ID: 901064212

View in Genome Browser
Species Human (GRCh38)
Location 1:6486954-6486976
Sequence GGTTCCATGGGGAAAGAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 330
Summary {0: 1, 1: 0, 2: 2, 3: 40, 4: 287}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901064196_901064212 8 Left 901064196 1:6486923-6486945 CCACCCACCCCTAATTGCTCCTC 0: 1
1: 0
2: 0
3: 36
4: 346
Right 901064212 1:6486954-6486976 GGTTCCATGGGGAAAGAGGGTGG 0: 1
1: 0
2: 2
3: 40
4: 287
901064197_901064212 5 Left 901064197 1:6486926-6486948 CCCACCCCTAATTGCTCCTCCTC 0: 1
1: 0
2: 3
3: 39
4: 367
Right 901064212 1:6486954-6486976 GGTTCCATGGGGAAAGAGGGTGG 0: 1
1: 0
2: 2
3: 40
4: 287
901064195_901064212 9 Left 901064195 1:6486922-6486944 CCCACCCACCCCTAATTGCTCCT 0: 1
1: 0
2: 3
3: 30
4: 261
Right 901064212 1:6486954-6486976 GGTTCCATGGGGAAAGAGGGTGG 0: 1
1: 0
2: 2
3: 40
4: 287
901064194_901064212 28 Left 901064194 1:6486903-6486925 CCATGCTGTCTGTCATCAGCCCA 0: 1
1: 0
2: 2
3: 24
4: 263
Right 901064212 1:6486954-6486976 GGTTCCATGGGGAAAGAGGGTGG 0: 1
1: 0
2: 2
3: 40
4: 287
901064201_901064212 -1 Left 901064201 1:6486932-6486954 CCTAATTGCTCCTCCTCCACCTG 0: 1
1: 0
2: 1
3: 37
4: 410
Right 901064212 1:6486954-6486976 GGTTCCATGGGGAAAGAGGGTGG 0: 1
1: 0
2: 2
3: 40
4: 287
901064198_901064212 4 Left 901064198 1:6486927-6486949 CCACCCCTAATTGCTCCTCCTCC 0: 1
1: 0
2: 3
3: 96
4: 803
Right 901064212 1:6486954-6486976 GGTTCCATGGGGAAAGAGGGTGG 0: 1
1: 0
2: 2
3: 40
4: 287
901064199_901064212 1 Left 901064199 1:6486930-6486952 CCCCTAATTGCTCCTCCTCCACC 0: 1
1: 0
2: 1
3: 44
4: 590
Right 901064212 1:6486954-6486976 GGTTCCATGGGGAAAGAGGGTGG 0: 1
1: 0
2: 2
3: 40
4: 287
901064200_901064212 0 Left 901064200 1:6486931-6486953 CCCTAATTGCTCCTCCTCCACCT 0: 1
1: 0
2: 3
3: 35
4: 467
Right 901064212 1:6486954-6486976 GGTTCCATGGGGAAAGAGGGTGG 0: 1
1: 0
2: 2
3: 40
4: 287

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901064212 Original CRISPR GGTTCCATGGGGAAAGAGGG TGG Intronic
900135511 1:1115614-1115636 GGGTCCCTGGGGAGGGAGGGGGG - Intronic
900407313 1:2498387-2498409 GGTGCCAGGGGGAGGGAGGGAGG - Intronic
901064212 1:6486954-6486976 GGTTCCATGGGGAAAGAGGGTGG + Intronic
901536141 1:9883981-9884003 GAATCCATGGGGAAGGAGGAAGG + Intronic
902242622 1:15099098-15099120 AGTTCACTGGGGGAAGAGGGTGG + Intronic
902501372 1:16913911-16913933 GGTGCCAGGCGGCAAGAGGGAGG + Intronic
902626033 1:17676893-17676915 GGCTCCATGGAGAAAGGGGCAGG - Intronic
902888367 1:19423419-19423441 GGAACGATGGGGACAGAGGGAGG + Intronic
902944909 1:19828230-19828252 GGTTCCAGGGGTTAAGAGAGAGG - Intergenic
903257339 1:22111705-22111727 GCTTCAACTGGGAAAGAGGGAGG - Intergenic
905326249 1:37154019-37154041 GGTTTTCTGGGCAAAGAGGGAGG - Intergenic
906411952 1:45585524-45585546 GAATCAATGGGGAAAGAGGCAGG - Intronic
907411641 1:54287564-54287586 GGTGGCCTGGGGAAGGAGGGAGG + Intronic
908364654 1:63408172-63408194 GGTACCATTGGGAAAGGAGGAGG - Intronic
908951819 1:69569463-69569485 GATTCGACGTGGAAAGAGGGAGG + Intronic
910914500 1:92274893-92274915 GGTTGGATAGGGAAAGAAGGGGG - Intronic
911939219 1:104020198-104020220 GCTGCCAGGGGGGAAGAGGGAGG + Intergenic
914816227 1:151064685-151064707 GCCACCATGGGGAAAGGGGGAGG - Intronic
915553271 1:156647191-156647213 GGTTCCAGAGGGAGGGAGGGAGG + Intronic
915634217 1:157174930-157174952 AGTTCCATGGGGTAAGAATGGGG - Intergenic
915938587 1:160103844-160103866 GGTGGTATGGGGAAAGAGGGAGG + Intergenic
916559360 1:165919970-165919992 GGTTCCCTGGAGTAGGAGGGAGG - Intergenic
916883601 1:169046131-169046153 GGTCCCAAAGGGATAGAGGGAGG - Intergenic
917268453 1:173246993-173247015 GATTCCCTGGGAAAAGAAGGAGG - Intergenic
917622900 1:176815963-176815985 GGTTCCTTGTGGAAAAAGGACGG - Intronic
924949647 1:248870748-248870770 GGTGGAATGAGGAAAGAGGGTGG + Intergenic
1063889940 10:10618847-10618869 GGTTCCATGGTGAAATACAGGGG + Intergenic
1068368030 10:56077197-56077219 TGCTCCATGGAGAAATAGGGAGG - Intergenic
1068615177 10:59106384-59106406 GGTTCCATGGCAGAAGAGGGAGG + Intergenic
1069842450 10:71348264-71348286 AGTTCCTTGGGGCAAGAAGGAGG - Intronic
1070157125 10:73842206-73842228 GGCACCCTGGGGAAAGAGGAAGG + Exonic
1070556602 10:77532661-77532683 GTTTCCATGGGGGAAGAGGGTGG + Intronic
1071926574 10:90416097-90416119 GGTTCCATGCAGGAAGAGGAGGG - Intergenic
1073378079 10:103054175-103054197 GATGCCACGGGGAAGGAGGGAGG - Intronic
1073663367 10:105502733-105502755 GGTTCCAAGGGGAGTCAGGGTGG - Intergenic
1074012110 10:109492670-109492692 GATTCCATGGGAAAAGAGCATGG + Intergenic
1074834088 10:117272528-117272550 GTTTAAATGGGGAAAGAGGAGGG - Intronic
1075008288 10:118846153-118846175 CATTCCATGGGGAAAAAGGGAGG + Intergenic
1075718375 10:124570187-124570209 GGTGCCATGGGGACAGAGAGGGG - Intronic
1076087504 10:127648212-127648234 GGCTCCATGGGGGACGTGGGTGG + Intergenic
1076207160 10:128612493-128612515 GTTTGCCTGGGGAGAGAGGGGGG - Intergenic
1077059313 11:610775-610797 GGGAACATGGGGAAAGTGGGAGG - Intronic
1077088111 11:764725-764747 GGCACCATGTGGAAGGAGGGAGG - Intronic
1078355675 11:10629852-10629874 GGTTGCATGGGGACAGACAGTGG + Intronic
1082942842 11:58726406-58726428 GGTTCAAGGGGGACAGGGGGAGG + Intronic
1083477044 11:62921504-62921526 GGTGCCCTGGTGAAGGAGGGGGG - Exonic
1083594082 11:63910827-63910849 TGTTCCATAGGGCAGGAGGGGGG - Exonic
1083729525 11:64645221-64645243 GGTTCCACAGGGAGGGAGGGAGG + Intronic
1083782180 11:64924432-64924454 GGCTGCATAGGGAAAGAGGAGGG - Intronic
1084171587 11:67403785-67403807 GGGGCCATGGGGAAGGTGGGAGG + Intronic
1084174214 11:67415346-67415368 GCTGCCATGAAGAAAGAGGGAGG - Intronic
1085788218 11:79473475-79473497 GGTTCCAGGGGGAAAGGGAAGGG + Intergenic
1085809138 11:79664783-79664805 GGTTGCAGGGGGCAGGAGGGGGG + Intergenic
1086808476 11:91273507-91273529 TGTTACATGGAGAAAGAGGGAGG - Intergenic
1089130749 11:116210019-116210041 GGCTACAGGGGAAAAGAGGGAGG - Intergenic
1090091269 11:123700603-123700625 GTTTTCAAGGGGAATGAGGGAGG + Intergenic
1090557535 11:127892630-127892652 GGTTTCATGGAGAAAGAAGATGG + Intergenic
1092003910 12:5052919-5052941 GGGTTCATGGGGCAGGAGGGTGG - Intergenic
1092616649 12:10221914-10221936 CGCGACATGGGGAAAGAGGGTGG + Exonic
1093376940 12:18440705-18440727 GGTTACAGGGGGAAAGAGTAGGG + Intronic
1095722080 12:45411853-45411875 GGTGCAATGGGGAGAGAGGCAGG - Intronic
1095966020 12:47867630-47867652 AGTTAGATGGGGAAAGATGGTGG + Intronic
1096110654 12:49027198-49027220 GGTGCCAAGGGGGAAGGGGGCGG + Exonic
1097010777 12:55952219-55952241 AGTCCCATGGGGAACAAGGGTGG - Intronic
1099611664 12:84879801-84879823 GGTTCCATGAGGACAGACTGTGG + Intronic
1100210655 12:92395224-92395246 TGTTCAATAGGGACAGAGGGAGG - Intergenic
1102370024 12:112375088-112375110 GGTTACCTGGGGATAGAGGCAGG - Intronic
1103109641 12:118264540-118264562 GGTTACCTGGGGGAAGGGGGTGG + Intronic
1103131132 12:118469587-118469609 AAGTCCATGGGGAAAGTGGGGGG - Intergenic
1108706451 13:52992849-52992871 GGTTCCATGGGGAGTGAATGGGG + Intergenic
1110499464 13:76209763-76209785 GCTTCCATGGGGAAATGGAGAGG - Intergenic
1110906150 13:80892298-80892320 TGTTTCATGGGGAAAGAAGGGGG + Intergenic
1111202877 13:84962241-84962263 GGGTCCAGGGGGACTGAGGGAGG - Intergenic
1111611591 13:90614424-90614446 GGGTCTATGGGGACACAGGGTGG - Intergenic
1113150747 13:107261192-107261214 GGTTCCCAGGGGAAGGAGGCAGG + Intronic
1113168907 13:107475897-107475919 GGGTCCATGGGGAAAAAAAGAGG - Intronic
1113187431 13:107704838-107704860 GGTTACATTGGGAGAGAGTGTGG + Intronic
1113425022 13:110200542-110200564 GGAGCCGTGGGAAAAGAGGGGGG + Intronic
1114069671 14:19097360-19097382 GGTTCAGTGGGCAAAGAGAGGGG - Intergenic
1114487186 14:23069799-23069821 TTTTCCTTGGGGAAAGAGCGTGG + Intronic
1114700339 14:24671338-24671360 GGTTCCATTTGGAAAGGGAGAGG - Intergenic
1114764446 14:25355101-25355123 GATTCCTTGGGGAAAGGAGGTGG + Intergenic
1117054082 14:51892708-51892730 GGTTACATGGGGGAGGAGGGAGG - Intronic
1118678183 14:68211333-68211355 GTTTCAATGGGGAAAGCGGGTGG - Intronic
1119563250 14:75607503-75607525 GGTTCCATGGGAAGAGAGCAGGG + Intronic
1121520454 14:94582741-94582763 GGTCCCATGGAGAGAGAGGCCGG + Intronic
1121956400 14:98217515-98217537 GGTTTCAGGGGGAAAGGGAGAGG - Intergenic
1122228285 14:100292252-100292274 GGAGCCCTGGGGAAGGAGGGCGG + Exonic
1122265507 14:100544866-100544888 TGTTCCATGGAGAAAGGGGTGGG + Intronic
1122707059 14:103628437-103628459 GGCTGCGTGGGGACAGAGGGGGG + Intronic
1123065685 14:105618152-105618174 GGTCCCAGGTGGAAAGGGGGCGG + Intergenic
1123074521 14:105661375-105661397 GGTTCCAGGTGGAAAGGGGGAGG + Intergenic
1123094869 14:105762342-105762364 GGTCCCAGGTGGAAAGGGGGCGG + Intergenic
1125486804 15:40116750-40116772 GATTCCATGGCAATAGAGGGAGG - Intergenic
1125504107 15:40257132-40257154 GGTGCCAGGGGGTGAGAGGGGGG - Intronic
1125867080 15:43062422-43062444 GGTTGCCAGGGGATAGAGGGAGG + Intronic
1126427322 15:48542673-48542695 GGTTCCATGGGGAAAACTGGGGG - Intronic
1128635152 15:69298401-69298423 GGATCCCTGGGGAAAGGGTGAGG + Intergenic
1128916386 15:71566734-71566756 GGGAGCAGGGGGAAAGAGGGGGG - Intronic
1130986316 15:88847164-88847186 GGCTCCATGGGCACAGAGGGGGG - Intronic
1132552449 16:559182-559204 GGTGCCTTGGGGAAGAAGGGAGG - Intergenic
1133041957 16:3065596-3065618 GGTTTTATGGGGAAAGTGGGGGG - Exonic
1133255176 16:4512212-4512234 GGTCCCAGGGGGAAAGAGTCTGG + Exonic
1135383059 16:22009368-22009390 GGTGCCCTCGGGAAAGAGGCGGG + Intronic
1137693474 16:50445978-50446000 GGGTCCTTGGGTGAAGAGGGTGG - Intergenic
1137732182 16:50697238-50697260 GCTTTGATGGGGGAAGAGGGTGG + Exonic
1140314319 16:73879879-73879901 TGTCCCCTGGGGAAGGAGGGGGG + Intergenic
1140739287 16:77926840-77926862 GGTCACATGTGGAAGGAGGGAGG - Intronic
1141428584 16:83959243-83959265 CGTTACCTGGGGAGAGAGGGTGG - Exonic
1142294515 16:89211604-89211626 GGTCCCATGAGGGAAGAGTGGGG + Intergenic
1143512292 17:7403578-7403600 GGGTCCCTGGGGGAAGTGGGCGG - Intronic
1143925008 17:10361845-10361867 GGTTCCCTGGGGACAAAGGTAGG + Intronic
1144714483 17:17424509-17424531 GGTTCCTGGGTGGAAGAGGGTGG + Intergenic
1145097375 17:20042347-20042369 GTCACCATGGGGGAAGAGGGAGG + Intronic
1145998177 17:29116265-29116287 GATGCCAGGGGGCAAGAGGGAGG - Intronic
1147139070 17:38451524-38451546 GGCTCCATGGGGGATGAGAGGGG + Intronic
1147203988 17:38823718-38823740 GGTTAGAGGGAGAAAGAGGGAGG - Intronic
1147658679 17:42105480-42105502 GGGTCCGTAGGGAAAGAGGTGGG - Intronic
1147792003 17:43019869-43019891 GGGTCCATGGGGAAGGGGGATGG + Intronic
1148109676 17:45137415-45137437 GGTTCCTTGGGGAGGCAGGGAGG - Exonic
1148804880 17:50259044-50259066 GATTCCAGAGGGAAAGAGGTTGG - Intergenic
1150268640 17:63848183-63848205 GGTACCATGGGGAAACAAGGAGG + Intergenic
1151944420 17:77311693-77311715 GGTGCCCTGGGGAAATAGCGAGG - Intronic
1152061301 17:78077668-78077690 GTTGCCATGAGGAAAGAGGGTGG - Intronic
1152104199 17:78319219-78319241 GGCTCCATGGGGCAAGGGAGGGG + Intergenic
1153159485 18:2187656-2187678 TGTTCCATGGGAAAGGAGGGAGG - Intergenic
1156427973 18:37036689-37036711 GTTTTCATGTGGAAAGAGGGTGG - Intronic
1157287151 18:46384662-46384684 GGTCCCAAGTGGAAAGAGGTGGG - Intronic
1157437664 18:47684375-47684397 GGTGCCATGGAGGAAGATGGGGG + Intergenic
1158619632 18:59021449-59021471 GGGTCCAGGGGTAAAGATGGTGG + Intergenic
1159735444 18:72091713-72091735 GATTCCTCGGGGAAAGAGTGAGG - Intergenic
1160148248 18:76381124-76381146 CGTTCCTTGGGTAAAGTGGGAGG - Intronic
1160178131 18:76612575-76612597 GGTCCGATGGAGAAAGGGGGTGG + Intergenic
1160919225 19:1512078-1512100 GCCTGCAGGGGGAAAGAGGGGGG + Intronic
1161066625 19:2241702-2241724 GGTTCCTTGGGGCCAGAGGGTGG + Intronic
1161102746 19:2429380-2429402 GGTCCCATGTAGATAGAGGGGGG - Exonic
1161943217 19:7418778-7418800 GATTCAAGGGGGAGAGAGGGAGG + Intronic
1162052974 19:8046319-8046341 GGTTGCATGGAGAGAGAGGGTGG - Intronic
1162124328 19:8491078-8491100 GGTGCCATGGGCAGAGGGGGTGG - Exonic
1162332552 19:10039112-10039134 GGTTCTGTGGGGATAGGGGGTGG - Intergenic
1163757157 19:19112925-19112947 GGGTTCATGGGGGAAGATGGGGG - Intergenic
1163771516 19:19193932-19193954 AGCTCCATGGGGAAAGCTGGCGG - Exonic
1165395336 19:35560703-35560725 GGACCCATGGGGAGAGATGGAGG + Intronic
1165573185 19:36792355-36792377 GATTCTATGGGGTAAGAGTGTGG - Intergenic
1165632497 19:37313371-37313393 GATTCTATGGGGTAAGAGTGTGG - Intronic
1166498277 19:43321630-43321652 GGTTCCATGAGGAAAAACAGTGG - Intergenic
1166861764 19:45815534-45815556 GGCTCGAGGGGGAAAGGGGGTGG - Exonic
1167005822 19:46775826-46775848 GATTCCAGGGGGAGAGAGGCAGG - Intronic
1167045484 19:47046558-47046580 GGTTCCGTGGGGCGAGAGGGGGG + Intronic
1167562193 19:50232630-50232652 AGTGCCATGGAGAAAGATGGGGG + Intronic
1167644093 19:50696380-50696402 GGCAACATGGGGAGAGAGGGTGG - Intronic
1168286842 19:55339500-55339522 AGGTCCAAGTGGAAAGAGGGCGG - Intergenic
925347745 2:3182841-3182863 GGTTGGATGGGGTAAGTGGGTGG - Intergenic
926299079 2:11589401-11589423 GGGGCCCTGGGGAGAGAGGGAGG + Intronic
927953973 2:27194902-27194924 GGCTCCTTGAGGGAAGAGGGTGG - Intergenic
929234710 2:39593678-39593700 GGGGCCATGGGGAAGGAGGTGGG + Intergenic
931113443 2:59138554-59138576 GGTTATAGTGGGAAAGAGGGTGG - Intergenic
931729011 2:65136697-65136719 GGTTCCATGGGAGATGAGGTGGG + Intergenic
931997873 2:67856440-67856462 TGTTCCATGGGGAGTGATGGGGG - Intergenic
932768086 2:74483674-74483696 AGTTCCTTGGGAAAAGATGGAGG + Intronic
934029805 2:88033037-88033059 GGTTGCTTGGGGAGAGAGGTGGG + Intronic
934514509 2:94977799-94977821 GGTCCCATGGGCACAGAGGTTGG - Intergenic
934865958 2:97811494-97811516 AGGTCCATGGGTAAAGAGTGAGG - Intronic
935816148 2:106847801-106847823 GATTCCACAGGGAAAGAGGGTGG - Intronic
936751715 2:115650396-115650418 GCTGGCATGGGGAAAGGGGGGGG + Intronic
936999293 2:118450105-118450127 GTTGCCAAGGGGAGAGAGGGAGG - Intergenic
938591300 2:132738787-132738809 TGTTACATGGTGAGAGAGGGGGG + Intronic
939344162 2:140941391-140941413 GGTACCATGGGTGAAGAAGGAGG + Intronic
939597882 2:144150048-144150070 GATTTCATGGGGCAAGAGTGAGG - Intronic
944051410 2:195474339-195474361 TCTTCCAAAGGGAAAGAGGGAGG + Intergenic
945133034 2:206595387-206595409 GGGTCCCTGGAGAAACAGGGAGG + Intronic
945974812 2:216262004-216262026 AGTTCCATGGGCACAGAAGGAGG + Intronic
946078465 2:217095924-217095946 GGTTCTATGGGGCATGAGAGAGG + Intergenic
946758517 2:222971009-222971031 GCTTGCCTGGGGAAAGACGGTGG - Intergenic
947330513 2:229024907-229024929 TGTTAGAAGGGGAAAGAGGGTGG + Exonic
947486651 2:230556159-230556181 GGTTCCATGTTGATAGAGGATGG - Intergenic
1169823353 20:9738644-9738666 GGTTTCCTGGGGACAGAGGTTGG + Intronic
1170643286 20:18175176-18175198 GGTTCCCTGAGAGAAGAGGGTGG - Intronic
1171209975 20:23309476-23309498 GGTTCCATGGGCAAGCATGGAGG - Intergenic
1171395777 20:24832248-24832270 GCTGCCATGGGGAAGGTGGGAGG - Intergenic
1172238941 20:33399020-33399042 GAATCTGTGGGGAAAGAGGGTGG + Intronic
1173120823 20:40287404-40287426 GGTGCCAGGGGGAAGGAGGCAGG - Intergenic
1174602889 20:51739145-51739167 GCACCCATGGGGAAAGGGGGAGG - Intronic
1175134627 20:56813805-56813827 TGTTGCAGGGGGAATGAGGGAGG - Intergenic
1177717148 21:24853619-24853641 TGTTCCGTGGGGAAAGAGACGGG - Intergenic
1178615843 21:34132167-34132189 GGTTCCCTGGGAGAAGAGGTCGG + Intronic
1179568615 21:42264753-42264775 GGCCACATGGGGAAAGGGGGAGG + Intronic
1179583684 21:42361419-42361441 GGTTCCAGGGAGGAAGAGGGAGG - Intergenic
1180085600 21:45506750-45506772 GGTTCCAGAGGGAAGGTGGGAGG - Intronic
1181474312 22:23159049-23159071 GGAGCCATGGGGAGGGAGGGAGG + Intronic
1182249407 22:28988247-28988269 GGTACCATGGGGAGAGAGCTGGG + Intronic
1182351716 22:29703537-29703559 CCTTCCATGGGAAAAGAGGAGGG - Intergenic
1183219580 22:36504072-36504094 AGTTCCATGCGGAAGGAGGTGGG - Intronic
1184624200 22:45710310-45710332 GGTTCCATGCAGAAAGACAGCGG - Intronic
1184925786 22:47636329-47636351 GGCTCAATGGGGAAAAAGAGAGG - Intergenic
949125025 3:436811-436833 GCTTTAATGGGGAAAGACGGAGG + Intergenic
952675499 3:36025577-36025599 GGTTCCATTTGGAATGATGGAGG + Intergenic
952828803 3:37545878-37545900 GGTTCCAGGAGGAAAGGGGCAGG - Intronic
953378932 3:42452033-42452055 GGTTCCATCCAGGAAGAGGGGGG + Intergenic
953563562 3:44012951-44012973 GTTTCCTTGGGGAGAAAGGGTGG + Intergenic
954431411 3:50472764-50472786 GGGTGCATGGGGAATGGGGGTGG - Intronic
955080003 3:55649725-55649747 GGCTCCATGGGGAAATGAGGAGG - Intronic
955351506 3:58196759-58196781 CCTTCAATGGGGACAGAGGGGGG - Intronic
955723762 3:61910742-61910764 GGTTCTGTGGGGAAAGCAGGTGG - Intronic
955962030 3:64350479-64350501 TGTTGCATGAGGAAAGTGGGTGG + Intronic
956851432 3:73231651-73231673 GGTGACCTGGGAAAAGAGGGAGG - Intergenic
958164030 3:89855874-89855896 GTTTCCATATGGAAAGAGTGAGG - Intergenic
958944704 3:100350192-100350214 GGTTGCATGGTGGAAGATGGGGG + Intronic
959108558 3:102094307-102094329 GGTTCCATGTAAAAAGAGGAGGG + Intergenic
961200817 3:125043856-125043878 GGTTCCGAGGAGGAAGAGGGGGG + Intronic
962636996 3:137341356-137341378 GGATGCAGGGGGAAAAAGGGAGG - Intergenic
963633787 3:147767883-147767905 CTTGCCATGGGGAAAGAGTGGGG - Intergenic
963952140 3:151214542-151214564 GGGTAAAGGGGGAAAGAGGGAGG - Intronic
965533342 3:169798835-169798857 GGTGCCATGGGGACATAAGGAGG - Intronic
969430026 4:7148619-7148641 GCTTCCATGGGGAATGGAGGTGG + Intergenic
969990755 4:11260083-11260105 GGTTCCCTGGGAAAACAGGATGG + Intergenic
970513712 4:16806305-16806327 AGTTTCATGGGGAAAGAAAGAGG - Intronic
971412753 4:26392646-26392668 GGTTTCCTGGGGATAGGGGGAGG + Intronic
972682448 4:41319487-41319509 GGTTGCAGGGGTAAATAGGGTGG - Intergenic
974279411 4:59773054-59773076 TGTTCCAAGGGTAAAGAGAGAGG + Intergenic
976526625 4:86099468-86099490 TGTTCCATGGGGAAGGAAGGCGG + Intronic
980265926 4:130515371-130515393 GGATCCATGGGAAAAGAAAGGGG + Intergenic
981514031 4:145587825-145587847 GGTACCTTGGGGAAATAGGGAGG - Intergenic
982138061 4:152291494-152291516 AGTTTCATGGGAAAAGAGGCAGG - Intergenic
982405201 4:155011841-155011863 GGTTACTTGTGGAAGGAGGGTGG + Intergenic
984264669 4:177483430-177483452 GGTACCATGTGGAAAGGGTGGGG + Intergenic
984952388 4:185017183-185017205 GGGCCCAAGGGGAAGGAGGGGGG - Intergenic
985785007 5:1888786-1888808 GCTTCCACGGGGAAAGAAGAGGG + Intergenic
986403109 5:7397889-7397911 GGTTACATGTGGAGAGAGTGAGG - Intronic
986956548 5:13157895-13157917 GGCTCCCTGGGGAATGAGGAAGG - Intergenic
988974646 5:36502862-36502884 GCTGCCATGGGGATAGAGAGAGG + Intergenic
989158207 5:38364931-38364953 GGTTTGATGTGGAAAGAAGGAGG + Intronic
990486267 5:56261827-56261849 GGTTCTATGGGAAGAGAGGAGGG + Intergenic
992761652 5:79955942-79955964 GGTTCCCTGGGGGAAAAGAGTGG - Intergenic
998955412 5:147433303-147433325 GGGTGGATGGGGAAAGAGGCAGG + Intronic
999596374 5:153209832-153209854 GGTTCCATGGGGCAAGCCAGCGG + Intergenic
1001398981 5:171435627-171435649 GGGTCCATGGGGAAAGAAGGAGG - Intronic
1002375405 5:178785304-178785326 GCTTCCTTGGGGAAGGGGGGCGG + Intergenic
1003291092 6:4778540-4778562 GGTTTCATGGGGAAATACTGAGG + Intronic
1003815868 6:9839607-9839629 GGTTACCTGGAGAAACAGGGAGG - Intronic
1005997333 6:30939442-30939464 GGGTCCCTGGGGAAAGGGGGGGG + Intergenic
1006022426 6:31125298-31125320 GGTGTCATGGAGAAAGAGAGAGG - Intronic
1006106589 6:31720526-31720548 GATACCATGGGGAAAGAATGTGG + Intronic
1007311907 6:40953396-40953418 GGTTACATGAGGAAAGAAGGGGG + Intergenic
1007610846 6:43147791-43147813 AGTTTCATGGGGAAGGAGGTAGG - Intronic
1007777960 6:44234260-44234282 GGGTCCAAGGGGGAGGAGGGGGG + Intergenic
1010124303 6:72414365-72414387 GGTTTGCTGGGGAAGGAGGGTGG - Intergenic
1010309767 6:74371310-74371332 GGTTCCCTGGAGAAAGAGCTAGG + Intergenic
1010833901 6:80563435-80563457 GCTTTCATGGGTAAAGAGGGTGG - Intergenic
1011854323 6:91669757-91669779 GGCTCAGTGGGGAAAGAGAGGGG + Intergenic
1012984809 6:105864426-105864448 GGTTCCTTTGGGGAAGAGAGAGG - Intergenic
1017093035 6:150778674-150778696 GGTTACAGGGGTAAAGAAGGTGG - Intronic
1017685730 6:156912454-156912476 AGTGGGATGGGGAAAGAGGGAGG + Intronic
1018379308 6:163243292-163243314 AGTTCCACGGGGAAAGGGGAGGG + Intronic
1018618564 6:165709545-165709567 GGCTGCATGGGGATAGAGAGTGG - Intronic
1018862402 6:167720594-167720616 GGTCCCAGGAGGAAAGAGAGTGG - Intergenic
1019013002 6:168857628-168857650 GGTTGCCTGGGGATAGAGGGAGG + Intergenic
1022177861 7:27889281-27889303 GGTTCAATGGGGAAATATGGGGG + Intronic
1022531354 7:31068855-31068877 GGTTCAATGGGGGAAGAGTAAGG - Intronic
1023311301 7:38889180-38889202 AGTTCCACAGGGAAAGAGAGTGG + Intronic
1026673815 7:72412665-72412687 GGTTCCATGGGGGAAGGGTGAGG - Intronic
1028490736 7:91408726-91408748 AATTCCATGTGGAGAGAGGGTGG + Intergenic
1029642392 7:101829373-101829395 GGTTTCATGGGAACAGATGGCGG + Intronic
1030524976 7:110641732-110641754 GGTTCCAGGGGTAAAGACTGGGG - Intergenic
1032580468 7:133098892-133098914 GGTTCCATGGGGATGGGGTGAGG - Intergenic
1033539773 7:142345681-142345703 GTTTCCATGGGGACTGCGGGGGG - Intergenic
1034652097 7:152699782-152699804 GGTCCCATTGAGAAAGAGGCTGG - Intergenic
1035787647 8:2274907-2274929 GACTCCAAGGGGAAGGAGGGAGG - Intergenic
1035805163 8:2446809-2446831 GACTCCAAGGGGAAGGAGGGAGG + Intergenic
1036614750 8:10379575-10379597 GGTGCCAGAGGGGAAGAGGGGGG - Intronic
1036944420 8:13081320-13081342 GGTTGGTGGGGGAAAGAGGGAGG + Intergenic
1038531345 8:28320292-28320314 GGATGAATGGGGAAGGAGGGTGG - Intronic
1038677926 8:29640366-29640388 GGTCTCATCGGGAAAGTGGGAGG - Intergenic
1039074519 8:33677755-33677777 GGTTCCATGCTGAAAGCAGGAGG - Intergenic
1039959778 8:42237522-42237544 GGTTCCCTTGGTCAAGAGGGGGG + Intergenic
1040434953 8:47381177-47381199 GGTACAATGGGTACAGAGGGAGG - Intronic
1041129180 8:54679022-54679044 GGTTCCATAGGAAAAGAGGCAGG - Intergenic
1041268392 8:56086568-56086590 TGTTCCATGGAAAAAGAGGCTGG + Intergenic
1042511592 8:69617982-69618004 GATTCCATGGGGAAGGCAGGAGG - Intronic
1043100840 8:76043231-76043253 GGGTCCATGTGGAAAGATGAGGG + Intergenic
1043556314 8:81434511-81434533 AGTTCCATGAGGAACGATGGTGG + Intergenic
1045204489 8:100023886-100023908 GGTTCCTTGGGTGAAGTGGGAGG + Intronic
1045903226 8:107310550-107310572 GGTTGTATGGGAAAAGAGAGAGG + Intronic
1046170906 8:110504370-110504392 GGTTACAAGAGGAAGGAGGGTGG - Intergenic
1047632306 8:126721639-126721661 TGTTCCATGGGGAAAAAAGATGG - Intergenic
1048325699 8:133437220-133437242 GGGTCCAAGGAGAAACAGGGTGG + Intergenic
1049218510 8:141418330-141418352 TGTGCCATCGGGAAGGAGGGCGG + Intronic
1051141404 9:13983211-13983233 GGTTCCTTGGGGAGGGAAGGGGG + Intergenic
1052831385 9:33218713-33218735 GCATCCATGGGGAAAAAGGGAGG + Intronic
1054530503 9:66178575-66178597 GGGTAGATGGGGGAAGAGGGAGG - Intergenic
1054831334 9:69628316-69628338 GTTTCCATGGGGCAAGAGTCTGG - Intronic
1054905043 9:70407395-70407417 GGTTCCTGGGTGAGAGAGGGAGG - Intronic
1055154585 9:73044600-73044622 GGCACCATGGAGAAAGAGAGAGG - Intronic
1056261685 9:84855049-84855071 TGTTTCATGGGGAATGAGGCAGG + Intronic
1056461069 9:86810360-86810382 GGTTCCCTGGGGATGGAGGGTGG + Intergenic
1057018703 9:91678964-91678986 GGTAGCCTGGGGAAAGAGGCAGG - Intronic
1057567715 9:96179904-96179926 CGTTCCATGAGGAGAAAGGGAGG - Intergenic
1057701445 9:97366000-97366022 GGTGCCTTGGGGACAGAGGATGG - Intronic
1058030640 9:100193599-100193621 GGTTGCTTGGGGAGGGAGGGTGG - Intronic
1058091893 9:100814334-100814356 GGTTCCTGGGTGGAAGAGGGAGG + Intergenic
1058343679 9:103930627-103930649 GGTTGCATGTAGAAAGAGGGAGG + Intergenic
1058986730 9:110214766-110214788 GATTCTATGGGCAAAGAGGCAGG - Intergenic
1059316599 9:113430801-113430823 GGTTCAAGGGGGTAAGAGGAGGG + Intergenic
1060408996 9:123387656-123387678 GGCTGCATGGCGAAAGCGGGGGG - Intronic
1060948020 9:127581809-127581831 GATTACATGGGGAGAGAGGGAGG - Intergenic
1060948042 9:127581890-127581912 GATTACATGGGGAGAGAGGGAGG - Intergenic
1060948051 9:127581917-127581939 GATTACATGGGGAGAGAGGGAGG - Intergenic
1060948064 9:127581967-127581989 GATTGCATGGGGAGGGAGGGAGG - Intergenic
1060948083 9:127582021-127582043 GATTACATGGGGAGAGAGGGAGG - Intergenic
1060948092 9:127582048-127582070 GATTACATGGGGAGAGAGGGAGG - Intergenic
1060980669 9:127789773-127789795 GTTTCCATGGGGTAGGAGGATGG + Exonic
1061543840 9:131292326-131292348 TGTCACATGGGGAAAGAAGGTGG - Intronic
1061990998 9:134158744-134158766 GCTCCCCTGGGGCAAGAGGGTGG + Exonic
1062081723 9:134627658-134627680 GGAAGGATGGGGAAAGAGGGAGG - Intergenic
1062151389 9:135021015-135021037 GGTTCAGTGGAGAACGAGGGAGG + Intergenic
1185671600 X:1814229-1814251 GGGGTCATGGGGAAAGAGTGTGG + Intergenic
1189161357 X:38812596-38812618 GGCTCCATGTGGAAAAAAGGAGG + Intergenic
1190023780 X:46903740-46903762 GTTCCCATGGGGGAAGAAGGCGG - Intergenic
1190917985 X:54824371-54824393 GGTTGCATGGGCAATGAGGTAGG + Intergenic
1192265363 X:69533871-69533893 GGTTCCTTGGTGAAAGGGGGCGG - Intergenic
1193760001 X:85452914-85452936 GGTGGAATGGGGAGAGAGGGTGG - Intergenic
1193915008 X:87353360-87353382 GTTTCCTTGGGGAAGGATGGGGG + Intergenic
1194268672 X:91782932-91782954 GGTTGCACAGGGCAAGAGGGAGG + Intronic
1195887989 X:109660911-109660933 GGTTCCCAGGGGAAGGAGGGAGG + Intronic
1196798814 X:119523959-119523981 GGCCCCATGGGGAAAGGGAGAGG + Intergenic
1198146655 X:133864138-133864160 GGTGGCATGGGGGAAGAGAGGGG + Intronic
1199924544 X:152449081-152449103 GGATCCAAGGGTTAAGAGGGAGG + Intronic
1200585875 Y:5003847-5003869 GGTTGCACAGGGCAAGAGGGAGG + Intronic
1200746714 Y:6910312-6910334 AGTTCCGTGGGGGCAGAGGGCGG + Intergenic
1201989657 Y:20009819-20009841 GGGTTCTTGGGCAAAGAGGGGGG - Intergenic