ID: 901059280

View in Genome Browser
Species Human (GRCh38)
Location 1:6464694-6464716
Sequence ACAGTTCTCCAGCGCCACCT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 88}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901059275_901059280 15 Left 901059275 1:6464656-6464678 CCTGGCTTACAGCCACAGCGGGT 0: 1
1: 0
2: 2
3: 7
4: 92
Right 901059280 1:6464694-6464716 ACAGTTCTCCAGCGCCACCTGGG 0: 1
1: 0
2: 0
3: 8
4: 88
901059271_901059280 26 Left 901059271 1:6464645-6464667 CCACAAACCAGCCTGGCTTACAG 0: 1
1: 0
2: 3
3: 102
4: 3268
Right 901059280 1:6464694-6464716 ACAGTTCTCCAGCGCCACCTGGG 0: 1
1: 0
2: 0
3: 8
4: 88
901059277_901059280 3 Left 901059277 1:6464668-6464690 CCACAGCGGGTGTCGGCCACTGC 0: 1
1: 0
2: 0
3: 5
4: 83
Right 901059280 1:6464694-6464716 ACAGTTCTCCAGCGCCACCTGGG 0: 1
1: 0
2: 0
3: 8
4: 88
901059272_901059280 19 Left 901059272 1:6464652-6464674 CCAGCCTGGCTTACAGCCACAGC 0: 1
1: 0
2: 2
3: 35
4: 402
Right 901059280 1:6464694-6464716 ACAGTTCTCCAGCGCCACCTGGG 0: 1
1: 0
2: 0
3: 8
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901059280 Original CRISPR ACAGTTCTCCAGCGCCACCT GGG Exonic
901059280 1:6464694-6464716 ACAGTTCTCCAGCGCCACCTGGG + Exonic
901483293 1:9540247-9540269 ACCGTTCACCAGCACCACCCAGG - Intronic
903969437 1:27109306-27109328 GCACTTCTGCAGCGCCCCCTGGG - Intronic
904330405 1:29754748-29754770 TGAGCTCTCCAGGGCCACCTGGG - Intergenic
909204922 1:72743694-72743716 CCAGTCCTCCAGCCCCATCTTGG - Intergenic
909851918 1:80477428-80477450 ACATGTCTCCAGAGCCTCCTAGG + Intergenic
911145049 1:94543230-94543252 AGAGATCTTCAGCTCCACCTGGG + Intergenic
915347505 1:155205211-155205233 ACAGTTCTCCTGCGACTCCGAGG - Exonic
915569328 1:156735796-156735818 ACGGTTCTCCTGGGCCACGTGGG - Exonic
915634655 1:157177797-157177819 ACTGGTCACCAGGGCCACCTGGG + Intergenic
917609696 1:176674548-176674570 AATGTTCTCCAGCTCCATCTAGG + Intronic
923095029 1:230768381-230768403 TCTGTTCTCCAGCTCCACCCTGG + Intronic
1063980560 10:11448404-11448426 CAAGTTCCCCAGCCCCACCTCGG - Intergenic
1065007727 10:21395226-21395248 CCAGTTCTCCAATGCCACCTAGG + Intergenic
1066335093 10:34468204-34468226 AAGGTTCTCCAGGACCACCTAGG + Intronic
1066397149 10:35037292-35037314 GCCGCTCTGCAGCGCCACCTTGG + Intronic
1072214142 10:93273563-93273585 AGAGTTCTCCAGCTCAAGCTGGG - Intergenic
1073596328 10:104803984-104804006 ACAGTTCTCCAGGGCTGACTTGG - Intronic
1075427100 10:122350451-122350473 ACATTTCTCCACTGCCACCTGGG - Intergenic
1077055037 11:587400-587422 ACAGTTCTCCGGCGTCCCCACGG - Exonic
1077378647 11:2217583-2217605 ACAGTCCTGCAGCACCCCCTGGG - Intergenic
1080551584 11:33376962-33376984 ATACCTCTCCACCGCCACCTGGG - Intergenic
1083131321 11:60625427-60625449 ATTGCTCTGCAGCGCCACCTTGG - Intergenic
1084777784 11:71388751-71388773 GCAGTTCTCCAGAGCCTACTTGG + Intergenic
1087036107 11:93758242-93758264 ACGGAGCTCCAGCGCCAACTCGG - Intronic
1087224819 11:95586738-95586760 AGAGTCCTCCAGCCCCACCCTGG + Intergenic
1097041413 12:56158201-56158223 TCCTTTCTCCAGCGCCACCTGGG - Exonic
1098023388 12:66177856-66177878 ACAATTCTCCAACACCAACTGGG - Intergenic
1098915985 12:76257219-76257241 CCAATTCTCCAGCACCAACTTGG - Intergenic
1101963070 12:109264547-109264569 ACTGGTCTGCAGTGCCACCTGGG - Intronic
1101969260 12:109301317-109301339 ACAGTTCTCCAGTGCCTACCTGG - Intronic
1103932264 12:124457097-124457119 CCAGCTCACCAGCTCCACCTGGG + Exonic
1105999475 13:25706986-25707008 ATAGTTCTTCAGCACCATCTTGG + Intronic
1106049886 13:26180116-26180138 CCAGTTATCCATCGCCATCTTGG + Intronic
1106576742 13:30981811-30981833 ATAGTTCTCCAGCACCAGGTAGG + Intergenic
1107103129 13:36615431-36615453 ACAGTTCACCAGCGGCTCCAAGG + Intergenic
1113781420 13:112979719-112979741 GCAGTTCCCCGGCGCCTCCTGGG - Intronic
1116869241 14:50055955-50055977 TCAGTACTCCAGTGCCACCAGGG + Intergenic
1119949462 14:78729543-78729565 ACAGTTCTTCTCCACCACCTAGG - Intronic
1121008734 14:90507420-90507442 ACAGTTCTCCCCCACCACCATGG - Intergenic
1121231474 14:92361997-92362019 ATACTTCTCAAGCACCACCTGGG - Intronic
1121680359 14:95788246-95788268 CCATTTCCCCAGCTCCACCTAGG + Intergenic
1126896569 15:53264063-53264085 CCAGTTCTCCAACACCAGCTGGG + Intergenic
1136748273 16:32611494-32611516 ACAGTTCTGCATCATCACCTGGG + Intergenic
1139354414 16:66358943-66358965 CCAGTTCTCCAACACCACTTGGG + Intergenic
1141799301 16:86296214-86296236 ACAGCACACCAGCCCCACCTTGG - Intergenic
1142025672 16:87812184-87812206 ACATGTCTCCAGCCTCACCTGGG + Intergenic
1203050408 16_KI270728v1_random:870699-870721 ACAGTTCTGCATCATCACCTGGG + Intergenic
1142764717 17:2058684-2058706 GAGGCTCTCCAGCGCCACCTTGG - Exonic
1151328779 17:73394624-73394646 ACAGCTCTCCTGGGCCACCCTGG - Intronic
1152780772 17:82226614-82226636 ACAGGGCTCCAGGGGCACCTGGG - Intergenic
1162345229 19:10114767-10114789 AGGGTTCTCCAGCAACACCTAGG - Exonic
1163442268 19:17328177-17328199 ACAGCTCTCCAGCTCTGCCTGGG + Exonic
1165057917 19:33190415-33190437 CCAGGTCTCCAGGGCCCCCTTGG - Intronic
1165363533 19:35350903-35350925 GCAGTTCTCAGGGGCCACCTGGG - Intergenic
1165365677 19:35363362-35363384 GCAGTTCTCAGGGGCCACCTGGG - Intergenic
1165931486 19:39362069-39362091 CCAGTTCTCCAGGGAGACCTTGG + Intronic
925124776 2:1446125-1446147 ACAGTTCTCGATCTGCACCTGGG - Intronic
925257322 2:2501016-2501038 ACTGCTCTCCAGCCTCACCTGGG + Intergenic
931089485 2:58870029-58870051 ACTGTTCTGCAGCGCTACCTTGG - Intergenic
939039674 2:137172861-137172883 ACAATTCTCCAACACCACCTGGG - Intronic
946312558 2:218890854-218890876 ACAGTTCCCCAGTGGCCCCTAGG - Intronic
948351351 2:237343734-237343756 ACAGGCCTCCAGGGCCACCCTGG + Intronic
948579957 2:238980108-238980130 ACACTTCTCCATCGAGACCTGGG - Intergenic
1170072221 20:12381328-12381350 ACAGTTCTTCTTCTCCACCTAGG + Intergenic
1178927378 21:36787251-36787273 GCAGTCCTCCAGGGCCACCGTGG + Intronic
1180610151 22:17091005-17091027 ACTGTTCTCCAGCCCCAGCAAGG + Intronic
1182200321 22:28561603-28561625 ACAGTTCCCCATCGCCTCTTAGG + Intronic
1182838294 22:33362504-33362526 AAAGTTCTCCATGGACACCTAGG + Intronic
1184357054 22:43989184-43989206 AAAGTTCTCCAAAGCCACCCTGG - Exonic
956653800 3:71530093-71530115 CCAGTTCTCCAACACCAGCTGGG - Intronic
962052351 3:131830258-131830280 ACTTTTCTCCACCTCCACCTTGG + Intronic
962712627 3:138100646-138100668 CCAATTCTCCAATGCCACCTGGG - Intronic
963001797 3:140688328-140688350 ACAGGCCTCCAGACCCACCTTGG - Exonic
963585223 3:147178278-147178300 ACAACTCTCCAGCCACACCTAGG + Intergenic
968568153 4:1325889-1325911 ACAGTCCTCCTGCCCCAGCTTGG + Intronic
969478840 4:7436231-7436253 CCACGTCTCCAGCCCCACCTGGG - Intronic
971374748 4:26047958-26047980 CCAGTCCTTCAGAGCCACCTCGG - Intergenic
971661007 4:29415566-29415588 ACAATTCTCCAACGCCAACTGGG - Intergenic
992053668 5:72965600-72965622 ACAGCTCTCCAGTGCCACTCTGG - Intronic
997427821 5:133816283-133816305 CCAGCTCTCCAGGACCACCTGGG + Intergenic
999299986 5:150485443-150485465 ACAGCTCTCCAGGACCTCCTGGG - Intergenic
999554175 5:152722512-152722534 CCAGTTCACCAGCGCCAACCTGG + Intergenic
1001725917 5:173899956-173899978 ACAGTTCTCCAGAATCTCCTGGG - Intronic
1001746841 5:174098864-174098886 CTAGTTCTCCAGCGCTACATTGG - Intronic
1013292962 6:108734459-108734481 TCAGGTCTCCATAGCCACCTGGG - Intergenic
1015196486 6:130529526-130529548 ACAGTTTTTCAGCGTCTCCTGGG - Intergenic
1019701210 7:2475752-2475774 CCGGTTCTCCAGCGCCACTGTGG - Exonic
1027604033 7:80277175-80277197 ACAGTTCTCCAGCTGCAGTTTGG - Intergenic
1029637444 7:101794416-101794438 GCCATTCTCCAGGGCCACCTGGG - Intergenic
1035348712 7:158227516-158227538 ACACTTCTTCCTCGCCACCTGGG - Intronic
1035719089 8:1778012-1778034 GCAGTTGTCCAGCCTCACCTGGG + Intronic
1037897167 8:22665630-22665652 ACAGTTATCCAGAGGCACATGGG + Intronic
1040071591 8:43193017-43193039 ACAATTCTGCAGCGCCACCCCGG - Intronic
1056840818 9:89996846-89996868 CCAGTTATCCGGCGCCACCTGGG + Intergenic
1061443743 9:130625716-130625738 AGACTTCTCCAGCCCCACATGGG + Intronic
1186352724 X:8756760-8756782 ACATTTCCCCAACCCCACCTTGG + Intergenic