ID: 901061175

View in Genome Browser
Species Human (GRCh38)
Location 1:6472608-6472630
Sequence CCCTCTAGAAGCTGACCCGG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 78}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901061175_901061186 19 Left 901061175 1:6472608-6472630 CCGCCGGGTCAGCTTCTAGAGGG 0: 1
1: 0
2: 1
3: 6
4: 78
Right 901061186 1:6472650-6472672 ACGAGGCCTGGAGCACCTTAGGG 0: 1
1: 0
2: 1
3: 6
4: 61
901061175_901061190 27 Left 901061175 1:6472608-6472630 CCGCCGGGTCAGCTTCTAGAGGG 0: 1
1: 0
2: 1
3: 6
4: 78
Right 901061190 1:6472658-6472680 TGGAGCACCTTAGGGTGGCCGGG 0: 1
1: 0
2: 1
3: 13
4: 128
901061175_901061187 22 Left 901061175 1:6472608-6472630 CCGCCGGGTCAGCTTCTAGAGGG 0: 1
1: 0
2: 1
3: 6
4: 78
Right 901061187 1:6472653-6472675 AGGCCTGGAGCACCTTAGGGTGG 0: 1
1: 0
2: 0
3: 22
4: 166
901061175_901061189 26 Left 901061175 1:6472608-6472630 CCGCCGGGTCAGCTTCTAGAGGG 0: 1
1: 0
2: 1
3: 6
4: 78
Right 901061189 1:6472657-6472679 CTGGAGCACCTTAGGGTGGCCGG 0: 1
1: 0
2: 1
3: 16
4: 162
901061175_901061183 2 Left 901061175 1:6472608-6472630 CCGCCGGGTCAGCTTCTAGAGGG 0: 1
1: 0
2: 1
3: 6
4: 78
Right 901061183 1:6472633-6472655 GGCAGGATGGGTCATTCACGAGG 0: 1
1: 0
2: 0
3: 4
4: 115
901061175_901061191 28 Left 901061175 1:6472608-6472630 CCGCCGGGTCAGCTTCTAGAGGG 0: 1
1: 0
2: 1
3: 6
4: 78
Right 901061191 1:6472659-6472681 GGAGCACCTTAGGGTGGCCGGGG 0: 1
1: 0
2: 0
3: 12
4: 131
901061175_901061184 7 Left 901061175 1:6472608-6472630 CCGCCGGGTCAGCTTCTAGAGGG 0: 1
1: 0
2: 1
3: 6
4: 78
Right 901061184 1:6472638-6472660 GATGGGTCATTCACGAGGCCTGG 0: 1
1: 0
2: 0
3: 30
4: 824
901061175_901061185 18 Left 901061175 1:6472608-6472630 CCGCCGGGTCAGCTTCTAGAGGG 0: 1
1: 0
2: 1
3: 6
4: 78
Right 901061185 1:6472649-6472671 CACGAGGCCTGGAGCACCTTAGG 0: 1
1: 0
2: 0
3: 13
4: 127
901061175_901061182 -10 Left 901061175 1:6472608-6472630 CCGCCGGGTCAGCTTCTAGAGGG 0: 1
1: 0
2: 1
3: 6
4: 78
Right 901061182 1:6472621-6472643 TTCTAGAGGGAGGGCAGGATGGG 0: 1
1: 0
2: 0
3: 32
4: 304

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901061175 Original CRISPR CCCTCTAGAAGCTGACCCGG CGG (reversed) Exonic
900167786 1:1250771-1250793 CCCTCTAGAAGACGACCAAGAGG + Intergenic
900616003 1:3565932-3565954 TCCTATAGCAGCTGACCCTGAGG - Intronic
901061175 1:6472608-6472630 CCCTCTAGAAGCTGACCCGGCGG - Exonic
903982712 1:27201431-27201453 CCGCCTCGAAGGTGACCCGGCGG + Intergenic
905851901 1:41280819-41280841 CCCTCTAAAAGCTGACTGGGTGG + Intergenic
912740033 1:112186127-112186149 AGCTCCAGGAGCTGACCCGGGGG + Intergenic
915322127 1:155061939-155061961 CCCTCTGCCCGCTGACCCGGTGG + Exonic
918386428 1:184012956-184012978 CCCTCAAGAAGCTGAGCCTAGGG + Intronic
919084676 1:192908203-192908225 TCCCCTAGAAGCAGACCCTGAGG + Intergenic
1066521834 10:36228806-36228828 AGCTCCAGAAGCTGACCCAGAGG + Intergenic
1067183905 10:44011111-44011133 CCCTCAGGGAGCTGACCTGGGGG - Intergenic
1069677060 10:70255782-70255804 TCCGCGAGAAGCTGACCCTGCGG - Exonic
1075476906 10:122743812-122743834 CCCTCTCCAAGCTGCCCTGGCGG + Intergenic
1075502228 10:122985675-122985697 CCCTCTTAAGGCTGAACCGGGGG - Intronic
1077910388 11:6567619-6567641 TCCTCCAGAAGCTGATCCTGTGG + Exonic
1084719164 11:70893029-70893051 TCCCCTAGAAGCTGACCTTGAGG - Intronic
1085029132 11:73258996-73259018 TCCTCCAGAAGCTGATCCTGAGG - Intergenic
1091800332 12:3320996-3321018 CCCTCAACAAGATGACCTGGTGG + Intergenic
1101529312 12:105559718-105559740 CTCCCTTGAAGCTGACCAGGTGG - Intergenic
1104353321 12:128063812-128063834 CCAGCTAGAGGCTGACCCCGCGG - Intergenic
1115637372 14:35303553-35303575 CCCTCTAGAATCTGACTTTGTGG + Intronic
1119640121 14:76308602-76308624 CCCCCTTGAAGCTGGCCTGGGGG - Intergenic
1120463056 14:84821451-84821473 CCCTCAAGGAGCTGACCATGAGG - Intergenic
1121049291 14:90809776-90809798 CCCTCTAGAAGCTGACCATTTGG + Intronic
1121637273 14:95462236-95462258 CTCTCTAGAAGCTGGCCATGGGG - Intronic
1122576697 14:102747420-102747442 CCCTCAAGAAGCTGACTCACAGG - Intergenic
1123020998 14:105397913-105397935 ACCTCTGGAATCTGACCCTGTGG + Exonic
1126451209 15:48811122-48811144 CCGACTAGAAGCTCGCCCGGTGG + Exonic
1128410927 15:67396244-67396266 CCCTCTGCAATCTGACCCAGTGG - Intronic
1128497091 15:68204845-68204867 CCCTCCAGAACCTGACCAGTTGG - Intronic
1133007862 16:2894698-2894720 CCCTCGAGAAGGTGCCCCTGGGG + Intronic
1133206794 16:4238919-4238941 CCCTCAAGAAGGTAACACGGTGG - Intronic
1136059693 16:27718071-27718093 TCCCCTAGAAGCAGACCCTGAGG - Intronic
1139286710 16:65821804-65821826 CCCTCAAGATGAAGACCCGGAGG + Intergenic
1142157120 16:88537653-88537675 CCCTGTAGCCGCTGACTCGGTGG + Intergenic
1142286343 16:89173062-89173084 CCCTCCAGCAGCTGCCCCTGAGG + Intronic
1144798647 17:17910467-17910489 CTCTCTAGAAGCTCCCCAGGTGG - Intronic
1144833319 17:18143707-18143729 CCCTCTAGGAGCTGAGCAAGCGG + Exonic
1150526851 17:65932592-65932614 CCCTCTAGAAGCTGAACAGACGG - Intronic
1151547782 17:74803720-74803742 CCCTCGAGAAGCTGAGCCCCGGG + Intronic
1151900298 17:77007982-77008004 CCCTGTAGAAACTGCCCCTGAGG + Intergenic
1159460645 18:68718745-68718767 CCCTAGAGAATCTGACCCAGTGG + Intronic
1160790518 19:920739-920761 CCCTCTCTGAGCGGACCCGGTGG + Exonic
1161470788 19:4455965-4455987 CCCTCTAGAAGGTGAGCCCTGGG + Intronic
1166389889 19:42402943-42402965 CCCTCAAGAACCTGACCCTGAGG - Exonic
931221991 2:60296514-60296536 CCCCCCAAAAGCTGACCTGGAGG + Intergenic
935402855 2:102678817-102678839 AGCTCTAGAAGATGACCTGGCGG + Intronic
937714879 2:125020982-125021004 TCCTCAAGAAGCAGACCCAGAGG - Intergenic
938317851 2:130342260-130342282 CCTTAAAGAAGCTGACCCAGAGG - Exonic
944534151 2:200693566-200693588 CCATCTAGAAGCTCACCCCTAGG - Intergenic
1169070908 20:2729807-2729829 CCCTCTAGAAGCAGAACCTGAGG + Intronic
1172017967 20:31890520-31890542 TCCACTAGAAACTGACCCTGAGG + Intronic
1172225405 20:33302182-33302204 CCCCATAGAAGCTGACCTAGGGG + Intronic
1174664796 20:52247833-52247855 CCCTCTAGACTCAGATCCGGGGG - Intergenic
1176215501 20:63945862-63945884 CCCTCAAGAAGCTGAAGCAGGGG - Exonic
1179983280 21:44907402-44907424 TCCTCTAGCAGCTGGCCCAGGGG + Intronic
1180199503 21:46215919-46215941 CCCTCCAGCAACTGACCCCGAGG + Intronic
1181341716 22:22186103-22186125 CCCTCTAGCTGCAGACCTGGTGG + Intergenic
1185375485 22:50481182-50481204 CCCTCCAGGGTCTGACCCGGTGG - Intergenic
949926852 3:9048425-9048447 CCCTCTTGAAGCTTACGTGGTGG + Intronic
954767689 3:52934814-52934836 CCCTCTAGCAGCGGAACAGGAGG + Exonic
961174833 3:124826273-124826295 CCCTCAAGAAGCTGGCGTGGAGG - Intronic
962108512 3:132417696-132417718 CACTCTGGAAGCTGAGCCGGCGG + Exonic
966893498 3:184425448-184425470 CCCTCTAGAATCAGAGCCTGAGG - Intronic
966922304 3:184620569-184620591 CCCTCTAGAAGCTCACCATCAGG + Intronic
968880451 4:3296057-3296079 GCCCCCAGAAGCTGACCAGGGGG - Intronic
968880463 4:3296094-3296116 GCCCCCAGAAGCTGACCAGGGGG - Intronic
981005772 4:139873610-139873632 CTCTCTTGAAGCTGACTCAGGGG + Intronic
985731653 5:1552972-1552994 CCCGCTGGACGCTGGCCCGGCGG + Intergenic
990165507 5:52989359-52989381 CACTCTAGAAGCTGTCCAGAGGG - Exonic
995180174 5:109223678-109223700 CGCTCTAGGGGCTGACCGGGCGG + Intergenic
1003030308 6:2595631-2595653 GCCTCTAGAAGCTGAACGGAAGG - Intergenic
1007477470 6:42128546-42128568 CCTTCCTGATGCTGACCCGGCGG - Intronic
1017687510 6:156928142-156928164 CCCTGTAGAAGCTGACCTGGTGG + Intronic
1018775693 6:167013253-167013275 CCCAGTAGAAGCTGAGCAGGTGG + Intronic
1018924385 6:168196069-168196091 CCCTCTAGATGCTGAGCCCTAGG + Intergenic
1032578573 7:133081895-133081917 CCGCCTCGAAGGTGACCCGGCGG + Exonic
1033610902 7:142962245-142962267 CACTCTAGGAGCTGATTCGGAGG + Exonic
1034542534 7:151767937-151767959 TCCTCTAGAAGCAGAGCCTGAGG + Intronic
1036016132 8:4787107-4787129 CCCTCTAAAAGTTGAGCCAGCGG - Intronic
1049687872 8:143946198-143946220 CCCTCTCGGAGCTGCCCCAGGGG - Intronic
1056988904 9:91391289-91391311 ACCTCTGGGAGCTGACCCTGGGG - Intergenic
1060867730 9:127013315-127013337 CCTTCAAGAAGCTGAACAGGTGG + Intronic
1189323820 X:40101284-40101306 CCCTTCGGGAGCTGACCCGGGGG + Intronic
1196736541 X:118985605-118985627 CCCTCTAGAAGCTGGCCGTCTGG + Intronic
1199595877 X:149505338-149505360 ACCTCTAGAACCCGCCCCGGAGG - Intronic