ID: 901061394

View in Genome Browser
Species Human (GRCh38)
Location 1:6473510-6473532
Sequence GGCCCTGGAAACCCGCCCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 178}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901061394_901061404 2 Left 901061394 1:6473510-6473532 CCCCAGGGCGGGTTTCCAGGGCC 0: 1
1: 0
2: 2
3: 18
4: 178
Right 901061404 1:6473535-6473557 AGGCCAGCCTGGGATGGAGGAGG 0: 1
1: 0
2: 7
3: 87
4: 740
901061394_901061398 -9 Left 901061394 1:6473510-6473532 CCCCAGGGCGGGTTTCCAGGGCC 0: 1
1: 0
2: 2
3: 18
4: 178
Right 901061398 1:6473524-6473546 TCCAGGGCCTCAGGCCAGCCTGG 0: 1
1: 0
2: 2
3: 46
4: 510
901061394_901061401 -4 Left 901061394 1:6473510-6473532 CCCCAGGGCGGGTTTCCAGGGCC 0: 1
1: 0
2: 2
3: 18
4: 178
Right 901061401 1:6473529-6473551 GGCCTCAGGCCAGCCTGGGATGG 0: 1
1: 0
2: 5
3: 58
4: 491
901061394_901061405 3 Left 901061394 1:6473510-6473532 CCCCAGGGCGGGTTTCCAGGGCC 0: 1
1: 0
2: 2
3: 18
4: 178
Right 901061405 1:6473536-6473558 GGCCAGCCTGGGATGGAGGAGGG 0: 1
1: 0
2: 4
3: 85
4: 705
901061394_901061408 23 Left 901061394 1:6473510-6473532 CCCCAGGGCGGGTTTCCAGGGCC 0: 1
1: 0
2: 2
3: 18
4: 178
Right 901061408 1:6473556-6473578 GGGTCTCTGCATCTCTACCCTGG 0: 1
1: 0
2: 0
3: 23
4: 199
901061394_901061400 -8 Left 901061394 1:6473510-6473532 CCCCAGGGCGGGTTTCCAGGGCC 0: 1
1: 0
2: 2
3: 18
4: 178
Right 901061400 1:6473525-6473547 CCAGGGCCTCAGGCCAGCCTGGG 0: 1
1: 0
2: 3
3: 101
4: 728
901061394_901061410 25 Left 901061394 1:6473510-6473532 CCCCAGGGCGGGTTTCCAGGGCC 0: 1
1: 0
2: 2
3: 18
4: 178
Right 901061410 1:6473558-6473580 GTCTCTGCATCTCTACCCTGGGG 0: 1
1: 0
2: 1
3: 18
4: 233
901061394_901061403 -1 Left 901061394 1:6473510-6473532 CCCCAGGGCGGGTTTCCAGGGCC 0: 1
1: 0
2: 2
3: 18
4: 178
Right 901061403 1:6473532-6473554 CTCAGGCCAGCCTGGGATGGAGG 0: 1
1: 0
2: 2
3: 90
4: 528
901061394_901061409 24 Left 901061394 1:6473510-6473532 CCCCAGGGCGGGTTTCCAGGGCC 0: 1
1: 0
2: 2
3: 18
4: 178
Right 901061409 1:6473557-6473579 GGTCTCTGCATCTCTACCCTGGG 0: 1
1: 0
2: 0
3: 23
4: 180

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901061394 Original CRISPR GGCCCTGGAAACCCGCCCTG GGG (reversed) Intronic
900106048 1:981551-981573 GGCCCTGTAAACCTTTCCTGTGG - Intronic
900109357 1:999091-999113 GGCCCTGCGGCCCCGCCCTGGGG + Exonic
900240550 1:1615486-1615508 GGCCCTGGGCTCCCGCCCTTCGG + Exonic
900514912 1:3077049-3077071 AGGCCTGGAGACCTGCCCTGTGG - Intronic
901061394 1:6473510-6473532 GGCCCTGGAAACCCGCCCTGGGG - Intronic
901649363 1:10734828-10734850 GGCCCTTTACACCTGCCCTGGGG + Intronic
901851965 1:12021656-12021678 GGGCCTGGAACCCAGCCCTGAGG + Exonic
902919080 1:19655978-19656000 GGGCCTGGAAAGGGGCCCTGAGG - Intronic
903263470 1:22143231-22143253 GGCCCGGGACACCCCCCCGGGGG + Intronic
903957248 1:27033909-27033931 TGCCCTGAAAACCCACCCAGTGG - Intergenic
904415831 1:30360545-30360567 GGCCCTGGACCCAGGCCCTGGGG + Intergenic
904678996 1:32215831-32215853 GTCCCTGGAAAACCAGCCTGGGG + Exonic
907354955 1:53864623-53864645 GGGTCTGGAAACCTGCCATGTGG + Intronic
907491312 1:54810587-54810609 GAGCCTGGAACCCGGCCCTGGGG - Intronic
913090581 1:115474179-115474201 CACCCTGGAAACCAGGCCTGAGG + Intergenic
919813289 1:201422349-201422371 AGCCCTGGAAACACTCACTGGGG - Intronic
920054754 1:203183849-203183871 GGTCCTGGAAACCCCACCAGAGG - Intronic
1063487604 10:6434567-6434589 GCCCCTGGAAAGCTGCACTGAGG + Intronic
1067180381 10:43980956-43980978 AGGCCTGGAACCCAGCCCTGAGG - Intergenic
1071754020 10:88515526-88515548 GGCCATTGAAACCAGCCTTGAGG - Intronic
1074382618 10:112992678-112992700 GCCCCTGGAAACCCCTCCTGAGG + Intronic
1075120177 10:119659083-119659105 GGCCCTTGGAGCCCTCCCTGGGG + Intronic
1075995497 10:126873387-126873409 AGCACTGGGCACCCGCCCTGCGG - Intergenic
1076096179 10:127736618-127736640 GGGCCTGGACAGCGGCCCTGGGG - Intergenic
1076723064 10:132401144-132401166 GGCCCTGGAGACCAGGCCTGAGG - Intronic
1076804933 10:132850565-132850587 AGCCCTGGAGACCCTCCCTGCGG - Intronic
1076829120 10:132985472-132985494 GCCCCTGGCACCCCGCCCCGAGG - Intergenic
1077095645 11:797962-797984 GGCCCCGGACACCCACCCTCGGG + Exonic
1077158847 11:1103529-1103551 TGGCCTGGCCACCCGCCCTGGGG - Intergenic
1080420513 11:32106023-32106045 GGGTCTGGAAAGCCCCCCTGAGG - Intergenic
1081615138 11:44586307-44586329 GGCCCTGGAAAGCCTACCTGAGG - Intronic
1081637551 11:44730447-44730469 GGCCTTGGAAACCAGCACTCTGG + Intronic
1089099738 11:115952508-115952530 GGTCCTGGAAGCCAGGCCTGTGG + Intergenic
1089311474 11:117560945-117560967 AGCCCTGGAGCCCCGCCCTCAGG - Intronic
1092056402 12:5511758-5511780 GCCCCTGGAAAGCAGCCCAGGGG + Intronic
1097895387 12:64820068-64820090 GGCCCTGGAAGCCTGCTATGAGG - Intronic
1101785056 12:107875277-107875299 GGTCCTGGAAATCAGCCTTGGGG - Intergenic
1101937056 12:109066792-109066814 GGCCTTGGGAAACAGCCCTGTGG + Intronic
1102587503 12:113933433-113933455 GGCCCTGGAGATCAGCTCTGTGG + Intronic
1103188940 12:118983960-118983982 TGCCCTAGAAACCACCCCTGAGG + Intronic
1103705968 12:122872599-122872621 GCCCATGGAGAGCCGCCCTGTGG - Intronic
1106106330 13:26736662-26736684 GACCCAGGAAACCCACCCAGTGG + Intergenic
1107065916 13:36214384-36214406 GGCCCTCAAAGCCCGGCCTGGGG - Intronic
1107635895 13:42392351-42392373 AGCCCTGGAGCCCCGTCCTGGGG - Intergenic
1107987047 13:45784718-45784740 GGCTCTGGGAAGCTGCCCTGGGG - Intronic
1108282758 13:48876091-48876113 GCCCCTGGCACCCCACCCTGGGG + Intergenic
1110470658 13:75856132-75856154 GGCCCTGGCACTCCACCCTGGGG - Intronic
1113767890 13:112892300-112892322 GCCCGTGGGAACCCGCCCTGAGG - Intergenic
1113874369 13:113585084-113585106 GGCCCGGGACCCCCGCCCCGCGG - Intronic
1114635260 14:24183547-24183569 GGCACTGAAAACCCTGCCTGGGG - Intronic
1118700359 14:68426908-68426930 GGCCCTGGAAAGTCAGCCTGTGG - Intronic
1119148897 14:72340381-72340403 GCCCCTTGAAACCTGCCCTAAGG - Intronic
1121404644 14:93712391-93712413 GGCCTTGTAAACCAGCCCCGAGG - Intergenic
1121726141 14:96151484-96151506 GGGCCCGGAAAGCCGCGCTGTGG + Intergenic
1122470893 14:101965102-101965124 GGCCCTGGGGACCCGGCCGGCGG - Intronic
1122782325 14:104148996-104149018 GGCCCCGGCAAGCAGCCCTGTGG + Intronic
1122809881 14:104282584-104282606 GGCCTTGGCATCCTGCCCTGTGG - Intergenic
1123006595 14:105326723-105326745 GGCCGTGAAGACCCACCCTGAGG + Intronic
1123716703 15:23039183-23039205 GTCCCGGGTAACACGCCCTGTGG + Intronic
1124231968 15:27953548-27953570 GGCACTGCAAACCTTCCCTGAGG + Intronic
1128803734 15:70514899-70514921 GGAGCTGGAAAACTGCCCTGGGG - Intergenic
1129455285 15:75673455-75673477 GGCCCTGGTCACCCTCCCTGGGG + Intergenic
1130970224 15:88726492-88726514 GTCCCTAGAAACCTTCCCTGAGG - Intergenic
1132597804 16:761251-761273 GGTGCTGGAAGCCCGGCCTGGGG - Intronic
1132665081 16:1077897-1077919 GGCCCTGGAACCCCCCACTGTGG - Intergenic
1132878440 16:2150403-2150425 AGCCCTGGAAACCCTCGCTCAGG - Intronic
1133231822 16:4370620-4370642 AGCCCTGGAAAGGGGCCCTGTGG + Intronic
1135402019 16:22172439-22172461 GGCCCTGGGAAACCGTCCTTTGG - Intronic
1136590531 16:31215417-31215439 GGCCCATCAGACCCGCCCTGGGG - Intronic
1138556941 16:57776273-57776295 GGCCCTGGGAGCACACCCTGTGG + Intronic
1140048173 16:71456459-71456481 GGACGTGGAAACCGCCCCTGTGG - Intronic
1140224633 16:73067557-73067579 GTCCCTGGGATCCTGCCCTGTGG + Intergenic
1141111826 16:81276289-81276311 GGCCCTGTGAACTCACCCTGTGG - Intronic
1141976091 16:87517566-87517588 GGCCCAGCACACCAGCCCTGTGG + Intergenic
1142157008 16:88537249-88537271 GGGCCTGGCAACCCTTCCTGGGG + Intergenic
1142968934 17:3598250-3598272 GGCCCTCGTAACCCTGCCTGGGG + Intergenic
1143332382 17:6147252-6147274 GGGCCTGGAAACACCCCCTGCGG + Intergenic
1143902439 17:10184277-10184299 GCCCCAGGAAAGCCTCCCTGAGG + Intronic
1145265589 17:21378234-21378256 CGCCCTGGACCGCCGCCCTGTGG + Intronic
1146163285 17:30571169-30571191 GGTTCTGGAAACCTGCCTTGGGG - Intergenic
1150675925 17:67245693-67245715 TGCCCTGGGAAACCGCCCCGGGG + Intronic
1151124129 17:71826746-71826768 GGCCCTGTAATCCCCACCTGTGG - Intergenic
1151340747 17:73469331-73469353 GGCCCTTGGAACCCGCAGTGTGG + Intronic
1151351261 17:73533478-73533500 GTCCCTGGACACAGGCCCTGAGG + Intronic
1152303323 17:79507836-79507858 GGCCAGGAAAACCCACCCTGGGG + Intronic
1152920960 17:83066431-83066453 GGCCCAGGAAGCCCGCACTGTGG - Intergenic
1152922681 17:83073723-83073745 GTCCGTGGAGACTCGCCCTGTGG + Intergenic
1152931760 17:83113598-83113620 GCCCCTGGACACCGGCCCTCCGG - Intergenic
1154122119 18:11660573-11660595 GGCTACGGAAACCAGCCCTGTGG + Intergenic
1156456959 18:37300106-37300128 GACCCTGGACACCTGGCCTGGGG + Intronic
1159045836 18:63367564-63367586 AGGCCTGGAAACCCGCCCTGCGG - Intergenic
1159534329 18:69695992-69696014 GGCCCTGGAAAAACTCCCTTAGG + Intronic
1160021507 18:75185258-75185280 CCCCCTGGAAACCAGCCCTCAGG - Intergenic
1160917847 19:1506260-1506282 GGCCCAGGAGACCCGCTATGAGG - Exonic
1161057512 19:2198142-2198164 GGGGCTGGGAACCCTCCCTGGGG - Intronic
1163153468 19:15428051-15428073 GGCCCTGGAGCCCCTCCCGGGGG - Intronic
1163371033 19:16901391-16901413 GTCCCAGGAAGCCTGCCCTGGGG + Intronic
1163483539 19:17572968-17572990 GGCCCTGGATACCAGCCCCAGGG - Intronic
1163548644 19:17953016-17953038 GGCCCTGGCAACCCACGCTCAGG - Intronic
1163727235 19:18929613-18929635 GGACCTGGAGACCCGCAATGCGG - Exonic
1164587216 19:29483570-29483592 GGCCCTGGAACACTGCACTGAGG - Intergenic
1165071361 19:33256617-33256639 AGCCCTGGAAAGAAGCCCTGAGG + Intergenic
1165156646 19:33792880-33792902 GGCCCTGGGAGCCAGCACTGGGG - Intergenic
1166653095 19:44590136-44590158 GGACCTGGAAGCCCCCTCTGCGG + Intergenic
1168116067 19:54221948-54221970 GGGCCTGGAACCCCCCACTGTGG + Exonic
1168119049 19:54241696-54241718 GGGCCTGGAACCCCCCACTGTGG + Exonic
1168185495 19:54697372-54697394 GGGCCTGGAACCCCCCACTGTGG - Intronic
1168717370 19:58537442-58537464 GGCCCTGGCAACACACCTTGGGG - Intronic
925126824 2:1463142-1463164 TGCCCTGGAGACCCACCCTGGGG - Intronic
928127857 2:28628604-28628626 GGCCCTGGACATCCTCTCTGAGG + Exonic
928398764 2:30963211-30963233 GGCCCTGGAACCCTGCACTCTGG - Intronic
930393246 2:50787826-50787848 GGCACTGGTGACCTGCCCTGAGG + Intronic
931516183 2:63051824-63051846 GGCGCTGGAAACTGGGCCTGGGG - Intronic
933691372 2:85181754-85181776 CGCCCTGGGAACCCTCCCTGAGG - Intronic
934552610 2:95271571-95271593 TGCCCTGGAAACACCTCCTGGGG - Intergenic
934873242 2:97887369-97887391 GGGCCTGAAAAACAGCCCTGTGG - Intronic
935165087 2:100563140-100563162 GGCAGTGGACGCCCGCCCTGGGG + Intronic
948851633 2:240711199-240711221 GGTCCTGGAAGCCCACACTGCGG + Intergenic
1169046128 20:2535900-2535922 GGCCCTGGGAGCCTGCACTGTGG - Intergenic
1169200305 20:3706096-3706118 CGCCCTGGAAACCCCAGCTGAGG + Intronic
1172124935 20:32619908-32619930 TCCCCTGCAAACCAGCCCTGTGG - Intergenic
1172536890 20:35680855-35680877 GGAACTGCAAATCCGCCCTGAGG + Exonic
1172589309 20:36106089-36106111 AGCCCTGGAGACCCGTCCAGAGG + Intronic
1172991674 20:39041232-39041254 GGCCCTGGAAAACAGAGCTGAGG - Intergenic
1173795586 20:45857332-45857354 GGCCCTGCACACCCGCTCCGCGG + Exonic
1175795479 20:61767790-61767812 GGGCCTGGAAACTGGCCCTGTGG - Intronic
1176310078 21:5144830-5144852 GGCCCCCCAACCCCGCCCTGGGG - Intronic
1178670814 21:34590184-34590206 GGCCCTGGAGGGCCGCTCTGAGG - Intronic
1179846978 21:44117202-44117224 GGCCCCCCAACCCCGCCCTGGGG + Intronic
1179980760 21:44894583-44894605 GGCCCTGGGAAGACACCCTGGGG - Intronic
1179988812 21:44935243-44935265 GTCCATGGAGACCCTCCCTGGGG + Intronic
1180050913 21:45330641-45330663 GGCCCTGACCACCCACCCTGAGG - Intergenic
1180965998 22:19788268-19788290 GGCCCAGGAAACCCACACTCGGG + Exonic
1181036831 22:20173811-20173833 AGCCCTGGAAACCCTCACTGTGG + Intergenic
1181555671 22:23670488-23670510 GGCCCTGGAAACCGGGCAAGTGG - Intergenic
1183361149 22:37384183-37384205 GGCCTTGGCAAACCACCCTGTGG + Intronic
1184389741 22:44196487-44196509 GGCCCTGGGAACCTGCTGTGTGG + Intronic
1184478569 22:44734769-44734791 TGCCCTGGAAAAAGGCCCTGTGG - Intronic
1184646568 22:45898573-45898595 GTGCCTGGAAAACCTCCCTGTGG + Intergenic
1184894228 22:47397779-47397801 GGGCCTGGAAGGCAGCCCTGGGG - Intergenic
1185420501 22:50731916-50731938 GGCCCTAGTGGCCCGCCCTGGGG + Intergenic
949517399 3:4820093-4820115 GACCCTGGAAACCTCACCTGTGG - Intronic
950269807 3:11605015-11605037 GGCGATGGAAAGCAGCCCTGCGG - Intronic
950428336 3:12936646-12936668 GCGCCTGGTAACCCGCCATGCGG - Exonic
958951669 3:100423862-100423884 GGCCCTGGGCACCTGCCTTGAGG - Intronic
962746337 3:138399881-138399903 GGCCCTGGAAACCTGCTCTGTGG + Intronic
966010077 3:175064447-175064469 CGCCCTGGATGCCAGCCCTGAGG - Intronic
968076498 3:195818448-195818470 GGCGCTGGAAACCCGGGCTCCGG - Intergenic
968583005 4:1403591-1403613 CGCCCTGGCAACCCGACCCGCGG + Exonic
968603262 4:1520331-1520353 GCCCCTGGAAACCATCCCCGTGG - Intergenic
969106756 4:4812169-4812191 GTCCCCGGAATCCCACCCTGGGG + Intergenic
970340109 4:15097303-15097325 AGCCCTGGAAACTCACCCTCAGG - Intergenic
973531700 4:51842827-51842849 GACCCTGAAACCCCGCCCAGTGG - Intergenic
976595651 4:86892500-86892522 GGCCCGGGAGACGCGCCCCGCGG + Intronic
985547019 5:514944-514966 GGCTCTGGGAGCCAGCCCTGGGG - Intronic
985913197 5:2898634-2898656 TGCCCGGGAAACCCAGCCTGTGG + Intergenic
990961657 5:61399852-61399874 GACCCTGGAAAACTGCCCTCTGG + Intronic
991669212 5:69030904-69030926 TGCCCTGGAAAACCTTCCTGTGG - Intergenic
997243193 5:132323575-132323597 GGACCGGGAAACCCGGCCTGAGG + Intronic
998955228 5:147431771-147431793 GGCCATGGGAACTTGCCCTGTGG - Intronic
1001110848 5:168895001-168895023 AGCTCTGGAAACCCTCCCAGAGG + Intronic
1001774338 5:174317343-174317365 GGCCCTGGGACCCCTCCCTGGGG - Intergenic
1006510943 6:34520765-34520787 GACCCTGGAACCGGGCCCTGAGG + Intronic
1007967152 6:46014016-46014038 GGACCTGGAAATCCAGCCTGGGG + Intronic
1008678044 6:53842678-53842700 GGCAAGGGAAACCTGCCCTGGGG + Intronic
1011281217 6:85679328-85679350 GGGCCTTGATGCCCGCCCTGAGG - Intergenic
1015437064 6:133201894-133201916 TGCCCAGGAAGCCGGCCCTGTGG + Intergenic
1019135588 6:169905704-169905726 TGCCCTGGAAACCCGGGGTGTGG + Intergenic
1019522514 7:1467223-1467245 GACCCTGGGAACCAGCCGTGTGG - Intergenic
1022500921 7:30882006-30882028 GGCCCTGGGAAACAGCCCAGTGG + Intronic
1025176159 7:56803500-56803522 GGCCCTGGGAAGGCGCCGTGAGG + Intergenic
1025695634 7:63772922-63772944 GGCCCTGGGAAGTCGCCGTGAGG - Intergenic
1025994367 7:66518743-66518765 GTCCCTGGAATCCCTCTCTGGGG - Intergenic
1026033631 7:66815920-66815942 GTCCCTGGAATCCCTCTCTGGGG + Intergenic
1028223090 7:88219715-88219737 GACCCTAGAAGCCCACCCTGCGG - Intronic
1034323283 7:150204958-150204980 GGGTCTGGAAACCTGCACTGGGG - Intergenic
1034769913 7:153764230-153764252 GGGTCTGGAAACCTGCACTGGGG + Intergenic
1035418629 7:158709246-158709268 GGCCCTGGAGACCCCTCCTCCGG - Intergenic
1036779052 8:11633359-11633381 GGCCCTGGAAAGCAGCCCCAGGG + Intergenic
1040395627 8:46997513-46997535 GGCTCAGGAAACCAGCCCAGTGG - Intergenic
1041389678 8:57337595-57337617 GGCCCTGGAGACTCACTCTGGGG - Intergenic
1045269435 8:100649537-100649559 AGCGCTGGGAACCCGACCTGCGG + Exonic
1046420786 8:113980495-113980517 GCACCTGGAACCCCACCCTGAGG + Intergenic
1048525322 8:135197140-135197162 GGACCTGGAGACCAGCTCTGGGG + Intergenic
1048941626 8:139405223-139405245 CGCCCTGGAAGCCAGACCTGGGG - Intergenic
1049595390 8:143481061-143481083 TGCCCAGGACACCCTCCCTGAGG + Intronic
1049964108 9:763059-763081 GGCCCTGGAAGCCCGTCTTTTGG - Intergenic
1052880688 9:33599523-33599545 GGCCCTGGCCACCCACCCTGGGG - Intergenic
1057937651 9:99254139-99254161 GGCCCAGCCAACCAGCCCTGTGG - Intergenic
1060196351 9:121626049-121626071 GGCCCTGGGAGCCCCCTCTGAGG + Intronic
1061235728 9:129341601-129341623 GGACCAGGAAACCTCCCCTGGGG - Intergenic
1061546908 9:131309724-131309746 GGCCCTGGAGCCCAGCCTTGGGG + Intergenic
1061945362 9:133905676-133905698 GGGCCTGAAGACCAGCCCTGGGG + Intronic
1185870262 X:3658822-3658844 GGCCCAGGAAACCTTCCCTGAGG + Intronic
1186378724 X:9034346-9034368 GGGCCTAGAACCTCGCCCTGGGG + Intronic
1187530312 X:20090666-20090688 GACCCAGCAATCCCGCCCTGAGG + Intronic
1192809443 X:74536250-74536272 GGCCCTGGCATCCGGGCCTGGGG + Intergenic
1195923305 X:110003000-110003022 GGCCCTAGACGCCCGCCCTCCGG - Intronic
1200054072 X:153449574-153449596 GGCCCTGCACACCCGGCCTTGGG - Intronic