ID: 901063224

View in Genome Browser
Species Human (GRCh38)
Location 1:6483310-6483332
Sequence GTGGGGGCACCTGGTGCTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 318
Summary {0: 1, 1: 0, 2: 5, 3: 32, 4: 280}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901063224_901063227 -7 Left 901063224 1:6483310-6483332 CCTTGAGCACCAGGTGCCCCCAC 0: 1
1: 0
2: 5
3: 32
4: 280
Right 901063227 1:6483326-6483348 CCCCCACTTCTACACCCTTCAGG 0: 1
1: 0
2: 1
3: 16
4: 156
901063224_901063233 17 Left 901063224 1:6483310-6483332 CCTTGAGCACCAGGTGCCCCCAC 0: 1
1: 0
2: 5
3: 32
4: 280
Right 901063233 1:6483350-6483372 GTGATCTTCAACTGTGCTTGTGG 0: 1
1: 0
2: 0
3: 7
4: 129
901063224_901063235 19 Left 901063224 1:6483310-6483332 CCTTGAGCACCAGGTGCCCCCAC 0: 1
1: 0
2: 5
3: 32
4: 280
Right 901063235 1:6483352-6483374 GATCTTCAACTGTGCTTGTGGGG 0: 1
1: 0
2: 1
3: 11
4: 206
901063224_901063234 18 Left 901063224 1:6483310-6483332 CCTTGAGCACCAGGTGCCCCCAC 0: 1
1: 0
2: 5
3: 32
4: 280
Right 901063234 1:6483351-6483373 TGATCTTCAACTGTGCTTGTGGG 0: 1
1: 0
2: 0
3: 12
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901063224 Original CRISPR GTGGGGGCACCTGGTGCTCA AGG (reversed) Intronic
900266415 1:1759529-1759551 GTGGGGGCGCCTGGTGAGGAGGG - Intronic
900831224 1:4967138-4967160 GTGGGGGCAGCTGGAGCAGAGGG - Intergenic
900970348 1:5989195-5989217 GTGGTGGCTCCTGGGGCTCTGGG - Intronic
901061694 1:6474674-6474696 GTGGGGGCAGCTGGGGCTGTGGG - Intronic
901063224 1:6483310-6483332 GTGGGGGCACCTGGTGCTCAAGG - Intronic
901225679 1:7611742-7611764 GTGGGGGCAGCTGCTGCTTCAGG + Intronic
904281942 1:29426775-29426797 ATGGGAGCATCTGGAGCTCAGGG + Intergenic
906322964 1:44828022-44828044 GTGGGGGCACCAGGTGGGCTTGG + Exonic
907242420 1:53088105-53088127 GTGGGGGCAGGTGGGGCCCAGGG + Exonic
907464332 1:54624859-54624881 GCAGGAGGACCTGGTGCTCAGGG + Intronic
907911062 1:58826397-58826419 GTGAGGTCATCTGATGCTCAAGG - Intergenic
911108010 1:94152550-94152572 CTGGTGGGCCCTGGTGCTCAGGG - Intronic
912305493 1:108561924-108561946 GTGGTGACACCTGGTGGTCAGGG + Intronic
912805995 1:112757606-112757628 GTGGTGGAACCTGGTTCTCTCGG - Intergenic
913467741 1:119159532-119159554 GTGGGAGCACAGGGTGCTGAGGG - Intergenic
914808535 1:151009120-151009142 GTGGAGGGAACCGGTGCTCACGG + Intronic
915620553 1:157080703-157080725 GTTGGGGCAGCTGGGGCTCGAGG + Intergenic
918546276 1:185688142-185688164 CTGTGGGCACTTGGTGGTCAGGG - Intergenic
920377416 1:205516662-205516684 GGAGGGGCACCTGGTGGTCCTGG + Intronic
922771407 1:228185656-228185678 GTGCGTTCACGTGGTGCTCACGG + Intergenic
923108097 1:230869170-230869192 TTCGGGGCATCTGGTGCTCAAGG + Intronic
1063105700 10:2989633-2989655 ATTGGGGCACCTGGAGCTCAAGG + Intergenic
1064555395 10:16542305-16542327 CTAGGGGCACCTGGTTCTCTAGG + Intergenic
1065918388 10:30370698-30370720 CTGGGGGCCTCTGGTGCTAAGGG - Intronic
1067141220 10:43658802-43658824 GTTGAGTCACCTGGTGCACATGG - Intergenic
1067704776 10:48598624-48598646 GTGGGGGCAGCAGGTGCGCAGGG - Intronic
1067931412 10:50565841-50565863 GTGGGAGCACCTGATCGTCACGG - Intronic
1069566704 10:69468193-69468215 GTGTGTGCACCTGGTGATTAAGG - Intronic
1069630708 10:69895486-69895508 TTGGGGGTACCTGTTTCTCAGGG - Intronic
1069748290 10:70729959-70729981 GTGGGGACAGCTGGTGATCTTGG + Intronic
1070557449 10:77539554-77539576 GTGGGGACACCTGGGGATGAGGG - Intronic
1070856312 10:79610501-79610523 GTGGGGGGGCCTGGGGCTCATGG + Intergenic
1071508684 10:86247972-86247994 GTGGGGGGATCTGGTTGTCAGGG - Intronic
1073424353 10:103447241-103447263 GTGGGAGGCCCTGGTTCTCACGG + Exonic
1073514707 10:104066014-104066036 GTGGGGGGACCTGGTGGGGAAGG - Intronic
1075444180 10:122502451-122502473 GTGGGGAGACCTGGAGCCCATGG + Intronic
1076335462 10:129703705-129703727 GTGGTGGCACCTGGGGCTGCAGG - Intronic
1076355306 10:129848308-129848330 TTGGGGGCAGCAGGTGCTCTGGG - Intronic
1076501703 10:130942285-130942307 GTGTGGGCAGCTGTGGCTCAAGG - Intergenic
1076555676 10:131319853-131319875 GTGGGGACACCTGGTGACCGAGG + Intergenic
1076833178 10:133007128-133007150 GTGGGGGCACAGGGGGCTCAGGG + Intergenic
1076846805 10:133073205-133073227 ATGGGGGCTCCTGCTGCCCAGGG - Intronic
1077142544 11:1030875-1030897 GTGGGGGCCCTTGGTGGTCTCGG + Intronic
1077160255 11:1109454-1109476 GTGGGGGTGCCTGGTGTTCTGGG + Intergenic
1077378412 11:2216212-2216234 CTGGGCGCACCGGATGCTCAGGG + Intergenic
1077440615 11:2567045-2567067 TGGGGGGCACCTGGGGCCCACGG + Intronic
1078103861 11:8346285-8346307 GCAGGGTCACCTGGGGCTCACGG - Intergenic
1079085184 11:17440136-17440158 GTGGGGGCACTGGGTCCCCAAGG - Intronic
1083749895 11:64755135-64755157 GTGGGGGCACAGGATGCACAAGG + Intronic
1083856608 11:65396211-65396233 ATGGGGGCCCTTGGTGCACATGG + Intronic
1084603884 11:70161806-70161828 TTGGGGGCACCTGGAGCCCAGGG + Intronic
1084982434 11:72837569-72837591 GTGGGGGCACCTGCTGCTGCAGG + Intronic
1085410251 11:76286551-76286573 GTGGGGGGACTTGGTGCTGAAGG - Intergenic
1086001117 11:81987015-81987037 GGGGCTGCACATGGTGCTCATGG - Intergenic
1090207695 11:124895071-124895093 GTGGGGGTACCTGGTAGCCACGG + Exonic
1091325429 11:134683441-134683463 CTGTGGGCTCCTGGAGCTCAGGG + Intergenic
1091369981 11:135049657-135049679 GTGGGGGGACCCGGTGCTCAGGG + Intergenic
1091401234 12:182041-182063 GTGAGGGGACCTGGTGCACAGGG - Intergenic
1091675574 12:2486681-2486703 CTGGGAGAACCTGTTGCTCAGGG - Intronic
1093191110 12:16076502-16076524 TTTGGGCTACCTGGTGCTCAAGG - Intergenic
1095039262 12:37423633-37423655 GTGGGGGCTTCTGGTCCTCCAGG + Intergenic
1096618656 12:52848754-52848776 GTGGGAGTACCTGGGGGTCAGGG - Exonic
1097233805 12:57526861-57526883 GTGGGGGTAGCAGGGGCTCAGGG - Exonic
1097249558 12:57625046-57625068 GAGGGGGATCCTTGTGCTCAAGG + Intronic
1097253654 12:57655787-57655809 GGGGCTGCACCTGGTGTTCACGG + Intergenic
1101044620 12:100791783-100791805 ACTGGGGCACCTGGGGCTCAGGG - Intronic
1101552286 12:105773977-105773999 GTGGTGGCACTTGGAGCTCCGGG - Intergenic
1102787902 12:115619268-115619290 GTGGCGGCACCTGGAGGTCTTGG - Intergenic
1103027265 12:117583664-117583686 GAGGTGGGACCTGGTGCACAGGG - Intronic
1103996009 12:124830623-124830645 GTGGGGGCAGCAGGACCTCAGGG + Intronic
1105665571 13:22552302-22552324 GGAGGGGCACCTGGTGCTCCAGG + Intergenic
1105865019 13:24451528-24451550 GTGCTGGCTCCTGGAGCTCAGGG + Intronic
1105883854 13:24625943-24625965 GTGGGGGCACCTGCCTCTGAAGG - Intergenic
1106132749 13:26953193-26953215 CTGGGACCACCTGGTGCCCAGGG - Intergenic
1106340841 13:28825048-28825070 GTGGGGGAATCTCATGCTCATGG + Intronic
1107861072 13:44661334-44661356 GTGGAAGCACCAGGTCCTCATGG - Intergenic
1113913875 13:113859828-113859850 GTGGGGGCGCCTGGTGGGGAAGG - Intronic
1114418726 14:22561855-22561877 GTGTGGGCAGGAGGTGCTCAGGG + Intergenic
1114716303 14:24829057-24829079 GTGGGGGCACAGGGGGCACAGGG - Intronic
1118110305 14:62711206-62711228 TGGGGGGCAGCTGGTGGTCAAGG - Intronic
1119674201 14:76541730-76541752 GTGGTGGCACCTGGAGCACCTGG - Intergenic
1123097621 14:105773900-105773922 GTGGCAGCTCCTGGAGCTCAGGG - Intergenic
1123114154 14:105886371-105886393 GTGGAGGCACCTGGTGGCCCAGG - Intergenic
1123120614 14:105914697-105914719 GTGGAGGCACCTGGTGGCCCAGG - Intergenic
1123403325 15:20006243-20006265 GTGGAGGCACCTGGTGGCCCAGG - Intergenic
1123512663 15:21012897-21012919 GTGGAGGCACCTGGTGGCCCAGG - Intergenic
1124251011 15:28106618-28106640 GTGGGGGCACCGGGCGCACGCGG + Intergenic
1124417723 15:29487490-29487512 GTTTTGGCATCTGGTGCTCAAGG + Intronic
1124625639 15:31306216-31306238 CTGCGGGCTCCTGGTGCACAAGG - Intergenic
1124959928 15:34386522-34386544 CTGGGGGCCCCTGGTGCCAAGGG - Intronic
1124976555 15:34532743-34532765 CTGGGGGCCCCTGGTGCCAAGGG - Intronic
1125541254 15:40471203-40471225 GCGGGGGAACATGGTGCTCAAGG - Exonic
1129037355 15:72658717-72658739 CTGGGGGCCCCTGGTGCCAAGGG + Intronic
1129212532 15:74078508-74078530 CTGGGGGCCCCTGGTGCCAAGGG - Intronic
1129397867 15:75262571-75262593 CTGGGGGCCCCTGGTGCCAAGGG + Intronic
1129401478 15:75286852-75286874 CTGGGGGCCCCTGGTGCCAAGGG + Intronic
1129729668 15:77922827-77922849 CTGGGGGCCCCTGGTGCCAAGGG - Intergenic
1130651374 15:85763952-85763974 GTGGGTGCCCCTGGTGACCATGG - Intronic
1131512548 15:93057188-93057210 GTGAAGCCACCTGGTGCCCATGG - Intronic
1132433520 15:101778994-101779016 CTGGGGGCCCCTGGTGCCAAGGG - Intergenic
1132728101 16:1347447-1347469 GTGGGGCCACCTCATGCTCAAGG - Intronic
1133118008 16:3589273-3589295 GCTGGGGCTGCTGGTGCTCAGGG + Exonic
1135231950 16:20716718-20716740 GTGTGGGCTCCTAGAGCTCAGGG + Intronic
1137701026 16:50497796-50497818 GCGGGGGGACCTGGTGGACATGG + Intergenic
1139356852 16:66371756-66371778 GGGGGTCCTCCTGGTGCTCAGGG + Intronic
1139547892 16:67658196-67658218 GTGTGGGGACCTGGGGGTCAGGG + Exonic
1139958676 16:70705412-70705434 GTGGGCCAACCTGGCGCTCAAGG + Intronic
1142224765 16:88872027-88872049 TTGGGGCCACCTGGAGCTCCAGG - Intergenic
1142713727 17:1736904-1736926 TTGGGGGCACCTTGAGCTGAGGG - Intronic
1143010186 17:3861929-3861951 GTGGGGAAACCGGGTGCCCATGG - Intronic
1143292015 17:5838487-5838509 GTGGGGGCACCTCATTCTCCAGG - Intronic
1143508627 17:7383442-7383464 GGGTGGGCTCCTTGTGCTCAGGG - Exonic
1143514153 17:7411117-7411139 CTGGGCGAACCTGGTGCTCCCGG + Intronic
1143523890 17:7461802-7461824 TTGGGGGCCCCTGGAGCTCAGGG - Exonic
1144810131 17:17993734-17993756 GTGGGATCACCTGGGGCACATGG + Intronic
1144875672 17:18395877-18395899 CTGGGACCACCTGGAGCTCAAGG + Intergenic
1145156554 17:20548544-20548566 CTGGGACCACCTGGAGCTCAAGG - Intergenic
1145761877 17:27429969-27429991 CTGGGGGCACCTGGGACTCAGGG + Intergenic
1146160346 17:30556182-30556204 CTGGGGCCACCGGGAGCTCAGGG + Intergenic
1147910529 17:43853398-43853420 GAGGGGGCACATGGTGGTGAGGG + Intronic
1148047493 17:44753139-44753161 TTGGGGGCACCTGGGGCACCAGG - Intergenic
1148641925 17:49194091-49194113 GTGGGGAGAACGGGTGCTCAGGG - Intergenic
1150286390 17:63956600-63956622 GTGGGGGAACCTGGGCCTCCTGG - Intronic
1151340545 17:73468050-73468072 CTGGGGGCACCTGGAGCTCTGGG + Intronic
1151343360 17:73486090-73486112 GAGGGGGCACCTGATGGTCTGGG + Intronic
1151674811 17:75591928-75591950 GTGGGGGCTACTGCTGCCCAGGG + Intergenic
1152037297 17:77881203-77881225 GTGGGGGAGGCTGGAGCTCAGGG - Intergenic
1152258845 17:79255724-79255746 CCGGGGGCACCTGCAGCTCAGGG + Intronic
1152890404 17:82878376-82878398 GTGACGGGACCTGGTGCACATGG - Intronic
1152928670 17:83099348-83099370 GAGGCGGCACCGGGTGCTCCTGG + Intergenic
1153870768 18:9317793-9317815 GTGAGGGCACCTGGGGATAATGG + Intergenic
1155226990 18:23737520-23737542 GTGGGGGCATTTGGAACTCAAGG + Intronic
1155500176 18:26479743-26479765 GAGGGGGCACGTGGTGCCAAGGG + Intronic
1157499410 18:48179421-48179443 GTGGGGGCTTCAGGTGCTCAAGG + Intronic
1159954536 18:74510054-74510076 GTGGAGGCACCTCGGGCTCTGGG + Intronic
1160317576 18:77861826-77861848 ATGAGGGCTCCTGGTGCTGATGG - Intergenic
1160512495 18:79460482-79460504 GTGGGGGCTCCAGGCGCACACGG - Intronic
1160584341 18:79904266-79904288 GCGGGGAGACCTGGGGCTCAGGG + Intronic
1160940627 19:1618985-1619007 GTGGGGGCACCTGGTGACATGGG - Intronic
1161943501 19:7420009-7420031 GTGGGTGCACCTGGGGTGCAGGG - Intronic
1163007415 19:14405722-14405744 GGAGTGGCACCGGGTGCTCAGGG - Intronic
1163428079 19:17250090-17250112 GTGAGGGAAGCTGGTGCACATGG - Exonic
1163860053 19:19738099-19738121 GTGGGGGCACCTGGAGCCTGAGG + Intergenic
1165150448 19:33757050-33757072 GTGGGGGCTCCTGCTGCTACAGG + Intronic
1165346967 19:35254555-35254577 GTGGGGGCACTTGGACCCCAAGG - Intronic
1165831093 19:38730820-38730842 ATGGGCGCACCTGCTGCTCAGGG - Exonic
1167953406 19:53045673-53045695 GTGGGGGCATATGGTGTTCAGGG - Intronic
1168263630 19:55209382-55209404 CTGGGGGAACCTGGTGCTGCTGG - Exonic
1168613534 19:57819866-57819888 GTGAGGGCGCCTGCTGCTCCCGG + Exonic
1168624243 19:57904315-57904337 GTGTGGGCTCCTAGAGCTCAGGG + Intronic
925117616 2:1393504-1393526 GTGGGGGACCCTTGTGCCCAAGG + Intronic
925476600 2:4223716-4223738 ACTGGGGCACCTGCTGCTCACGG - Intergenic
925976380 2:9145096-9145118 GTGGGGGCTGCAGGTGGTCAGGG - Intergenic
926095424 2:10078494-10078516 GCTGGGGCAGCTGGTGCCCAGGG - Intronic
926251889 2:11159464-11159486 GTGGGAGGCCCTCGTGCTCAGGG + Intronic
926304946 2:11631141-11631163 GTGCATGCAGCTGGTGCTCATGG - Intronic
926706301 2:15840142-15840164 CTGCAGGCACCTGGTGCTCAGGG + Intergenic
926730775 2:16034083-16034105 GAGGGGAGAGCTGGTGCTCAGGG + Intergenic
928212894 2:29336944-29336966 GTGGGGGAACCTGGTGTCTAGGG + Intronic
929881491 2:45840847-45840869 ATGGGGACATGTGGTGCTCATGG + Intronic
930618097 2:53614920-53614942 GTGGTTGCTCCTGCTGCTCAAGG + Intronic
931190094 2:59991961-59991983 ATGGAGACATCTGGTGCTCAAGG + Intergenic
932288797 2:70557810-70557832 GATGGGGCACCTGGTGCAGAGGG + Intergenic
932415296 2:71569980-71570002 CTGGAGGCACCTGGTGCTCAGGG + Intronic
933707187 2:85300513-85300535 CTGGCGCCACCTGGTGGTCATGG + Intronic
933764465 2:85697378-85697400 GAGCTGGCACCTGGTGCCCATGG - Intronic
934247089 2:90316896-90316918 GTGAGGGCAGCTGCTGCACAAGG + Intergenic
934551840 2:95267560-95267582 GTGGGAGCACCTGGGGCTCTTGG + Intergenic
935538918 2:104326429-104326451 GTGGGAGCACCTGATGGTCAGGG + Intergenic
935720003 2:105971690-105971712 GTGTGGCCACCTAGGGCTCAGGG - Intergenic
936036939 2:109120541-109120563 GAGTGGGCACCTTGTGCTCTAGG + Intergenic
936072515 2:109380769-109380791 TGGGGGGCACCTGGTGGGCAGGG - Intronic
936246793 2:110835542-110835564 ATGAGGCCTCCTGGTGCTCACGG - Intronic
936952289 2:117990096-117990118 GTGTGGGCACCTGTTATTCAAGG + Intronic
937096068 2:119235935-119235957 GTAGGAGGACCTGCTGCTCAGGG - Intronic
941827921 2:169920516-169920538 GTTAGGGCACCTGGACCTCAGGG + Intronic
942541332 2:177018244-177018266 GTGGGGGTACTTTGTTCTCATGG + Intergenic
943355337 2:186848906-186848928 GTGGGGGAACCTGGTGGGCGGGG + Intronic
945041475 2:205746627-205746649 GTGGGAGCCACTGGGGCTCAGGG + Intronic
946019659 2:216632708-216632730 GTGGGGGCCCAGGGTGCTAAGGG + Intergenic
946929113 2:224655319-224655341 GGGGCTGCACGTGGTGCTCATGG + Intergenic
947612384 2:231531971-231531993 GCAGGGGCACGTGGTCCTCAGGG + Intergenic
947765924 2:232637288-232637310 GGGAGAGCACCAGGTGCTCAGGG - Intronic
948563453 2:238868679-238868701 ATGGTGGCAGCTGGTGATCACGG - Intronic
948577971 2:238966276-238966298 GAGTGGGGACCTGGTTCTCACGG + Intergenic
948596650 2:239083716-239083738 GTGTGGGCACCTGGTCCTGCTGG - Intronic
948825399 2:240571354-240571376 TTGGGGGCACCTTCTACTCATGG + Intronic
948854983 2:240725867-240725889 GTGGGGGCAGCTGCTGTGCATGG + Intronic
1169204277 20:3731503-3731525 GTGGGGGCACATGGGGCAGAGGG + Intergenic
1169354559 20:4896312-4896334 GTGGGGGCTCCTGCTCCGCACGG - Intronic
1171019194 20:21569825-21569847 GTGGGGGCATCAGATGCTGATGG + Intergenic
1174444203 20:50579723-50579745 GTGGGGGCTCCAGGTCCTCGTGG - Exonic
1175578144 20:60078199-60078221 GTGGAGGAAACTGGTGCTCCAGG - Intergenic
1175797202 20:61779252-61779274 GAGGGGGAACGTGGTGCTCCTGG + Intronic
1176025222 20:62982228-62982250 GTTGGGGCAGCTGGTGCTGTCGG - Intergenic
1176090877 20:63318159-63318181 GTGGGGGCAGATGGTTCTCCAGG + Intronic
1176236626 20:64056533-64056555 GTGGGGGCTCCTGGGGCTGCAGG + Intronic
1178128141 21:29538424-29538446 ATGGGGGCAGTTGCTGCTCAAGG + Intronic
1178832750 21:36070202-36070224 CTCGGGGGACGTGGTGCTCACGG + Exonic
1179308227 21:40174163-40174185 GTGGGGGCTGCTGGTGCTAGGGG + Intronic
1179863579 21:44204234-44204256 GGGGAGGCAGCTGCTGCTCATGG - Intergenic
1179922248 21:44513621-44513643 TTGGGGGCTCCAGGTGCTCCTGG - Intronic
1179985961 21:44920483-44920505 CTGGGGGGTCCTGGTGCTCCGGG - Intronic
1180074460 21:45455665-45455687 GCAGGGGCCCCTGGGGCTCAGGG - Exonic
1180590729 22:16935076-16935098 GTGAGGGCAGCTGCTGCTCAGGG + Intergenic
1180983464 22:19890605-19890627 GTGGGTGCAGCTGGGGCTTAGGG - Intronic
1181174425 22:21027711-21027733 CTGTGGGTACCTGGTGATCAGGG + Exonic
1182071290 22:27465590-27465612 GGGAAGGCACCAGGTGCTCAGGG - Intergenic
1182452550 22:30429875-30429897 GTGGTGGCCCCTGCTGCTCTGGG + Intergenic
1182813112 22:33134681-33134703 GTGGGGCCTCCTGGTGCACCAGG + Intergenic
1183067849 22:35375842-35375864 GTGGGGGCAACTGGGGCCCCTGG + Intergenic
1183695181 22:39417716-39417738 GAGGAGGCAGCTGGTGCTGAGGG - Exonic
1184187520 22:42874692-42874714 ATGGGGGAACCTGGTGGTCCTGG + Intronic
1184645296 22:45891891-45891913 GTGGGGGCCACAGGGGCTCATGG - Intergenic
1184777548 22:46630975-46630997 GTGGGGGCACATGGCCCTCGAGG - Intronic
1184779402 22:46638968-46638990 GTGCGCTCACCTGGTGCTCAAGG + Intronic
1184806761 22:46799834-46799856 GCGGGGGCACGTGGTGCTGGTGG + Intronic
949765530 3:7521913-7521935 GTGGAGGCAGGTGGGGCTCAAGG - Intronic
950187522 3:10954184-10954206 GTGTGGGTAGCTGGTGCTCAGGG + Intergenic
950611326 3:14128518-14128540 GGGGGTGGACTTGGTGCTCAAGG - Intronic
950674907 3:14548837-14548859 GAGGGAGCACCTGGTTCTCATGG - Intergenic
950775413 3:15345723-15345745 GAGAGAGCAGCTGGTGCTCATGG + Intergenic
953366282 3:42348260-42348282 CTGGTGGCACCTGTGGCTCAAGG - Intergenic
954216642 3:49128495-49128517 GTGTGGGCATTTGGTGCCCAAGG - Exonic
960714276 3:120560039-120560061 GTGGGGGCAACTGGGGCTTTAGG + Intergenic
961322239 3:126084031-126084053 GTGGGGTCAGCTGGGGCCCAAGG - Intronic
963146564 3:142000909-142000931 GTGGGGGCCCCTGGTACCCTGGG - Intronic
968505161 4:968070-968092 GCGGGGGCACCAGGTGCGCCAGG + Intronic
968541758 4:1171661-1171683 GTGGGGGCAGGGGGCGCTCACGG - Intronic
968661819 4:1801810-1801832 GTGGGGGCAGATGACGCTCAGGG - Intronic
968735961 4:2296726-2296748 GGGGCGGCACCTGCTGCTCAAGG + Intronic
969608645 4:8215035-8215057 GTGTGCGCACCTGGTGCTCAGGG + Intronic
969715638 4:8866938-8866960 CTGGGGACACCTGGAGCCCAGGG - Intronic
972309115 4:37863682-37863704 GTGGGGGCAGGTGGGGCTTATGG - Intergenic
978044716 4:104112271-104112293 GTGTGGGCACATGGTGCTGTGGG - Intergenic
981342078 4:143633098-143633120 GTGGAGGCACTTGGTTTTCATGG + Intronic
985658174 5:1142778-1142800 GGGGGGGCAGCTGATGGTCACGG - Intergenic
985731978 5:1554330-1554352 GTGGGGGCACCTGGGGCCCAGGG + Intergenic
985744976 5:1641258-1641280 GACGGGGCACCTGGTGTTCGGGG - Intergenic
986106409 5:4663588-4663610 GCGGGGACACCTGGTCCTCCAGG + Intergenic
986298581 5:6460197-6460219 GGGGAGGCATCTGATGCTCAGGG - Intronic
986993050 5:13576014-13576036 GTGGGGGCACCTGGGGAGAAGGG + Intergenic
992076722 5:73198722-73198744 GTGGTGGGACCTGGGCCTCATGG + Intergenic
997379971 5:133428610-133428632 GTGTGACCACTTGGTGCTCAGGG - Intronic
998161129 5:139813562-139813584 ATGGGGGCAGCTGGTGGTGATGG + Exonic
1001965632 5:175908105-175908127 GTGGGGGAAACTGAGGCTCAGGG - Intergenic
1002251316 5:177931090-177931112 GTGGGGGAAACTGAGGCTCAGGG + Intergenic
1002324042 5:178393987-178394009 GTCAGGGCACCTGGTGGGCAGGG - Intronic
1002661102 5:180791669-180791691 GTGGGGGCGCCAGGTGGACACGG + Exonic
1003019494 6:2497298-2497320 GTGGGGCCACCAGGTCCTCCAGG - Intergenic
1006425369 6:33959917-33959939 GATGGGCCACCTGGTCCTCAGGG - Intergenic
1007142177 6:39587170-39587192 AAGGAGGCACCTGGGGCTCAGGG + Intronic
1007685950 6:43667515-43667537 GGGGGGGAACATGGTGCCCAGGG + Intronic
1014913357 6:127118763-127118785 GCGGGGGCCCCTGGAGCGCAGGG - Exonic
1016388158 6:143548979-143549001 GTGGGGGCACCTGTGGCTTGAGG + Intronic
1016810756 6:148259156-148259178 GTGGGGGCACCTCCTGTTCCAGG + Intergenic
1018804844 6:167250362-167250384 CAGGGGGCAGCAGGTGCTCAGGG + Intergenic
1018816453 6:167336166-167336188 GTGGGGGCAGCTGAGGATCATGG + Intronic
1018826282 6:167409928-167409950 TCGGGGGCAGCAGGTGCTCAGGG + Intergenic
1018826297 6:167409979-167410001 TTGGGGGCAGCAGGTGCTCAGGG + Intergenic
1018826312 6:167410050-167410072 CAGGGGGCAGCAGGTGCTCAGGG + Intergenic
1019023871 6:168941826-168941848 GTGGGAACACCAGGTGCACAGGG + Intergenic
1019497182 7:1346139-1346161 GTGGGGGAAACTGAGGCTCAGGG - Intergenic
1020119493 7:5495181-5495203 GAGGGGGCACCTGGGTCTCCTGG + Intronic
1020639544 7:10738362-10738384 TTGGGGGCACATGGGGCTCTGGG - Intergenic
1023296991 7:38725366-38725388 GTGGGACCACCTGATGCTGAAGG - Exonic
1024005685 7:45223839-45223861 CAGGTGGCACCTGGGGCTCAGGG + Intergenic
1026863312 7:73807901-73807923 GTGGGGGCAGCTGGTGCTCGTGG + Intronic
1028755147 7:94425792-94425814 GCAGGTGCACCTGGTCCTCATGG + Exonic
1029673653 7:102051035-102051057 GTGGGGGCAGCTTATGCTGAAGG - Intronic
1033225002 7:139554418-139554440 GTGGGGGCAGGTGGCGCTCATGG + Intergenic
1033937891 7:146610859-146610881 ATTGGGGCACCAGGGGCTCAAGG - Intronic
1034401503 7:150864534-150864556 GTGAGTGTACGTGGTGCTCAGGG - Intergenic
1034498255 7:151434437-151434459 TTGGTGGCACCTGGAGCCCAGGG - Intronic
1035276691 7:157752197-157752219 GTGGGGGCACCGAGTGGCCAGGG + Intronic
1035523245 8:292060-292082 CTGAGGGCAAGTGGTGCTCACGG - Intergenic
1036659327 8:10697846-10697868 GTGTGGCCACCTGCTGCTCGTGG - Exonic
1036766241 8:11550963-11550985 GAGGGGGCTCCTGGTGGTCTGGG - Intronic
1037805822 8:22057446-22057468 GTGGGGGCACGGGGTGGGCAGGG + Intronic
1038035519 8:23683034-23683056 GCGGGGTCACCTGGGGCTCAGGG - Intergenic
1039567966 8:38564722-38564744 TGGGGGGCAGCTGGTGGTCAGGG - Intergenic
1042078375 8:65021130-65021152 CTGAGTGCACCTGGTGTTCAAGG - Intergenic
1043152633 8:76738216-76738238 ATGGGGGCACCTAGGGTTCAGGG - Intronic
1048421539 8:134283062-134283084 GTTGGTGCTCCTGGTGCTCCTGG - Intergenic
1049337299 8:142093323-142093345 GTGGGGGCAGCTGGATCTGAGGG + Intergenic
1049399512 8:142418697-142418719 GTGGGGGAGCCTGGGGCTGAGGG - Intergenic
1049469673 8:142769719-142769741 CTGGGGCCACCTCCTGCTCAAGG - Intronic
1049592350 8:143468372-143468394 AGGAGGGCACCTGGTGCACACGG + Exonic
1049598308 8:143494683-143494705 GTGGGGGCTCCTGGCCCTCTGGG - Intronic
1049661869 8:143823173-143823195 ACTGGGGCACCTGGTGCTGAGGG - Intronic
1049661881 8:143823224-143823246 ACTGGGGCACCTGGTGCTGAGGG - Intronic
1049661894 8:143823275-143823297 ACTGGGGCACCTGGTGCTGAGGG - Intronic
1049702372 8:144021065-144021087 CTGGGGGCATCAGGTCCTCAGGG - Intronic
1053314339 9:37038341-37038363 TTCGGGTAACCTGGTGCTCATGG + Intergenic
1056554574 9:87677889-87677911 ATGGGCGCACCTGGTGCACGTGG + Intronic
1057302794 9:93896350-93896372 CTAGGGGCACCTGGTGCCCTTGG - Intergenic
1059385260 9:113959483-113959505 GTGGTGGCACCTGGTACCCTGGG + Intronic
1060158687 9:121339326-121339348 ATGGAGGCTCCTGGTCCTCAAGG + Exonic
1060604145 9:124899278-124899300 GTGGGGGACCCTGGTGCTCCTGG + Intronic
1060933971 9:127505512-127505534 GTGGTGGCGCCTGGCACTCAGGG - Exonic
1060934937 9:127509249-127509271 GGATGGCCACCTGGTGCTCATGG + Intronic
1060976601 9:127768649-127768671 GTGGGGCCTGCTGCTGCTCAAGG + Intronic
1061911285 9:133726488-133726510 GTGGGGACACCTGGTGGCCAGGG + Intronic
1062568357 9:137173123-137173145 GAGGGGGTCCCTGGTGCCCAGGG - Intergenic
1188449549 X:30294908-30294930 GTGGGAGCAACTGGGGCACAGGG - Intergenic
1189061943 X:37763703-37763725 TTGTGGGCACCTGGTTCTGAAGG - Intronic
1189129666 X:38485244-38485266 TTGGCGGCTCCGGGTGCTCATGG + Intronic
1190916597 X:54815709-54815731 GTGGGGACATCTGGGGCTTATGG + Intronic
1193460901 X:81790115-81790137 GTGGAAAGACCTGGTGCTCAAGG + Intergenic
1193549315 X:82871309-82871331 GTGGTAGGATCTGGTGCTCAGGG + Intergenic
1194095236 X:89631714-89631736 GAGGGAGGACCTGGGGCTCAAGG + Intergenic
1198338654 X:135692663-135692685 ATGGTGGCACCTGGTGCCCTGGG - Intergenic
1199236391 X:145498983-145499005 GTGAGGGCACATGGGGCTAAGGG + Intergenic
1199390151 X:147269566-147269588 GTGGGGGCGGGGGGTGCTCAGGG - Intergenic
1199671197 X:150149752-150149774 GAGGTGGAAACTGGTGCTCAGGG + Intergenic
1200223611 X:154404560-154404582 GTGGGAGCTGCTGGGGCTCAGGG - Intronic
1200447870 Y:3287892-3287914 GAGGGAGGACCTGGGGCTCAAGG + Intergenic
1202083133 Y:21105476-21105498 GTGGGGGCACCAGTCTCTCAGGG + Intergenic