCCTGGCTGGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 466
Summary {0: 1, 1: 0, 2: 4, 3: 38, 4: 423}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901058369_901058378 15 Left 901058369 1:6460203-6460225 CCAGCCAGCCAGGCCCTGGTGGA 0: 1
1: 0
2: 4
3: 38
4: 423
Right 901058378 1:6460241-6460263 ACAGCCCTCCCCTCCTGCGCTGG 0: 1
1: 0
2: 1
3: 23
4: 264

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901058369 Original CRISPR TCCACCAGGGCCTGGCTGGC TGG (reversed) Exonic
900204594 1:1426626-1426648 GCCACCAGGGCCTGGACAGCTGG + Intronic
900349257 1:2227247-2227269 TCCGCCAGGGGCCGGCGGGCGGG + Intergenic
900401099 1:2473287-2473309 GCCACCAGGGCCAGGCAGTCAGG + Intronic
900406295 1:2494604-2494626 TCCACCGGGGCCTGACTTTCAGG + Intronic
900491002 1:2949110-2949132 TCCAGCAGAGCCTGCCTGGGAGG - Intergenic
900505353 1:3027611-3027633 TCCACCAGGGGCAGGCGGGGGGG + Intergenic
900695181 1:4005279-4005301 TCCCCGGGGTCCTGGCTGGCAGG - Intergenic
900702202 1:4055424-4055446 CCCACCATGGCCTTGATGGCAGG + Intergenic
900921021 1:5670705-5670727 CACACCATGCCCTGGCTGGCAGG + Intergenic
900971710 1:5995580-5995602 TGCACCAGGGCCTGCATGCCAGG - Intronic
900979240 1:6036920-6036942 TGCAACAGAGACTGGCTGGCTGG - Intronic
901001878 1:6152956-6152978 ACCAGCATTGCCTGGCTGGCAGG - Intronic
901058369 1:6460203-6460225 TCCACCAGGGCCTGGCTGGCTGG - Exonic
901068450 1:6505776-6505798 TCCTCCAGGGCTGGCCTGGCTGG - Intronic
902516547 1:16992571-16992593 TCCTCCAGGACCTGGCAGGCAGG + Exonic
902724874 1:18328640-18328662 TACAACAGGGCCTGGCATGCTGG - Intronic
903221626 1:21872750-21872772 TCCACCTGGGCCTGGGTAGACGG + Exonic
903917608 1:26775529-26775551 TCCACCAAGCCCAGGTTGGCTGG - Intronic
904044556 1:27602111-27602133 TGCACCAGTGCCTGACTGGCAGG - Intronic
904411122 1:30325480-30325502 TCTCCCATGGCCTGGCTGGGTGG - Intergenic
904477701 1:30775559-30775581 TCCACGAGGACCAGCCTGGCAGG - Intergenic
905938102 1:41840740-41840762 TCGTCCAGTGACTGGCTGGCTGG - Intronic
906110536 1:43319239-43319261 TCCACAGGGACCTGGCTGCCCGG + Exonic
906611755 1:47208705-47208727 TCAGCCAGAGCCCGGCTGGCTGG - Intergenic
906740155 1:48174461-48174483 TCCCGCAGGGGGTGGCTGGCCGG - Intergenic
907438235 1:54462920-54462942 TCCACCAGGGCCTGACACCCTGG - Intergenic
908256471 1:62307899-62307921 GCCTTCAGGGCCTAGCTGGCAGG - Intronic
910217016 1:84853259-84853281 TCCCCCAGCTCCTGGCTGGAAGG + Intronic
912507392 1:110165597-110165619 TGTAACAGGGCCTGGCTGGCAGG + Intronic
913077609 1:115354202-115354224 TCCACCAGTGCCCGCCTTGCAGG + Intergenic
913606935 1:120475547-120475569 TCCTCCAGGCCCTGTCTTGCAGG + Intergenic
913988408 1:143586059-143586081 TCCTCCAGGCCCTGTCTTGCAGG - Intergenic
914209497 1:145564597-145564619 TCCTCCAGGCCCTGTCTTGCAGG - Intergenic
914268415 1:146056965-146056987 TCCTCCAGGCCCTGTCTTGCAGG - Intergenic
914332314 1:146683590-146683612 TCTACCAGAGACTTGCTGGCTGG - Intergenic
914584257 1:149046291-149046313 TCCTCCAGGCCCTGTCTTGCAGG - Intronic
915367844 1:155325379-155325401 GCCACCAGGGCGTGGAGGGCCGG - Exonic
915513413 1:156399609-156399631 TCAGCCAGGGCCTGGCTGCTGGG - Intergenic
920400019 1:205670576-205670598 TCCCCCAGGGCCTGGAGGCCAGG + Intronic
920657012 1:207884818-207884840 TCCTCCAGGACCTGCTTGGCTGG + Intronic
921310594 1:213839337-213839359 TGCCCCAGGGCCAGGATGGCTGG - Intergenic
921332478 1:214053231-214053253 TCCTCCAGGGCCTGGCGCGGTGG - Intergenic
922724135 1:227914728-227914750 GGCAGCGGGGCCTGGCTGGCCGG - Intergenic
922730127 1:227945346-227945368 TGCACCTTGGCCTGGCTAGCAGG - Intronic
923864728 1:237927362-237927384 TGCATCTGGACCTGGCTGGCAGG + Intergenic
924421765 1:243916701-243916723 TCCACCCGGGCCAGGTTTGCTGG + Intergenic
1063620769 10:7646596-7646618 TCCAGAAGGGCTTGGCTGGGAGG + Intronic
1065593000 10:27284675-27284697 TACTCCAGGGGGTGGCTGGCAGG + Intergenic
1066380305 10:34895620-34895642 TCCACCAGGGCCAGGCGCGGTGG + Intergenic
1067039320 10:42940622-42940644 TGCACCAGGGCCTGGGTCTCCGG - Intergenic
1067095827 10:43298892-43298914 CCAACCTGGGCCTCGCTGGCTGG + Intergenic
1067344122 10:45425795-45425817 GGCAGCAGGGCCTGGGTGGCAGG - Intronic
1067533899 10:47094173-47094195 TCTTCCAGGGCCTCCCTGGCAGG - Intergenic
1067756360 10:49008798-49008820 TCTAGCAGGGCTTGTCTGGCAGG - Intergenic
1069630905 10:69896527-69896549 ACCACCCGGACCTGCCTGGCAGG - Intronic
1069728904 10:70598702-70598724 TCCACCAGGCCAGGGCTGCCGGG + Exonic
1070425423 10:76282479-76282501 TCCACCAGCGCCTCTCTGGCAGG - Intronic
1070600680 10:77864327-77864349 ACCTCCAGGCCCTGGCTGCCCGG + Intronic
1070895616 10:79981540-79981562 TCCCCCTGGGCTGGGCTGGCGGG - Intronic
1071067839 10:81656876-81656898 TCCACCAGGGCTGGCCTGGAGGG + Intergenic
1071568670 10:86684689-86684711 ATGACCAGGGCCAGGCTGGCCGG + Intronic
1072800689 10:98390540-98390562 TCCACATGGGCCTGGGAGGCGGG - Intronic
1073445144 10:103575955-103575977 CCCAGCAGGACTTGGCTGGCGGG + Intronic
1073542338 10:104324268-104324290 CCCACCAGGGCATCTCTGGCTGG + Intronic
1074431637 10:113399758-113399780 TCCACAAGGCTCTGGTTGGCAGG + Intergenic
1074535469 10:114325656-114325678 TCTGCTAGGGCCTGGCTGCCAGG - Intronic
1075263786 10:120984033-120984055 AGCACCAGGGCCTGGCAGGAGGG - Intergenic
1075349409 10:121710464-121710486 TCCTCCAGGGCCTGTCTGTCTGG + Intergenic
1075513622 10:123092275-123092297 TCCACCAGGGTCTGAGTGGAAGG + Intergenic
1076066541 10:127452889-127452911 TTCTCCAGGGCCTATCTGGCTGG + Intergenic
1076751755 10:132546815-132546837 TCTGCCTGGGCCTGCCTGGCTGG + Intronic
1076784388 10:132742498-132742520 TCCACCTGGGGATGGCAGGCAGG - Intronic
1076904978 10:133357148-133357170 TCCCCCAGGGCAGGGCGGGCGGG - Intronic
1076990602 11:271417-271439 ACCACCAGGGCCTGGGGGCCAGG + Intergenic
1077303267 11:1856744-1856766 TGCCCAAGGGCCTGGCTGCCTGG - Intronic
1077507850 11:2940415-2940437 CTCACCAGTGCCTGCCTGGCTGG - Intergenic
1078397082 11:10990760-10990782 TCCTCCAGGGCCTGAGTGGATGG + Intergenic
1078455120 11:11468952-11468974 TGCACATGGGGCTGGCTGGCTGG + Intronic
1078544874 11:12240157-12240179 TGCACCAGGGTCAGCCTGGCGGG + Intronic
1078722590 11:13898107-13898129 CCTTGCAGGGCCTGGCTGGCAGG + Intergenic
1080592651 11:33736805-33736827 TGCCCCAGGGCCTGGCTATCGGG + Intergenic
1081664124 11:44906603-44906625 TCCATGAAAGCCTGGCTGGCAGG - Intronic
1081838879 11:46180937-46180959 TCCACAAGGGCCTGACTACCAGG - Intergenic
1083265964 11:61546938-61546960 TCCCCCAGGGCCAGCCTTGCAGG - Intronic
1083764164 11:64834176-64834198 TCCACGATGGCCTGGCAGGGTGG - Intronic
1083924613 11:65798393-65798415 TCCACCATGGCCTGGCCAGATGG + Intergenic
1084214815 11:67641519-67641541 GGCACCAGGGACAGGCTGGCAGG - Intergenic
1084420580 11:69058593-69058615 TGCCCCAGGGCCCTGCTGGCAGG + Intronic
1084597102 11:70123459-70123481 TCCTCCAGTGCCTGGAGGGCAGG - Intronic
1084643806 11:70442645-70442667 GCTGCCAGGGCCTGGCGGGCGGG + Intergenic
1084965651 11:72743268-72743290 TCTACAAAGGCCTGGCTTGCAGG + Intronic
1085816695 11:79744890-79744912 TGTCCCAGGGCCTGGCAGGCAGG - Intergenic
1088780209 11:113126915-113126937 TGCACCAAGGTCTGTCTGGCTGG - Intronic
1088842406 11:113638165-113638187 TCCACCATGGCAAGGCTGTCAGG + Intergenic
1089283577 11:117391457-117391479 TCCTCCAGGGTCAGGCTGGATGG + Intronic
1089443071 11:118532011-118532033 CTCACCAGGGACTGGCTGGTTGG - Intronic
1089731285 11:120520648-120520670 CCTCCAAGGGCCTGGCTGGCTGG + Intronic
1090385703 11:126356460-126356482 TCCTCGGGGACCTGGCTGGCAGG + Intronic
1091589951 12:1837011-1837033 TCCACCCTGGCCTGACAGGCAGG + Intronic
1093638914 12:21502352-21502374 TCTACAAGTCCCTGGCTGGCTGG + Intronic
1095476816 12:42593973-42593995 TCTGCAAGGGCCTGGCTGTCAGG + Intergenic
1095787700 12:46128220-46128242 CACACCAGGGCCTGTCAGGCGGG - Intergenic
1096112711 12:49038758-49038780 CTCACCAGGGCCTGGCAGACGGG + Exonic
1096384957 12:51189218-51189240 TCCCCCAGGGCCTTGCTGTCTGG + Exonic
1096661014 12:53123970-53123992 GGCACCAGGGCCTGGCTTGGGGG + Intronic
1096966608 12:55632866-55632888 ACCAGCAGGGTGTGGCTGGCTGG - Intergenic
1097167537 12:57093730-57093752 CACCCCAAGGCCTGGCTGGCTGG - Intronic
1100998497 12:100330091-100330113 TCCACAAGGGCATGAATGGCAGG + Intronic
1101750660 12:107580536-107580558 TCCCCCAGACCCAGGCTGGCTGG - Intronic
1102201993 12:111063610-111063632 TCCAGCAGGGCCTGCCTTGGGGG + Intronic
1102454846 12:113065076-113065098 CCCACTGGGGCCTGGCAGGCTGG + Intronic
1103453974 12:121050277-121050299 TCCACTAGGGAGTGACTGGCAGG + Intergenic
1103721619 12:122978480-122978502 TCCAGCAGGGCCTGGCAGAAGGG - Exonic
1103723685 12:122987655-122987677 TCCACCTGGGCCCAGCAGGCTGG + Exonic
1103730815 12:123026653-123026675 TCCACCTTGGCCTTGCTGGGTGG + Intronic
1103742345 12:123099388-123099410 TCTGCCAGGGCTTGACTGGCGGG + Intronic
1103936832 12:124481476-124481498 CCCTCCAGGGCCTGCATGGCAGG - Intronic
1103950957 12:124550738-124550760 TCCACTAGGACCTGGCAGGGGGG + Intronic
1104056297 12:125233416-125233438 TCCTCCAGGGCCTGCCTGGAAGG - Intronic
1104373254 12:128242969-128242991 TCCACCTGGGCCTGGCTATGGGG - Intergenic
1104643928 12:130484010-130484032 TCCCCCAGGCACTGGCTTGCTGG + Intronic
1104715002 12:131010822-131010844 TCTTCCAGGGCCTGCCTGGCTGG - Intronic
1104892516 12:132147409-132147431 TCCCAGAGGGCCTGGCTGGCTGG + Intronic
1106155478 13:27151492-27151514 TACACCAGGGCCAGGCAGGGTGG + Intronic
1106519319 13:30483230-30483252 TCCACCAGGGCTTGGAAGCCTGG + Intronic
1106786545 13:33113424-33113446 GGCATCATGGCCTGGCTGGCAGG - Intronic
1108431825 13:50360859-50360881 TAGAGCAGGGCCTGGCAGGCAGG + Intronic
1108549778 13:51532340-51532362 CACACCAGGGCCTGTCAGGCAGG + Intergenic
1110132353 13:72023177-72023199 TCCATCAGGGTCTGACTGGTGGG - Intergenic
1111683672 13:91475621-91475643 TGCTCCAGGGCCTGGCTGGTGGG + Intronic
1112324832 13:98436995-98437017 TCTACCAGTGCCGGGGTGGCGGG + Intronic
1113563434 13:111302468-111302490 TACACCTTTGCCTGGCTGGCAGG + Intronic
1115197889 14:30821543-30821565 GCCACCAGGGCATGGCTGTAGGG - Intergenic
1117491794 14:56255469-56255491 TGCACCAGGGCCTGTCGGGGTGG + Intronic
1117558147 14:56907570-56907592 TCCACCAGATCCTTACTGGCTGG - Intergenic
1118255434 14:64201390-64201412 TCCCACAGGGCCTGGTGGGCAGG - Intronic
1118287315 14:64487647-64487669 TCCTCCAGGGCCTGGGTGGCAGG + Exonic
1119265888 14:73263089-73263111 TACCCCGGGGCCTGTCTGGCTGG + Intronic
1119417245 14:74480391-74480413 TCCTTCAGGTCCTGTCTGGCTGG + Intronic
1119478006 14:74942260-74942282 GCCGCCACGGCCTGGCTGGTGGG - Exonic
1119480059 14:74953476-74953498 TCCACCAGGGCTGGGCTGCTGGG + Intronic
1119728889 14:76938631-76938653 TCCTCCAGGGACTGGCAGGAGGG + Intergenic
1121254255 14:92519790-92519812 TCCATCAAGGCCACGCTGGCAGG - Intronic
1121348879 14:93157065-93157087 TTCACCAGGGACTGCCTAGCTGG + Intergenic
1121530687 14:94650549-94650571 GTGATCAGGGCCTGGCTGGCTGG + Intergenic
1121904016 14:97723384-97723406 TCCACCTGGGCTTGGCAAGCGGG - Intergenic
1121964337 14:98290148-98290170 TCCACCAGATCCAGGCTGACTGG - Intergenic
1122080036 14:99260829-99260851 GCCAACAGGGCCTGGCTCCCAGG - Intronic
1122548113 14:102535992-102536014 GCTCCCAGGGCCTGGCTGCCAGG - Intergenic
1122592813 14:102867567-102867589 TCAGCCATGGCCTGGCTGGGTGG + Intronic
1122627680 14:103092519-103092541 TCCACCAAGGCCTGGCTGTATGG + Intergenic
1122693340 14:103541670-103541692 TCTGGCAGAGCCTGGCTGGCAGG - Intergenic
1122703333 14:103605007-103605029 TACAGCAGGGCCTGGCACGCAGG - Intronic
1122797322 14:104212550-104212572 CCCAGCTGGGTCTGGCTGGCTGG - Intergenic
1122804171 14:104248281-104248303 TCCCCCAGGGCCTGGAGGCCTGG - Intergenic
1122816182 14:104315300-104315322 TGCCCCAGAGCCAGGCTGGCAGG - Intergenic
1122960510 14:105091855-105091877 TCCCCTGTGGCCTGGCTGGCAGG - Intergenic
1123180105 14:106461186-106461208 TCCACCAGGCGCGGGCAGGCAGG + Intergenic
1125509896 15:40287232-40287254 TCTACCAGGCCCTGGCTGTAGGG - Intronic
1125523322 15:40360088-40360110 GCAATCAGGGCCTGGCTGACAGG - Intronic
1125674969 15:41496931-41496953 TCAACCAGAGCCTGGATGACTGG + Intronic
1125729624 15:41885867-41885889 TCCACTGTGGCCAGGCTGGCTGG + Exonic
1125891939 15:43273591-43273613 TCCCCCAGGGCCTGGAACGCTGG - Intergenic
1128216241 15:65936213-65936235 CCCACCAGGGCAGGGCTGGTGGG - Intronic
1128349750 15:66880979-66881001 TCCCACTGGGCCTGGCTGGGTGG + Intergenic
1129403896 15:75301791-75301813 CCCAGCAGGGCCTGGCAGGGTGG - Intergenic
1131456691 15:92587373-92587395 TCCATCAGGGGCTGGCAGGCAGG + Intergenic
1131511185 15:93050435-93050457 TCCAGCAGAGCCTGGTTGACAGG + Intronic
1132681485 16:1144271-1144293 TCCTCCAGGGCCTGGATGAGAGG + Intergenic
1132846899 16:2004847-2004869 TCCACCAGGGGCGGGGTGGGCGG + Intronic
1132896017 16:2229768-2229790 GAGACCAGGGCCTGGCTGGGAGG + Intronic
1132929619 16:2452164-2452186 TCACCCAGGGCCTCGCTGTCCGG + Intronic
1133015610 16:2938132-2938154 GCCACAGGGGCCTGGGTGGCAGG - Intronic
1133023870 16:2979417-2979439 GCTACCTGGGCCTGGCTGGCAGG + Intronic
1133222298 16:4323978-4324000 TGCCCCAGGGCCAGGCTGCCTGG - Intronic
1133285715 16:4689696-4689718 GCCACCAGGTCCTCCCTGGCAGG - Exonic
1133289984 16:4714019-4714041 CCCAGCAGGGCGCGGCTGGCAGG + Intronic
1134095356 16:11415142-11415164 GCCACCTGGCCCTGGCTGGAGGG + Intronic
1135484874 16:22855432-22855454 GCTTCCAGGCCCTGGCTGGCTGG + Intronic
1135776065 16:25258135-25258157 GGCACCGGGGCCTGGCTGCCGGG + Intergenic
1136021736 16:27444868-27444890 CCCAACAGGGCCTGGCCAGCAGG - Intronic
1136290268 16:29267448-29267470 TCCTGCAGGCCCTGGCTGCCAGG + Intergenic
1136566360 16:31073114-31073136 CCCTCCAGGGGCTGCCTGGCTGG - Intronic
1136643841 16:31591602-31591624 TACCCCAGGTCATGGCTGGCAGG - Intergenic
1136661764 16:31769168-31769190 TACCCCAGGTCATGGCTGGCAGG + Intronic
1136666751 16:31819447-31819469 CCCCCCGGGGCCTCGCTGGCTGG - Intergenic
1137234956 16:46608933-46608955 ACCACCAGTACCTGGCTGGATGG + Intronic
1137611637 16:49822050-49822072 TCCAGCAGTCCCTGGTTGGCTGG + Intronic
1137675490 16:50301891-50301913 TCCCCCAGGGTCTGGCAGTCGGG - Intronic
1137733967 16:50710728-50710750 TCCTCCAGGCCCAGGGTGGCTGG - Exonic
1138279292 16:55760851-55760873 TCCGCGCGGGCCAGGCTGGCTGG - Intergenic
1138289239 16:55832825-55832847 TCCGCGCGGGCCAGGCTGGCCGG + Intronic
1138450784 16:57092584-57092606 TCCTCCCGGGCCGGGCGGGCGGG - Exonic
1138454843 16:57115355-57115377 TGCACCCCGCCCTGGCTGGCTGG - Intronic
1138925097 16:61581371-61581393 TCCACCAGGAACTGGCAGCCTGG + Intergenic
1139188611 16:64836156-64836178 GCCACCAGGCCATGACTGGCTGG - Intergenic
1139373228 16:66480931-66480953 ACCAGCAGGACCCGGCTGGCTGG - Exonic
1139385434 16:66566196-66566218 GGCACCCGGGCCTGGGTGGCAGG + Intronic
1139434536 16:66928435-66928457 CCCACCATGGCCTGGCTGCCAGG + Intergenic
1140001239 16:71027329-71027351 TCTACCAGAGACTTGCTGGCTGG + Intronic
1140477749 16:75247424-75247446 TCCACCCGGGCTGGGCAGGCAGG + Intronic
1141155070 16:81591713-81591735 CCCATCTTGGCCTGGCTGGCAGG + Intronic
1142096154 16:88240969-88240991 TCCTGCAGGCCCTGGCTGCCAGG + Intergenic
1142167514 16:88600383-88600405 TCCTCCAGGGCATTGATGGCTGG + Intronic
1142493294 17:292609-292631 CCCAGCCGGGCCTGGCTGCCTGG + Intronic
1143447668 17:7018677-7018699 TCCACCAGGCCAGGGCAGGCGGG + Intergenic
1143579467 17:7817278-7817300 TCCTCCAGGCCCTGGCGGACAGG - Exonic
1143845077 17:9767753-9767775 GCCACTGGGGACTGGCTGGCAGG - Intergenic
1147189441 17:38730266-38730288 TCTTCCGGGGCCTGGCGGGCCGG + Exonic
1147384715 17:40074374-40074396 TGCCCTAGGGCCTGGGTGGCAGG + Exonic
1147574456 17:41590634-41590656 GTCACCAGGGACTGGATGGCAGG + Intergenic
1147728517 17:42581954-42581976 TCCAGAAGGGCCTGGTTGGGAGG + Exonic
1147846354 17:43406830-43406852 GCCACCTGGGACTGCCTGGCTGG + Intergenic
1147914205 17:43877056-43877078 CCCCACAGGGCCAGGCTGGCAGG - Intronic
1149161143 17:53694611-53694633 TCCACCAGGGCATATCTGTCAGG - Intergenic
1151659113 17:75509351-75509373 TCCACCAGAGCCTGGGGGGCAGG - Intronic
1151957933 17:77389708-77389730 GCCGCCAGGGCCTGGGTGGGAGG - Intronic
1152252691 17:79220033-79220055 TCCCCCAGGGCCCAGCAGGCAGG - Intronic
1152406339 17:80100174-80100196 GCCTCCCGGGCCAGGCTGGCTGG - Exonic
1152433445 17:80261474-80261496 TCCCCCAGGGCCCGGCCCGCCGG - Intronic
1152467371 17:80473934-80473956 GGCACCAGGGCCTGGCTGTCGGG - Intronic
1152505538 17:80747336-80747358 TCCTCCTGGGCCTGGCAGACAGG + Intronic
1152597422 17:81244587-81244609 GCCCCCAGGGCCAGGCTGACGGG - Intergenic
1152698678 17:81808452-81808474 GCCACCCAGGGCTGGCTGGCTGG - Intronic
1152904156 17:82961264-82961286 TCCACCGGTTCCTGGTTGGCCGG - Intronic
1155261730 18:24050046-24050068 TCTTCCCAGGCCTGGCTGGCTGG + Intronic
1155308141 18:24498913-24498935 TCCACCAAGGCCTTGCTGCCAGG + Intergenic
1155839024 18:30625228-30625250 TCCACATGGGCCTTGCTGGCTGG - Intergenic
1156463352 18:37333929-37333951 TCCAGAAGGGCCTTGCTGGGAGG + Intronic
1156823347 18:41399383-41399405 TCCACCAGGGACTGGCTTCATGG - Intergenic
1157815960 18:50729657-50729679 TCCACCGGGGCCGGGCGGCCGGG - Exonic
1158934755 18:62354384-62354406 GCCACCAGGGCCTTGCCTGCGGG - Exonic
1160021807 18:75187060-75187082 TCCACCAGGCCCTGGTTGCATGG + Intergenic
1160513425 18:79465490-79465512 ACCACATGGGCCAGGCTGGCTGG - Intronic
1160624693 18:80195303-80195325 TCCACCGAGGCCAGGCTGACAGG + Intronic
1160745889 19:710440-710462 TCCTCCGGGGCCTGGCGAGCAGG - Intronic
1160898732 19:1416045-1416067 TTCACCAGGGGCTGACTCGCGGG + Intronic
1161200799 19:3013733-3013755 TCCACCAGGTCCCGACGGGCAGG + Exonic
1161320565 19:3638915-3638937 TCGTCCGAGGCCTGGCTGGCAGG + Exonic
1161408642 19:4103892-4103914 TCCACCTGGCCCTGGCTCACTGG - Intronic
1161644655 19:5445658-5445680 CCCTCCTGGGCCTGGCTGGGAGG + Intergenic
1161746515 19:6063503-6063525 TCCAGCAGGGCCAGGCAGGCTGG + Intronic
1162477342 19:10908446-10908468 TAGACCAGGGCCTGGCATGCAGG - Intronic
1162787292 19:13043678-13043700 TCCCCCAGGGCCATGCAGGCAGG + Intronic
1163126777 19:15248471-15248493 TTCACCAGTGCCTGCCTGGCAGG + Intronic
1163575304 19:18107624-18107646 TTCACCTGGGACTGGCGGGCTGG + Intronic
1163606684 19:18279712-18279734 CCCGCCGGGGCCTGGCGGGCTGG - Intergenic
1163810806 19:19430249-19430271 TCTACCATGCGCTGGCTGGCTGG - Intronic
1164918122 19:32068081-32068103 TCAAACAGGGCCCGGCTGCCTGG + Intergenic
1165495517 19:36150302-36150324 TCCTCCTGGGCCTGGCAGGCTGG - Exonic
1165604114 19:37085440-37085462 TCCACCAGGTCATTCCTGGCAGG + Intronic
1165742375 19:38211646-38211668 TCCTCCAAGGCCTGGCTGGGTGG - Intronic
1165863193 19:38919892-38919914 TGCACATGGGCCAGGCTGGCAGG + Intronic
1166720788 19:44994653-44994675 TGCACCATGGCCTGACTGACAGG + Intergenic
1167739058 19:51312833-51312855 CCCAGTAGGGCCTGGCAGGCAGG + Intronic
1168640609 19:58029091-58029113 TCTCCCAGGGCCTGGATGCCTGG - Intergenic
925224462 2:2171053-2171075 TCACCCGGGGCCTGGCTGGAGGG + Intronic
925388517 2:3479982-3480004 TCCTCCACCGCCAGGCTGGCAGG - Intronic
925389981 2:3488012-3488034 TCCACCAGAGCCTGTCTGTGAGG - Intergenic
925769878 2:7271559-7271581 TCAAACTGTGCCTGGCTGGCTGG + Intergenic
927203196 2:20591110-20591132 GCTATCAGGGCCTGGCTGGCTGG - Intronic
927678645 2:25125310-25125332 TCCAAGTGGGCCTGGCTGGCAGG - Intronic
928313136 2:30226838-30226860 TCCAGGAGGGCAGGGCTGGCAGG - Intergenic
932577080 2:72968523-72968545 TCCAGCAGGGCCTGAGGGGCAGG + Exonic
935205495 2:100893265-100893287 CTCACCAGGGACTGGCTGGGAGG + Intronic
936073350 2:109385727-109385749 TCCACCCTGGCAGGGCTGGCTGG - Intronic
937528659 2:122801777-122801799 TCTACCACGGCCTGGCTGTAGGG - Intergenic
938092781 2:128444236-128444258 CACACCAGGGCCTGCCTGCCAGG - Intergenic
938232699 2:129675334-129675356 TCACCCAGGGCCTGGCTCTCGGG - Intergenic
938989446 2:136612842-136612864 TGCTCCTGGGCTTGGCTGGCTGG + Intergenic
939630616 2:144523358-144523380 GGCACCAGGTCCTGGCTGGAGGG - Intronic
942278889 2:174342086-174342108 TCCACGCGGGCCTCGCGGGCCGG - Intergenic
942452449 2:176116651-176116673 TGCTCCAGAGCCTGGCCGGCCGG - Exonic
942644044 2:178091714-178091736 TACAGCAGGGCCTGGGTGGAAGG - Intronic
944774360 2:202947459-202947481 TACACCAGGGCCTGTCGGGGGGG + Intronic
946196433 2:218035163-218035185 CCCAGGAGAGCCTGGCTGGCTGG - Intronic
946200715 2:218069327-218069349 CCCAGGAGAGCCTGGCTGGCTGG - Exonic
946304458 2:218847757-218847779 TCCCCCAGGGCCTGACTGCAGGG - Intergenic
946326046 2:218985205-218985227 TCCGGCAGGGCCTGGCGGGAGGG + Exonic
947753489 2:232544828-232544850 TCCACACAGGCCTGGATGGCTGG - Exonic
948383160 2:237564783-237564805 CCCAGCAGGGCTGGGCTGGCAGG + Intergenic
948810805 2:240476855-240476877 TTCCTCAGGGCCTGGCTTGCTGG - Intergenic
1168772407 20:423800-423822 TTCACCTGGGCCTGGCTGGTGGG + Intronic
1169394819 20:5220069-5220091 TCCACCAGGGATGGGCGGGCTGG + Intergenic
1170164238 20:13345353-13345375 TTCACCAATGGCTGGCTGGCAGG + Intergenic
1170603404 20:17858993-17859015 TCCACAAGGACCAGGCTGCCAGG - Intergenic
1171593983 20:26646632-26646654 TCCATGTCGGCCTGGCTGGCCGG - Intergenic
1171902689 20:30872004-30872026 CACACCATGCCCTGGCTGGCAGG + Intergenic
1172195649 20:33089758-33089780 TCCACCAGGGTCTGGGAGTCAGG + Intronic
1172444567 20:34986267-34986289 ACCACCAGGGCCTGGCCTGATGG - Intronic
1172668207 20:36615236-36615258 TCCACCAGGGCCTGGAGTGAGGG + Exonic
1173161810 20:40658475-40658497 TCAGGCAGGGTCTGGCTGGCTGG - Intergenic
1173250618 20:41362495-41362517 TGCACCAGAGCCTTGATGGCCGG - Exonic
1174173728 20:48632340-48632362 TCCTCCGCGGCCTGGCTGCCTGG + Exonic
1174285156 20:49467661-49467683 CCCACCATGGGCTGGCAGGCAGG - Intronic
1174357489 20:50008434-50008456 GACAGCAGGGCCTGGCCGGCAGG + Intergenic
1174519477 20:51118570-51118592 CCCACCACTGCCTGGCTGCCTGG + Intergenic
1175885408 20:62287879-62287901 GCCCACAGGGCCTGGCAGGCAGG - Intronic
1176086043 20:63296003-63296025 CCCACCAGGGCCTGACAGGCCGG + Intronic
1176109895 20:63406433-63406455 TCCAACAGGGGCTGGAGGGCTGG - Exonic
1176135289 20:63519867-63519889 TACACCCGGTCCTGGCTGGGCGG - Intergenic
1176137564 20:63530812-63530834 TCCACCGGGACCTGGCCGCCAGG - Exonic
1176248914 20:64110807-64110829 CCTACCAGGGCCTGCCTGGCTGG - Intergenic
1178770984 21:35503891-35503913 TCCTCCAGGGCCTGTTTGGAGGG + Intronic
1178948257 21:36966211-36966233 TCCAGCACCGCCCGGCTGGCCGG + Intronic
1179442283 21:41403619-41403641 TCCACCGAGGACTGGCTGGTAGG + Intronic
1179799580 21:43804685-43804707 TCCCACACGGCCTGGCTGGCTGG - Exonic
1180336079 22:11577975-11577997 CACACCATGCCCTGGCTGGCAGG + Intergenic
1180947705 22:19705740-19705762 ACCACCAGTGCCAGGCAGGCAGG - Intergenic
1181044752 22:20209275-20209297 GCCACCACGGCCAGGCTGGAAGG - Intergenic
1182122458 22:27796834-27796856 TCCACCAGGGCCTTGTCAGCGGG + Exonic
1182796786 22:32996841-32996863 TCCAGCAGGGCGGGGCTGCCTGG + Intronic
1182828266 22:33284129-33284151 TCCTTCTGTGCCTGGCTGGCAGG - Intronic
1183341628 22:37284817-37284839 TCCCCCAGGGCCTGCCGGGAAGG + Intronic
1183362686 22:37390855-37390877 TCCCCCTGGGCCAGCCTGGCTGG - Intronic
1183465584 22:37978723-37978745 TGCACCAGGGCCTGGGAAGCGGG + Intronic
1184129922 22:42511688-42511710 CCCACCTGTGGCTGGCTGGCTGG + Exonic
1184233351 22:43170136-43170158 TCCAGCATGGCATGGATGGCGGG - Intronic
1184275702 22:43408506-43408528 TCCACACAGACCTGGCTGGCAGG + Intergenic
1184471640 22:44699302-44699324 ACAGGCAGGGCCTGGCTGGCAGG - Intronic
1184539481 22:45110847-45110869 TCTTCCAGGTCCTGGCTGCCTGG - Intergenic
1184717306 22:46289451-46289473 TCCACCAGGGCCTGGCACAGGGG - Exonic
1184767657 22:46579962-46579984 GACACCAGGGACTGGCTGGGTGG + Intronic
1185027342 22:48423041-48423063 CACAGCAGGGCCAGGCTGGCTGG + Intergenic
1185091732 22:48779357-48779379 GCCAGCAGGGCCAGGCAGGCAGG - Intronic
1185141721 22:49106371-49106393 TCTGCCAGGGCCTGCATGGCCGG + Intergenic
1185399106 22:50606822-50606844 TCCGACGGGGCCAGGCTGGCAGG + Intronic
949898529 3:8790994-8791016 TCCACCAGCACTTGCCTGGCAGG + Intronic
950670797 3:14524307-14524329 CCCACCAGGGCCTGGGTGGCAGG - Intronic
950934105 3:16821311-16821333 GCCACCAGGTCCTGCCTGGATGG + Intronic
953755685 3:45643922-45643944 CCCACTAAGGCATGGCTGGCAGG - Intronic
953843694 3:46410155-46410177 GCTACCAGGGCCTTGCTGCCAGG + Intronic
954256520 3:49411563-49411585 TCCACCAGGCCCGGCCGGGCGGG + Intronic
954412866 3:50378621-50378643 TGCACTTGGGCCTGGCTGCCGGG - Intronic
954443774 3:50535771-50535793 TCCACCAGGGCCTTGGGAGCAGG - Intergenic
956389442 3:68755710-68755732 ACCACCTGGGCCTGGCTGTAGGG - Intronic
956612456 3:71137931-71137953 TCCTTGAGGGCCTGGCTGGTGGG - Intronic
956731153 3:72197910-72197932 GCACTCAGGGCCTGGCTGGCAGG - Intergenic
961372900 3:126442249-126442271 TCCAGCAGCTGCTGGCTGGCAGG + Intronic
961715113 3:128852634-128852656 GCCGCCAGGACCTGGGTGGCAGG - Intergenic
961809567 3:129514051-129514073 CCTAGGAGGGCCTGGCTGGCAGG + Intronic
962295046 3:134175938-134175960 TCCACAAAGACCTGGCTGCCAGG - Exonic
962871197 3:139494348-139494370 TGCATCTGGACCTGGCTGGCTGG + Intergenic
963133335 3:141877296-141877318 TCCGCCAGGGCCTCTCGGGCCGG - Intronic
966516020 3:180821522-180821544 TCCATCCTGGCCTGGCTGCCAGG + Intronic
966818288 3:183906546-183906568 TCAGCCAGGGCCTGGCAGGGAGG - Intergenic
967732231 3:192917351-192917373 GCCACCTGGGGCTGGCAGGCAGG - Intronic
968551138 4:1223861-1223883 TCAACCTGGGCCTGGCTGTGTGG + Intronic
968816443 4:2824108-2824130 TGCCCCGGTGCCTGGCTGGCAGG + Intronic
968898382 4:3418493-3418515 TCCACCAGGGCCATGCCAGCTGG - Intronic
968984482 4:3867627-3867649 GCCTCCAAGGCCTGGCTGGCAGG - Intergenic
969489282 4:7490099-7490121 ACCCCAGGGGCCTGGCTGGCTGG + Intronic
969882723 4:10188530-10188552 CCTCCCAGGGTCTGGCTGGCTGG + Intergenic
972484302 4:39527503-39527525 TCCAGGAGGGCCTGGCTGCGGGG - Exonic
972741393 4:41890106-41890128 TCATCCAGAGCCTGGCTTGCTGG + Intergenic
975561112 4:75709133-75709155 GCCACCATGCCCTGCCTGGCTGG - Intronic
976500263 4:85779799-85779821 TCCCCGAGGCCCTGGCTAGCTGG + Intronic
977995124 4:103492198-103492220 TCCTCCATGGCCTGGCATGCTGG - Intergenic
980097922 4:128512314-128512336 TCTGGCAGGGCCTGGCTGCCTGG - Intergenic
981369601 4:143944794-143944816 TCTCCCAGAGCCTGCCTGGCAGG - Intergenic
981938802 4:150260214-150260236 TCCACCAGTCCTTGGCTGCCAGG - Intergenic
985112052 4:186555726-186555748 CCCAGCAGGGCCAGGCTGCCTGG + Intergenic
985576243 5:674727-674749 TCCAGCAGGGGATGGCAGGCTGG + Intronic
986385522 5:7229979-7230001 TTCACCAAGGCCTGGATAGCAGG + Intergenic
986430794 5:7679254-7679276 TCCCCCGGGACCTGGATGGCTGG - Intronic
987034644 5:14007424-14007446 GCCACCAGGGCTTGGCTGTGAGG - Intergenic
988264543 5:28930478-28930500 TATACCATGTCCTGGCTGGCTGG + Intergenic
990333122 5:54746628-54746650 CCCACCGAAGCCTGGCTGGCTGG + Intergenic
994701711 5:103142292-103142314 TTGTCCAGGGCCAGGCTGGCCGG + Intronic
996810576 5:127512464-127512486 TCCAGCAGGAGCTGGCTGGTTGG + Intergenic
997264864 5:132489698-132489720 TCCTCCAGAGACTGGCTGGGAGG - Intronic
999200578 5:149813409-149813431 GCCAGCATGGTCTGGCTGGCAGG + Intronic
999263327 5:150250866-150250888 TCCCCCAGCCCCTGACTGGCAGG + Intronic
1001313871 5:170629420-170629442 TCCATCAGGGCTTGGCTGTCCGG - Intronic
1001437081 5:171707757-171707779 TCCAGCAGGGCCTGGCACACAGG + Intergenic
1001476527 5:172054724-172054746 GGGACCAGGGCCTGGCTGGTTGG + Intronic
1001721525 5:173860764-173860786 TGCAGCAGGGCCTGGCTGGCTGG - Intergenic
1002173086 5:177386100-177386122 TCCTCCAGGGCCAGCTTGGCAGG - Exonic
1002350158 5:178577535-178577557 TTCAGCAGGGCCTGGCGCGCGGG + Intronic
1003306241 6:4932122-4932144 CCCACCAGGGCAAAGCTGGCTGG - Intronic
1005114269 6:22318591-22318613 TCCAGCACGGCGTGGCGGGCCGG + Intergenic
1005960268 6:30688751-30688773 TCTACCTGGGCCTGGCTCACGGG - Exonic
1006377273 6:33678490-33678512 TGCAGCAGGGCCTGGTTGCCGGG - Exonic
1006934858 6:37710220-37710242 TCCTCCACAGCCTGGCTGGGTGG - Intergenic
1009431852 6:63573311-63573333 ACCACCCGTGCCTGGCTGTCCGG - Intronic
1010685151 6:78845789-78845811 TCCACCTTGGCCTAGCTGCCTGG + Intergenic
1010881038 6:81172153-81172175 TCCAACATGGGCTGGCTGGCTGG + Intergenic
1015961159 6:138650459-138650481 TCCACCAGGCCCTGGCCATCCGG - Intronic
1017884414 6:158587216-158587238 TCAAGCAGGGCCAGGCTGCCAGG + Intronic
1018724113 6:166597388-166597410 GCCCCCATGGCCTGGCTGCCAGG - Intronic
1019060477 6:169254056-169254078 TCCTCCCAGGCCTGTCTGGCAGG - Intergenic
1019280165 7:195678-195700 TGCAGCAGGGCCTCGATGGCCGG - Exonic
1019298417 7:290870-290892 TGCGCCAGGGCCTCGGTGGCGGG + Intergenic
1019367900 7:644681-644703 CCCACCAGGGCCTGGGTGGCTGG + Intronic
1019453093 7:1109757-1109779 TGCCCCAGGGCCCGGCGGGCGGG - Intronic
1019547513 7:1585646-1585668 TCCACCACGGCCTGGGTGGACGG + Intergenic
1019605832 7:1909739-1909761 AGCAGCAGGCCCTGGCTGGCAGG - Intronic
1019624525 7:2009256-2009278 TCTGCCATGTCCTGGCTGGCAGG - Intronic
1019899210 7:4006885-4006907 TCAGGCAGGGCCAGGCTGGCGGG + Intronic
1023413277 7:39909093-39909115 TGCCCCAGGGCCTGGATTGCCGG - Intergenic
1023871104 7:44263480-44263502 TGCCCCAGAGCCCGGCTGGCAGG + Intronic
1024985567 7:55190826-55190848 TCTGCAAGGGCCAGGCTGGCAGG - Intronic
1026556303 7:71411619-71411641 TCCACCAGAGCCAGGCTTCCTGG + Intronic
1026582802 7:71632257-71632279 TCCCCCAGGGCCTTGCTTCCAGG - Intronic
1026863870 7:73810887-73810909 CCCACCAGGGCCTGGGAGGATGG - Intronic
1027201966 7:76069605-76069627 TCCACCAAGGACGGGTTGGCAGG + Intergenic
1027687395 7:81294863-81294885 TCCACCAGGAACTGGCAGCCCGG + Intergenic
1029544202 7:101201901-101201923 TCCACCTGGGCCGGACTGGGCGG + Intergenic
1029598060 7:101548219-101548241 TCCAGCATGGCCTGGCTCCCAGG - Intronic
1029606182 7:101600800-101600822 TCCAGGAGGGCCTGCCTGGATGG + Intergenic
1031971657 7:128068999-128069021 TCCTGCAGGGCATGGCTGGCTGG + Intronic
1032196880 7:129794547-129794569 TGCACCAGGGCAGTGCTGGCCGG + Intergenic
1033237217 7:139647878-139647900 TCAGCGAGGGCCTGCCTGGCAGG + Intronic
1033543886 7:142382117-142382139 ACCAGCAGTGCCTGGCAGGCAGG + Intergenic
1034557479 7:151859281-151859303 TGCAGCAGGGACTGGCTTGCGGG - Intronic
1034965728 7:155389456-155389478 TCCACCTGGGGCTGCCTTGCTGG - Intronic
1035435271 7:158854960-158854982 TTCACGGGGGCCTGGCTGGCAGG + Intergenic
1036465181 8:8990757-8990779 TCCACCAAGGCCTGGCGTGGTGG - Intergenic
1037882522 8:22579937-22579959 TCCCCCAGGGGCCGGCTGCCAGG - Intronic
1038927754 8:32158945-32158967 CCCACCAGAGTCTGTCTGGCAGG + Intronic
1039346613 8:36712116-36712138 TCGACCAGGAGCAGGCTGGCTGG - Intergenic
1040396307 8:47003703-47003725 TCTACCTGGTCCTGGCTGACAGG - Intergenic
1041491417 8:58437608-58437630 TCCACCAGGGCCAGGCATGGTGG - Intronic
1043463789 8:80486241-80486263 TCCGCCAGGGCCTGGTCGGACGG + Exonic
1043880425 8:85536072-85536094 AGCACCTGGGCCTGCCTGGCAGG + Intergenic
1045963960 8:108001866-108001888 CACACCAGGGCCTGTCTGGCAGG + Intronic
1048000561 8:130376270-130376292 TCCACCAGGCCCTGGCTGTGTGG - Intronic
1049189163 8:141277056-141277078 TCCTTCAGAGCCTGGCTCGCAGG - Intronic
1049219993 8:141424806-141424828 TGCATCAGGGTCTGCCTGGCTGG + Intronic
1049225768 8:141449826-141449848 ATCACCAGGGCCTGGGTGCCTGG + Intergenic
1049466649 8:142754082-142754104 TTCACCCAGGCCTGGCTGGGCGG - Intergenic
1049550373 8:143255071-143255093 TGCAGCAGCGCATGGCTGGCAGG + Intronic
1049771427 8:144383822-144383844 TCCACCAGGCTCAGGCTAGCAGG - Intronic
1049803493 8:144528752-144528774 ACCACCAGGGCCAGGTGGGCGGG - Exonic
1050561109 9:6834981-6835003 TGCATCTGGACCTGGCTGGCCGG + Intronic
1051592281 9:18788425-18788447 TCTACCGGGGCCTAGTTGGCAGG - Intronic
1053297217 9:36923450-36923472 TCAGCCATGGCCTCGCTGGCTGG - Exonic
1053297840 9:36927623-36927645 TCCCCCAGGGCCTGGCTTATAGG - Intronic
1053469943 9:38339265-38339287 TCAACCACAGCCTTGCTGGCAGG - Intergenic
1054943222 9:70766812-70766834 GCCACCAGGGCCAGGCTGTCTGG + Intronic
1056355656 9:85798989-85799011 TACACCAGGGCCTGTCGGGAGGG - Intergenic
1056761167 9:89415919-89415941 TCCCCCAGAGCTTGGCTTGCAGG + Intronic
1056879694 9:90379491-90379513 ACCACCAAAGCATGGCTGGCCGG + Intergenic
1057287808 9:93774495-93774517 CCCACCAGTGCCTCGGTGGCAGG + Intergenic
1058526624 9:105865571-105865593 TCTAGCAGAGCCTGGCTGGATGG + Intergenic
1058879950 9:109277602-109277624 TCCAGCAACGCCTGGCAGGCTGG + Intronic
1060506319 9:124200869-124200891 TCGATCAGGGCCTGGGTGACAGG - Intergenic
1061390192 9:130313362-130313384 TCCACCAGTGCCTCGCAGGCTGG - Intronic
1061669476 9:132180540-132180562 TCCCCCAGGCACTGGCTGCCAGG + Intronic
1061797824 9:133098558-133098580 CCTCCCAGGGTCTGGCTGGCTGG - Exonic
1061917265 9:133761813-133761835 TCCAGCAGGGTCTGTCTGACTGG - Intergenic
1062023604 9:134330398-134330420 GCCACAAGGGCCTGGGGGGCTGG + Intronic
1062042365 9:134409978-134410000 CCCACCAGGGGCTGGCGGGGAGG - Intronic
1062370054 9:136234056-136234078 TCCACCTGGGGCAGCCTGGCCGG + Intronic
1062458959 9:136654941-136654963 TCCACGCAGGCCTGGGTGGCCGG - Intergenic
1186910639 X:14160846-14160868 TACACCAGGGCCTGTCGGGGGGG - Intergenic
1189250783 X:39599437-39599459 GCCTCCAGGGCCTGCCTGCCTGG + Intergenic
1192261335 X:69507258-69507280 TCCACAAGGGCCATGCTGGATGG - Intronic
1192431952 X:71118706-71118728 ACCAGCAGGGCCAGGCTGACTGG - Exonic
1193780720 X:85698628-85698650 TCCAACAGGGCTTGTCAGGCAGG - Intergenic
1197252090 X:124227124-124227146 TCCCCCAGGGCCTGGGTGCTTGG - Intronic
1197833676 X:130672364-130672386 TCCACCAGGACCGGGCCAGCAGG - Intronic
1199752394 X:150832760-150832782 TCCACCAGGGCCGGGCGTGGTGG + Intronic
1200106263 X:153714877-153714899 ATCAGCAGGGCCTGGCTGGGAGG - Intronic
1200215286 X:154365546-154365568 TCCCACAGGGCCGGGCTGTCAGG + Intronic
1201752215 Y:17445383-17445405 TCCACCTGGTCCAGGCTGCCTGG + Intergenic