ID: 901059712

View in Genome Browser
Species Human (GRCh38)
Location 1:6466295-6466317
Sequence CGCTGCCGCCTAATGAGCTC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 41
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 39}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901059712_901059719 28 Left 901059712 1:6466295-6466317 CCTGAGCTCATTAGGCGGCAGCG 0: 1
1: 0
2: 0
3: 1
4: 39
Right 901059719 1:6466346-6466368 TGGGCTGCCTGCTGCGACCAGGG 0: 1
1: 0
2: 0
3: 13
4: 157
901059712_901059720 29 Left 901059712 1:6466295-6466317 CCTGAGCTCATTAGGCGGCAGCG 0: 1
1: 0
2: 0
3: 1
4: 39
Right 901059720 1:6466347-6466369 GGGCTGCCTGCTGCGACCAGGGG 0: 1
1: 0
2: 2
3: 15
4: 208
901059712_901059718 27 Left 901059712 1:6466295-6466317 CCTGAGCTCATTAGGCGGCAGCG 0: 1
1: 0
2: 0
3: 1
4: 39
Right 901059718 1:6466345-6466367 CTGGGCTGCCTGCTGCGACCAGG 0: 1
1: 1
2: 0
3: 31
4: 263
901059712_901059716 8 Left 901059712 1:6466295-6466317 CCTGAGCTCATTAGGCGGCAGCG 0: 1
1: 0
2: 0
3: 1
4: 39
Right 901059716 1:6466326-6466348 AAGTAGAACACGCGAAGCGCTGG 0: 1
1: 0
2: 0
3: 1
4: 17
901059712_901059717 9 Left 901059712 1:6466295-6466317 CCTGAGCTCATTAGGCGGCAGCG 0: 1
1: 0
2: 0
3: 1
4: 39
Right 901059717 1:6466327-6466349 AGTAGAACACGCGAAGCGCTGGG 0: 1
1: 0
2: 0
3: 0
4: 20

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901059712 Original CRISPR CGCTGCCGCCTAATGAGCTC AGG (reversed) Exonic
901059712 1:6466295-6466317 CGCTGCCGCCTAATGAGCTCAGG - Exonic
915554396 1:156653292-156653314 AGCTGCCTCCTATTGATCTCAGG + Intronic
918105693 1:181413468-181413490 CGCCGCCGCTTCATGACCTCGGG - Intronic
921207175 1:212858623-212858645 CGCTGCCGCCTCGGGAGTTCTGG + Exonic
1075483894 10:122804871-122804893 TGCTGCCGCCTGCTGAGTTCCGG + Intergenic
1076291487 10:129349222-129349244 CGCAGCAGCCTTCTGAGCTCAGG + Intergenic
1079373187 11:19869689-19869711 AGGTGCAGCCTAATGAGCTTGGG - Intronic
1101616720 12:106345074-106345096 CACTGAAGCCTCATGAGCTCAGG + Intronic
1103737162 12:123067955-123067977 GGCTGCAGCCCAATTAGCTCAGG + Intronic
1103955303 12:124573078-124573100 CGCTGCCACCTCAAGAGCCCTGG + Intergenic
1117161589 14:52995165-52995187 CGCAGCAGGCTAATGTGCTCTGG - Intergenic
1123068337 14:105629130-105629152 CTCTGCTGCCTCCTGAGCTCAGG + Intergenic
1123092356 14:105747454-105747476 CTCTGCTGCCTCCTGAGCTCAGG + Intergenic
1123097932 14:105775155-105775177 CTCTGCTGCCTCCTGAGCTCAGG + Intergenic
1131130727 15:89898660-89898682 CGCTTCCTCCTTAAGAGCTCTGG - Exonic
1151842662 17:76628868-76628890 CTCTGCCTCATAATGAGCTTGGG + Intronic
1152411179 17:80124013-80124035 AGCTGCAGCCTGCTGAGCTCGGG - Intergenic
1152489400 17:80619621-80619643 CGTTGCCACCAAATGAGCTGTGG - Intronic
1158949147 18:62475640-62475662 CACTGCAGACTAATGTGCTCTGG - Intergenic
1161489832 19:4555826-4555848 CGCTGACTCCTCTTGAGCTCAGG + Intronic
1166457189 19:42951611-42951633 CACTGCAGCCTAATTAGCTGCGG - Intronic
1168148331 19:54431539-54431561 GGCTGCCGCTTAGTGAGTTCTGG + Intronic
927881526 2:26692972-26692994 CGCTGCCGCTCGATCAGCTCGGG - Exonic
948642949 2:239386912-239386934 CGCTGCCACCTAATGAGGAAGGG - Intronic
1183350936 22:37334573-37334595 GGCGCCCGGCTAATGAGCTCTGG - Intergenic
955182195 3:56683007-56683029 CGCGCCGGCCTAAGGAGCTCTGG + Exonic
968096099 3:195931927-195931949 CACTGCTGGCTAAAGAGCTCTGG + Intergenic
968679272 4:1905487-1905509 CGCTGCCCCCACAGGAGCTCAGG - Intronic
982339748 4:154284766-154284788 CACTGCAGGCTAAAGAGCTCTGG + Intronic
983528466 4:168784859-168784881 CAATGCCGCCTTATGAGCTCTGG + Intronic
984847771 4:184122294-184122316 GGCTGCCACCTAATGTGCCCTGG - Intronic
1013476044 6:110508251-110508273 AGCTGCAGCCTAATCATCTCAGG + Intergenic
1018735381 6:166683944-166683966 TGCTGCTGCCTGGTGAGCTCTGG - Intronic
1021214708 7:17901434-17901456 CACTGCTGGCTAATGTGCTCGGG - Intronic
1048864802 8:138752053-138752075 CGATTCTGCCTCATGAGCTCAGG + Intronic
1059447307 9:114346375-114346397 CGCTGAAGCCCAATGAGCGCAGG - Intronic
1060427689 9:123520076-123520098 AACTGCAGCCTCATGAGCTCAGG - Intronic
1192073083 X:67961817-67961839 CACTGTGGGCTAATGAGCTCTGG + Intergenic
1193086480 X:77451312-77451334 CTCTGCTACTTAATGAGCTCAGG + Intronic
1193440970 X:81538825-81538847 TGCTGCAGGCTAATGTGCTCTGG + Intergenic
1195706281 X:107740202-107740224 CCCTGAAGCGTAATGAGCTCAGG - Intronic