ID: 901063224

View in Genome Browser
Species Human (GRCh38)
Location 1:6483310-6483332
Sequence GTGGGGGCACCTGGTGCTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 318
Summary {0: 1, 1: 0, 2: 5, 3: 32, 4: 280}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901063224_901063233 17 Left 901063224 1:6483310-6483332 CCTTGAGCACCAGGTGCCCCCAC 0: 1
1: 0
2: 5
3: 32
4: 280
Right 901063233 1:6483350-6483372 GTGATCTTCAACTGTGCTTGTGG 0: 1
1: 0
2: 0
3: 7
4: 129
901063224_901063227 -7 Left 901063224 1:6483310-6483332 CCTTGAGCACCAGGTGCCCCCAC 0: 1
1: 0
2: 5
3: 32
4: 280
Right 901063227 1:6483326-6483348 CCCCCACTTCTACACCCTTCAGG 0: 1
1: 0
2: 1
3: 16
4: 156
901063224_901063234 18 Left 901063224 1:6483310-6483332 CCTTGAGCACCAGGTGCCCCCAC 0: 1
1: 0
2: 5
3: 32
4: 280
Right 901063234 1:6483351-6483373 TGATCTTCAACTGTGCTTGTGGG 0: 1
1: 0
2: 0
3: 12
4: 120
901063224_901063235 19 Left 901063224 1:6483310-6483332 CCTTGAGCACCAGGTGCCCCCAC 0: 1
1: 0
2: 5
3: 32
4: 280
Right 901063235 1:6483352-6483374 GATCTTCAACTGTGCTTGTGGGG 0: 1
1: 0
2: 1
3: 11
4: 206

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901063224 Original CRISPR GTGGGGGCACCTGGTGCTCA AGG (reversed) Intronic