ID: 901059642

View in Genome Browser
Species Human (GRCh38)
Location 1:6466089-6466111
Sequence GGCTATGGAGCAGCGGCCGC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 135}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901059642_901059650 -3 Left 901059642 1:6466089-6466111 CCCGCGGCCGCTGCTCCATAGCC 0: 1
1: 0
2: 1
3: 11
4: 135
Right 901059650 1:6466109-6466131 GCCCTCCGACGGGCGCCCAGGGG 0: 1
1: 0
2: 0
3: 6
4: 61
901059642_901059649 -4 Left 901059642 1:6466089-6466111 CCCGCGGCCGCTGCTCCATAGCC 0: 1
1: 0
2: 1
3: 11
4: 135
Right 901059649 1:6466108-6466130 AGCCCTCCGACGGGCGCCCAGGG 0: 1
1: 0
2: 0
3: 6
4: 49
901059642_901059648 -5 Left 901059642 1:6466089-6466111 CCCGCGGCCGCTGCTCCATAGCC 0: 1
1: 0
2: 1
3: 11
4: 135
Right 901059648 1:6466107-6466129 TAGCCCTCCGACGGGCGCCCAGG 0: 1
1: 0
2: 0
3: 2
4: 35
901059642_901059659 29 Left 901059642 1:6466089-6466111 CCCGCGGCCGCTGCTCCATAGCC 0: 1
1: 0
2: 1
3: 11
4: 135
Right 901059659 1:6466141-6466163 TCCGTGCTCTCTGCCCGTCGTGG 0: 1
1: 0
2: 0
3: 3
4: 58
901059642_901059654 5 Left 901059642 1:6466089-6466111 CCCGCGGCCGCTGCTCCATAGCC 0: 1
1: 0
2: 1
3: 11
4: 135
Right 901059654 1:6466117-6466139 ACGGGCGCCCAGGGGCTTCCCGG 0: 1
1: 0
2: 1
3: 19
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901059642 Original CRISPR GGCTATGGAGCAGCGGCCGC GGG (reversed) Exonic
900736545 1:4302875-4302897 GGCCATGGAGGAGCAGCAGCAGG - Intergenic
901059642 1:6466089-6466111 GGCTATGGAGCAGCGGCCGCGGG - Exonic
902871713 1:19317655-19317677 GGCTGTGGAGGAGGGGCCCCCGG - Exonic
904716343 1:32470595-32470617 TGCTCTGGAGCAGCAGCAGCTGG + Exonic
906207665 1:43995797-43995819 GGCCATGGAGCAGGAGCTGCAGG + Exonic
908355841 1:63324078-63324100 GGCTATTGAGCTGCAGCTGCAGG - Exonic
911078843 1:93908951-93908973 GGCAAGGGAGAAGCGCCCGCGGG - Intronic
912202255 1:107471479-107471501 GGCTATGGAGCAGTAGATGCAGG + Intronic
917438634 1:175045747-175045769 GGCCATGGAGCCGCCGCTGCCGG - Intergenic
919879117 1:201890556-201890578 GGCTCTGGAGCTGCTGGCGCCGG - Exonic
921599169 1:217089098-217089120 GGATATGGAGCAGGGGTCGTTGG - Intronic
922416486 1:225427624-225427646 GGCTGTGGAGCGGCGGCGGCAGG - Intronic
922706455 1:227793216-227793238 TGCTCTGGAGCAGAGGCCCCTGG - Intergenic
924187871 1:241515285-241515307 GTCTCTGGAGCAGCAGCAGCAGG + Intronic
1065188707 10:23192355-23192377 GGCCAGAGCGCAGCGGCCGCGGG + Exonic
1067288226 10:44922809-44922831 GGCTATGGGGCAGGTGCTGCAGG + Intronic
1069080319 10:64081647-64081669 GGCAATGGAGCAGGGGGTGCCGG + Intergenic
1069906684 10:71736249-71736271 GGATCTGGGGCAGCGGCCCCTGG - Intronic
1072716336 10:97755267-97755289 GGTTCAGGAGCAGAGGCCGCAGG - Intronic
1073509407 10:104034043-104034065 GGCTATGGGGCAGCAGCAGAAGG - Exonic
1076674108 10:132138999-132139021 GGCTTTGGAGCAGCTGCCAAAGG + Intronic
1076725322 10:132410399-132410421 GGCTTTGGAGCAGCAGAGGCAGG + Intronic
1077077579 11:708463-708485 GGCTATGGGGCAGGTGCCTCTGG - Intronic
1077249602 11:1555165-1555187 GGGTATGGGGCAGGGGCAGCAGG + Exonic
1077281429 11:1747926-1747948 GGCTCAGGGGCAGGGGCCGCCGG + Exonic
1083448525 11:62727054-62727076 GGATCTGGCGCAGCGGCTGCAGG - Exonic
1084411568 11:69009065-69009087 CGCTGTGGAGTGGCGGCCGCAGG - Intronic
1089076815 11:115745163-115745185 GGCCAGGGAGCAGCAGCTGCAGG - Intergenic
1089460095 11:118647935-118647957 GGAGATGGAGCTGCGGCGGCAGG + Exonic
1089499910 11:118925792-118925814 GGCGGTGGTGCAGCGGCCCCGGG + Intronic
1091154746 11:133362290-133362312 GACTCTGGAGCACAGGCCGCGGG + Intronic
1093676886 12:21952075-21952097 GGCTAGGGAGCAGGGGAGGCGGG + Intergenic
1100830940 12:98516099-98516121 GGCTCTGGGGCCGCCGCCGCGGG + Exonic
1103527801 12:121579368-121579390 GGCTCTGCCGCCGCGGCCGCTGG - Intronic
1103907525 12:124335218-124335240 GGCTCTCAGGCAGCGGCCGCAGG + Exonic
1104947595 12:132423549-132423571 GGGCAGGGAGCAGCGGCCCCGGG + Intergenic
1105239202 13:18595474-18595496 GTCTATGGAGTGGCGGCTGCAGG + Intergenic
1105535194 13:21259360-21259382 GGTTAGGGAGCAGCGGCTGGGGG + Intergenic
1105947704 13:25203541-25203563 GGCGAAGAAGCAGCGGCCACAGG + Intergenic
1107605094 13:42048810-42048832 GCCGCTGGAGGAGCGGCCGCCGG + Exonic
1113879849 13:113618651-113618673 GACTCTGGGACAGCGGCCGCTGG + Intronic
1114630692 14:24157703-24157725 GGCTATTGAGGAGTGGCCCCGGG + Intronic
1122391912 14:101395251-101395273 GGTTATGGAGAAGCTGCAGCAGG - Intergenic
1124593848 15:31077605-31077627 GGCTGTGGGGCAGGGGCCTCGGG + Intronic
1125280139 15:38034534-38034556 GGCTAAGGAGCAACAGCCTCTGG - Intergenic
1125903573 15:43370749-43370771 GCCCAAGGAGCAGCGGCTGCGGG + Intronic
1125960631 15:43826915-43826937 TGCTCTGGCGCTGCGGCCGCTGG + Intergenic
1128082692 15:64865753-64865775 GGCTGTGGAGCAGCTGAGGCAGG + Exonic
1128224077 15:65989530-65989552 AGAGATGGAGCAGCAGCCGCCGG + Intronic
1130084568 15:80766426-80766448 GGCCATGGACCAGCAGCAGCTGG - Intergenic
1132460751 16:53399-53421 GGCGATGGAGCAGCAGTCGGAGG + Intronic
1132463023 16:64727-64749 GGCGTTGCAGCACCGGCCGCCGG + Exonic
1132551297 16:554865-554887 GGCCCTGGGGCTGCGGCCGCAGG - Intergenic
1136588357 16:31202182-31202204 GGCTCTGGAGCCGCGCCAGCTGG - Exonic
1137594498 16:49714848-49714870 GGCTGGAGAGCAGGGGCCGCGGG - Intronic
1137665301 16:50246103-50246125 GGGGAAGGAGGAGCGGCCGCAGG - Intergenic
1138507711 16:57486430-57486452 GGCGAGGGAGGCGCGGCCGCAGG + Exonic
1139509338 16:67417550-67417572 GGCCATGGAGCAGAGGAAGCAGG - Intergenic
1140196236 16:72857974-72857996 GGCTGAGGAGCAGCGGGCCCTGG - Intronic
1141392742 16:83678287-83678309 GGCTGTGGAGCTGGGGCCGTAGG - Exonic
1142105070 16:88298212-88298234 GGCTTTGGAGAAGGGGCCTCTGG + Intergenic
1142173554 16:88634860-88634882 GGAGATGGGGCGGCGGCCGCTGG + Intergenic
1142300982 16:89257603-89257625 GGCGAGGGAGCAGCAGCCACCGG - Intergenic
1142356738 16:89604938-89604960 GGGTGGGGAGCAGCGGCTGCGGG + Intergenic
1145125699 17:20298392-20298414 GGCTATGGAGCAGCAGCAGCTGG + Intronic
1149296273 17:55265027-55265049 CGCTGGGGAGCAGCGGCCGCCGG + Exonic
1151153067 17:72104573-72104595 GGCCAAGGAGCAGCGGCCATGGG - Intergenic
1152726505 17:81949268-81949290 GGGAATGGAGCCGTGGCCGCAGG + Intergenic
1153499229 18:5731186-5731208 GGCTTTGGAGCAGGGGGCTCCGG + Intergenic
1156449505 18:37258996-37259018 GGCCATGGAGCAGCTGGGGCGGG + Intronic
1162152203 19:8654732-8654754 GGCTTGGGAGCAGCGGCACCTGG - Intergenic
1162958903 19:14114668-14114690 GGAGAGGGAGCAGCGGCCCCAGG - Intronic
1166299120 19:41904241-41904263 GGCGCTGGAGCAGCAGCAGCAGG - Exonic
1166939840 19:46355926-46355948 GGGTAAGGAGCAGGGGCTGCAGG + Intronic
1167455560 19:49595518-49595540 GGTTATGGAGCAGCTGCCGGGGG + Exonic
1167456011 19:49596990-49597012 GGCTCTGGAGCCGCTGCCCCCGG + Exonic
1167638119 19:50666972-50666994 GGCTGTGGGGCAGCGGGAGCCGG + Exonic
1168524676 19:57079272-57079294 CTCCATGGAGCAGCTGCCGCAGG + Intergenic
927981947 2:27380053-27380075 GGTTAAGGATTAGCGGCCGCTGG - Intronic
928199164 2:29236280-29236302 GGAGATGGAGCAGAGGCCGACGG - Intronic
929536457 2:42787254-42787276 GGGCATGGAGCAGAGGCAGCAGG + Intronic
929958820 2:46480686-46480708 GGTGATGGAGCAGCTGCAGCGGG + Exonic
930071473 2:47369621-47369643 GGCTGGGGGGCAGCGGCCCCCGG + Intronic
936058644 2:109280225-109280247 GGCTGTGGAGAAGCAGCAGCAGG + Intronic
938251962 2:129822358-129822380 GGCTCTGCAGCAGCCGCCACCGG + Intergenic
939960557 2:148561637-148561659 GTGGATGGAGCAGCGTCCGCCGG - Intergenic
940300894 2:152175711-152175733 GTCTAGGGAGCCGCGGCCGCGGG - Exonic
947538549 2:230957590-230957612 GGCTCCGGAGCGGCGGCCACGGG - Intronic
947542773 2:230990320-230990342 GGACATGGAGCAGCGGCCTGGGG + Intergenic
948892921 2:240915954-240915976 GGCTGTGGCCCAGCGTCCGCTGG - Intergenic
1171266799 20:23777565-23777587 GGAGAGGGAGCAGCAGCCGCGGG + Intergenic
1171276346 20:23859209-23859231 GGAAATGGAGCAGCAGCCGCGGG + Intergenic
1172126597 20:32628206-32628228 GGCTAGGGAGCAGTGGCCGGGGG + Intergenic
1176147173 20:63570765-63570787 GGCTGTGGAGCTGCGGGGGCAGG - Exonic
1178400175 21:32278771-32278793 GGCTGCGGAGGAGAGGCCGCTGG - Exonic
1179488677 21:41726902-41726924 TGCTCTGGAGCAGAGGCCGATGG + Intergenic
1179520340 21:41939585-41939607 GGCACTGGAGCACCTGCCGCAGG + Intronic
1180163281 21:46007379-46007401 GGCCACGGAGCAGGGGCCGCAGG - Intergenic
1184709385 22:46239599-46239621 GGCTTAGGAGAAGCGGCCGATGG + Exonic
1185246217 22:49774727-49774749 GGCCCTGGAGCAGAGGCCGGTGG + Intronic
953407869 3:42668542-42668564 GGCTCTGGGGCAGAGGCCTCTGG + Intergenic
953462499 3:43093128-43093150 GGATATGGGGCAGTGGCTGCAGG + Intronic
954005617 3:47588207-47588229 GGCTAAGGAGCAGCTGAGGCTGG + Exonic
954747661 3:52796151-52796173 GGCTCTGGAGCATCTGCCCCTGG - Intronic
955839394 3:63096322-63096344 GGCTATGGGGCAGCCGCAGGAGG + Intergenic
959294905 3:104522677-104522699 GGCTCTGGAGTAGCAGCAGCTGG - Intergenic
960464654 3:117982494-117982516 GGCTATGGTGCTGCTGCTGCTGG - Intergenic
961434779 3:126909349-126909371 GGCTTTGGGGCAGGGGCTGCCGG + Intronic
963906771 3:150779432-150779454 GGCTCAGGAGCAGAGGGCGCTGG + Intergenic
965370488 3:167856052-167856074 GACTAGGGAGCAGAGGCTGCAGG - Intergenic
968910563 4:3475269-3475291 GGCCATGGCACAGAGGCCGCTGG + Intronic
969949663 4:10822272-10822294 GGCAATGAAGCAGCTGCCACTGG - Intergenic
975440724 4:74407133-74407155 GGCTACGGAGCAGTGGCTCCTGG - Intergenic
982137480 4:152285375-152285397 GGCTCAGGAGCAGTGGCAGCGGG + Intergenic
982321787 4:154084549-154084571 GGCCCTGGAGCAGCAGCCGCTGG - Intergenic
986170071 5:5307876-5307898 GGATATAGAGCAGAGGGCGCCGG - Intronic
986321017 5:6632961-6632983 GGCTATGGGGCGGCGGTCGCGGG - Exonic
994679368 5:102866092-102866114 GGCCATGAAGTAGCGGCTGCTGG + Exonic
996347943 5:122507775-122507797 GACTTTGGAGCAGTGGCAGCAGG - Intergenic
996862721 5:128083951-128083973 AGCTATGGAGCCGCGGCCCACGG + Exonic
1013641521 6:112087468-112087490 GGGAATGCAGAAGCGGCCGCGGG - Exonic
1015626002 6:135181497-135181519 GGCCATGGCGCGGCGGGCGCGGG - Exonic
1017492248 6:154954986-154955008 GGCTATGGAGTAGGGGTTGCAGG - Intronic
1018866242 6:167748744-167748766 AGCCATGGAGCAGAGGCCGTCGG + Intergenic
1018921932 6:168181469-168181491 GGCTGTGGGGCAGCAGCCCCTGG + Intergenic
1019338744 7:497607-497629 GGCTCTGGGGCAGGTGCCGCAGG + Intronic
1022378328 7:29835934-29835956 GGTCATGCAGCAGGGGCCGCAGG - Intronic
1024828230 7:53417815-53417837 GGTTATGGAGCAGTGGCAGACGG - Intergenic
1026442549 7:70456928-70456950 GACTTTGGGGCAGCGGCTGCCGG + Intronic
1029123103 7:98281472-98281494 GTCTAGAGAGCAGCGGCGGCGGG + Intronic
1029705489 7:102273685-102273707 GGCCATGGGGCAGAGGCCACAGG + Intronic
1036786666 8:11692624-11692646 GGCTGAGGCGCAGAGGCCGCGGG - Intronic
1037879452 8:22565846-22565868 GGCCCCGGAGCAGCGGCCCCCGG + Exonic
1039463159 8:37762737-37762759 GGCTGTGGCGCGGCGGCCGCGGG + Exonic
1040081665 8:43291920-43291942 GGCCATTGAGGAGAGGCCGCAGG - Intergenic
1048443785 8:134478490-134478512 GGCTGTGGAGCAGCCGGCCCAGG - Exonic
1049409916 8:142468337-142468359 GGCTGTGGGGCAGGGGCCGTTGG + Intronic
1049724338 8:144138516-144138538 GGGTAAGGGGCAGCAGCCGCTGG - Exonic
1057196847 9:93120208-93120230 GGCAATGTAGCATTGGCCGCAGG - Intergenic
1057198733 9:93129375-93129397 GGCTGTGGAGCAGATGCCCCAGG + Intronic
1060096267 9:120793359-120793381 GGACCGGGAGCAGCGGCCGCAGG - Exonic
1061414382 9:130438423-130438445 GGCTATGGAGCGGAGGCCGGGGG + Intergenic
1062122173 9:134839671-134839693 GGCCAGGGAGCAGAGGCCGGAGG + Intronic
1062235087 9:135504019-135504041 GGCCAAGGAGAAGCGGCAGCAGG + Exonic
1062408666 9:136410432-136410454 GGCCATGGAGCCGCCGCTGCCGG - Exonic
1188451062 X:30308667-30308689 GGCTCCGGAGGAGCGGCCGAGGG - Exonic
1189916710 X:45862927-45862949 GGCTCTGTAGCAGCTGCTGCTGG + Intergenic
1200144827 X:153921132-153921154 GGATCTGGAGCAGCAGCTGCAGG - Exonic