ID: 901063055

View in Genome Browser
Species Human (GRCh38)
Location 1:6482259-6482281
Sequence CTGTCCTTGCGAATGTGACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 94}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901063055_901063056 14 Left 901063055 1:6482259-6482281 CCTGGTCACATTCGCAAGGACAG 0: 1
1: 0
2: 0
3: 9
4: 94
Right 901063056 1:6482296-6482318 CTGATTCAGCGCCTGACCTCCGG 0: 1
1: 0
2: 0
3: 15
4: 165

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901063055 Original CRISPR CTGTCCTTGCGAATGTGACC AGG (reversed) Intronic
901063055 1:6482259-6482281 CTGTCCTTGCGAATGTGACCAGG - Intronic
906989714 1:50724880-50724902 CTGTCTTTCCAAATGTGACTAGG + Intronic
915008539 1:152663407-152663429 CTGTGCTTTTGCATGTGACCAGG + Exonic
919805161 1:201377100-201377122 CTAGCCTTGAGAATATGACCAGG + Intronic
920209694 1:204319311-204319333 CTGTCCTTACAAATGAGAGCTGG + Intronic
1063074031 10:2696360-2696382 CTGTCCTGGCCATTCTGACCAGG + Intergenic
1063412142 10:5844720-5844742 CTTTCCTTGCCAATCTGTCCAGG + Intergenic
1067527469 10:47047203-47047225 CTGTCCTTGAGAAAGAGCCCAGG - Intergenic
1076148032 10:128140715-128140737 CTGTCCTTGCAAATCTCTCCTGG + Intergenic
1080492612 11:32782371-32782393 CTGTTCTAGGGAATTTGACCAGG + Intronic
1082791088 11:57347285-57347307 CTGACCTTGCAACTGGGACCTGG + Intronic
1083793629 11:65001941-65001963 CTGCCCTTGCCAATCTCACCTGG - Intergenic
1083794589 11:65007856-65007878 CTGGCCTTGCCAATCTCACCTGG + Intergenic
1084111355 11:67015929-67015951 CTGGCCTTCCCAGTGTGACCTGG - Intronic
1087902760 11:103661193-103661215 CTGTCCTTCCTAATGTGAGTAGG + Intergenic
1089174808 11:116540739-116540761 CTTTCCTTGATAATGTGCCCAGG - Intergenic
1089891558 11:121886601-121886623 CTGCCCTTGCATATGAGACCCGG + Intergenic
1094739868 12:33275970-33275992 CTGTCTTTGAGTGTGTGACCTGG + Intergenic
1098693592 12:73522425-73522447 CTGTCCTTGAGTATTTGAACAGG + Intergenic
1099545403 12:83973484-83973506 CTGTCCTTTGCAATGTGACGTGG + Intergenic
1105316163 13:19266084-19266106 CTGACCCTGCAAATCTGACCTGG - Intergenic
1108281237 13:48864387-48864409 CTGTCCTTGCTCATGTTCCCTGG + Intergenic
1108470405 13:50761593-50761615 CTTTCCTTGTGAAAGCGACCTGG - Intronic
1110192715 13:72749852-72749874 CTGGCCTGGCTAATGTGATCTGG - Intronic
1111275336 13:85939073-85939095 CAGTCCTTCCTAATGTGCCCTGG - Intergenic
1111919210 13:94392964-94392986 CTGCTCTTGGGAATGTGACATGG - Intronic
1114055575 14:18964935-18964957 CTGCCCTGGGGAATGTGACCAGG - Intergenic
1114106971 14:19436828-19436850 CTGCCCTGGGGAATGTGACCAGG + Intergenic
1114162647 14:20186475-20186497 ATGTTCTTTCAAATGTGACCTGG + Intergenic
1116942846 14:50808293-50808315 CTGGCCTTGCGCATGTTAACTGG - Intronic
1119452406 14:74723162-74723184 CTGTCATTGCAAAAGTGTCCTGG + Intronic
1121684304 14:95821671-95821693 CTGTCCTTGTGATAGTGACAGGG + Intergenic
1122865961 14:104604084-104604106 CGGTCCTGGCGAGTGTGGCCCGG + Intronic
1124513727 15:30348922-30348944 CTGTCCTTGCGACAGTGTCTTGG + Intergenic
1124729194 15:32181843-32181865 CTGTCCTTGCGACAGTGTCTTGG - Intergenic
1140003160 16:71046623-71046645 CTGTCCTTTCGTTTGTGACAGGG + Intronic
1141046154 16:80717701-80717723 CTGTCCTTGGGAAGTTGGCCAGG + Intronic
1145720639 17:27068715-27068737 CGGCCTTTGCCAATGTGACCTGG + Intergenic
1153760550 18:8327263-8327285 TGGTCTTTGCCAATGTGACCTGG - Intronic
1156385907 18:36604971-36604993 CAATCATTGCCAATGTGACCTGG - Intronic
1159279706 18:66270074-66270096 CTGTCCTTGCTAGTGTTACTGGG + Intergenic
1165015816 19:32879284-32879306 CTGTCCTCGTGAGTGTGTCCTGG + Exonic
926497063 2:13603951-13603973 GAGTCCTTGCAAAGGTGACCTGG - Intergenic
928308870 2:30193588-30193610 CTGTCCCTGCTGATGCGACCTGG - Intergenic
929218146 2:39437214-39437236 CTCTCCTTGTGGGTGTGACCAGG - Exonic
929816963 2:45240181-45240203 AGGCCCCTGCGAATGTGACCAGG + Intergenic
933560801 2:83883623-83883645 CTGTCCTCACCAATGTGAGCAGG - Intergenic
935385975 2:102500627-102500649 CTGGGCTTGGGAATGTGAGCTGG - Intronic
937204646 2:120227596-120227618 CTGTCCTTGAGAAAGTCACAGGG - Intergenic
938473742 2:131589509-131589531 CTGCCCTGGGGAATGTGACCAGG - Intergenic
943441391 2:187932039-187932061 CAGTCCTTCCTAATGTGTCCTGG + Intergenic
947670402 2:231932150-231932172 CTGTGCCTGGGTATGTGACCTGG + Intergenic
947746653 2:232511465-232511487 CTGGGCTTGCTACTGTGACCTGG - Intergenic
948290082 2:236818170-236818192 CTGTCCTGGCAGATGGGACCGGG + Intergenic
948814032 2:240500581-240500603 ATGTCCTTGCGTGTTTGACCTGG - Intronic
1171018293 20:21561569-21561591 GTGTCCTTGTGAAGGAGACCAGG + Intergenic
1173590667 20:44222363-44222385 CTGTCCTTGAGGATGTCCCCTGG + Intergenic
1179288759 21:40000188-40000210 CAGTACCTGCGAATGTGACCTGG - Intergenic
1179452978 21:41478193-41478215 CTGTCCTGGGGAATGTGGCAGGG - Intronic
1180474052 22:15687487-15687509 CTGCCCTGGGGAATGTGACCAGG - Intergenic
1181974231 22:26717394-26717416 TTGTACTTGCGAGTGAGACCCGG + Intergenic
1185215114 22:49594334-49594356 CTGTCCTGGCGATTGCTACCTGG - Intronic
950093029 3:10310534-10310556 CTGTCCTAGTGAATGTGAGGTGG - Intronic
976486475 4:85611258-85611280 CTTTGCTTCCTAATGTGACCTGG + Intronic
979596928 4:122544470-122544492 CTGGCCTTGAGAAGGGGACCAGG - Intergenic
985781272 5:1873141-1873163 CTGTCTTTGCGACAGTGACGTGG - Intergenic
986803631 5:11286858-11286880 CTGTTCTTGTGCATGTGTCCTGG - Intronic
993468430 5:88276590-88276612 TTGTCTTTGCGAATATGACAGGG - Intergenic
994520964 5:100834683-100834705 CTGTCCTTGCGATAGTGAGTGGG + Intronic
995324065 5:110872134-110872156 CTGTCCTTGTGGGTGTGACAAGG - Intergenic
995794564 5:115927934-115927956 CTGGCCCTGTGAATGTGGCCTGG + Intergenic
1002456586 5:179348651-179348673 CTGTGCTGACAAATGTGACCTGG - Intergenic
1002712964 5:181205929-181205951 CCGCCCTTGCCAATGTCACCGGG + Intergenic
1002811911 6:639269-639291 CTGCCCTTGCCACTGTGAGCAGG + Intronic
1002811919 6:639306-639328 CTGCCCTTGCCACTGTGAGCAGG + Intronic
1002811927 6:639343-639365 CTGCCCTTGCCACTGTGAGCAGG + Intronic
1002811935 6:639380-639402 CTGCCCTTGCCACTGTGAGCAGG + Intronic
1002811943 6:639417-639439 CTGCCCTTGCCACTGTGAGCAGG + Intronic
1002811951 6:639454-639476 CTGCCCTTGCCACTGTGAGCAGG + Intronic
1002811959 6:639491-639513 CTGCCCTTGCCACTGTGAGCAGG + Intronic
1009445099 6:63733193-63733215 CAGTCTTTGAGAATGTGATCTGG - Intronic
1015328265 6:131949963-131949985 CAGGCCTTGCGAAGCTGACCTGG - Exonic
1017522846 6:155216920-155216942 ACGTCCTTGTGAATGTGACTTGG + Intronic
1018885059 6:167928328-167928350 CTGTCCTTGCCAGGGTGACAGGG + Intronic
1019096204 6:169581847-169581869 CTGGCCTAGCGCGTGTGACCAGG - Intronic
1019596142 7:1859280-1859302 CTGTCGTTGCCACTGTGGCCTGG - Intronic
1019860273 7:3652343-3652365 AAGTCCTGGCAAATGTGACCTGG + Intronic
1023258584 7:38336018-38336040 GTGTCCTTGCGAATGTGAAAAGG - Intergenic
1026339095 7:69420192-69420214 CTTCCCTTGCCACTGTGACCTGG - Intergenic
1028329666 7:89573866-89573888 CTGTCCTTGTGAAAAAGACCTGG - Intergenic
1033462873 7:141563279-141563301 CTGTCCTTTCAAATGGGATCAGG + Intronic
1034580349 7:152036012-152036034 CTGTCCTTGCGCATTTGGACTGG + Intronic
1039105656 8:33986375-33986397 GTGTCCTTGAGTATGTGACCTGG + Intergenic
1040408797 8:47134420-47134442 CTGCCCTGGGGAATATGACCAGG + Intergenic
1040529964 8:48258812-48258834 GTGCCCTTGAGAATGTGAACTGG + Intergenic
1043429834 8:80184206-80184228 CTGTCCTTTGGGATGGGACCAGG - Intronic
1046409406 8:113819668-113819690 ATGTCTTTGCTATTGTGACCAGG + Intergenic
1056526933 9:87452043-87452065 CTGTCCTTGGGATTGTGAAATGG - Intergenic
1056729791 9:89155706-89155728 AAGTCCTTGTGAATGTGACCAGG - Intronic
1062456191 9:136640330-136640352 CAGTCCTTGTGAATTTCACCTGG + Intergenic
1194619166 X:96147403-96147425 TTGTCCTCTCTAATGTGACCAGG - Intergenic
1195802128 X:108724555-108724577 CTGTTCTTTGGAATGTGCCCCGG - Intronic
1196820445 X:119696412-119696434 CTGTTCTTGGGAAGGTGACCCGG - Intergenic
1198084625 X:133270482-133270504 CTCTCTTTGCGAATCTGCCCTGG + Intergenic