ID: 901068570

View in Genome Browser
Species Human (GRCh38)
Location 1:6506213-6506235
Sequence ACTCCCTGCGTCCCGTCCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 2, 2: 1, 3: 19, 4: 159}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901068570_901068583 15 Left 901068570 1:6506213-6506235 CCTGGGGACGGGACGCAGGGAGT 0: 1
1: 2
2: 1
3: 19
4: 159
Right 901068583 1:6506251-6506273 GTTTCAGGGACCACTGGGGCTGG 0: 1
1: 1
2: 2
3: 27
4: 350
901068570_901068587 29 Left 901068570 1:6506213-6506235 CCTGGGGACGGGACGCAGGGAGT 0: 1
1: 2
2: 1
3: 19
4: 159
Right 901068587 1:6506265-6506287 TGGGGCTGGCCTCGGCTGGCAGG 0: 1
1: 0
2: 1
3: 43
4: 397
901068570_901068586 25 Left 901068570 1:6506213-6506235 CCTGGGGACGGGACGCAGGGAGT 0: 1
1: 2
2: 1
3: 19
4: 159
Right 901068586 1:6506261-6506283 CCACTGGGGCTGGCCTCGGCTGG 0: 1
1: 0
2: 2
3: 46
4: 439
901068570_901068575 -9 Left 901068570 1:6506213-6506235 CCTGGGGACGGGACGCAGGGAGT 0: 1
1: 2
2: 1
3: 19
4: 159
Right 901068575 1:6506227-6506249 GCAGGGAGTGCAGGGGCGCAGGG 0: 1
1: 0
2: 3
3: 58
4: 557
901068570_901068578 0 Left 901068570 1:6506213-6506235 CCTGGGGACGGGACGCAGGGAGT 0: 1
1: 2
2: 1
3: 19
4: 159
Right 901068578 1:6506236-6506258 GCAGGGGCGCAGGGGGTTTCAGG 0: 1
1: 0
2: 1
3: 27
4: 273
901068570_901068584 21 Left 901068570 1:6506213-6506235 CCTGGGGACGGGACGCAGGGAGT 0: 1
1: 2
2: 1
3: 19
4: 159
Right 901068584 1:6506257-6506279 GGGACCACTGGGGCTGGCCTCGG 0: 1
1: 0
2: 5
3: 47
4: 450
901068570_901068576 -8 Left 901068570 1:6506213-6506235 CCTGGGGACGGGACGCAGGGAGT 0: 1
1: 2
2: 1
3: 19
4: 159
Right 901068576 1:6506228-6506250 CAGGGAGTGCAGGGGCGCAGGGG 0: 1
1: 0
2: 3
3: 52
4: 610
901068570_901068577 -7 Left 901068570 1:6506213-6506235 CCTGGGGACGGGACGCAGGGAGT 0: 1
1: 2
2: 1
3: 19
4: 159
Right 901068577 1:6506229-6506251 AGGGAGTGCAGGGGCGCAGGGGG 0: 1
1: 0
2: 3
3: 53
4: 639
901068570_901068574 -10 Left 901068570 1:6506213-6506235 CCTGGGGACGGGACGCAGGGAGT 0: 1
1: 2
2: 1
3: 19
4: 159
Right 901068574 1:6506226-6506248 CGCAGGGAGTGCAGGGGCGCAGG 0: 1
1: 0
2: 2
3: 32
4: 358
901068570_901068581 10 Left 901068570 1:6506213-6506235 CCTGGGGACGGGACGCAGGGAGT 0: 1
1: 2
2: 1
3: 19
4: 159
Right 901068581 1:6506246-6506268 AGGGGGTTTCAGGGACCACTGGG 0: 1
1: 0
2: 0
3: 14
4: 241
901068570_901068579 1 Left 901068570 1:6506213-6506235 CCTGGGGACGGGACGCAGGGAGT 0: 1
1: 2
2: 1
3: 19
4: 159
Right 901068579 1:6506237-6506259 CAGGGGCGCAGGGGGTTTCAGGG 0: 1
1: 0
2: 1
3: 21
4: 199
901068570_901068580 9 Left 901068570 1:6506213-6506235 CCTGGGGACGGGACGCAGGGAGT 0: 1
1: 2
2: 1
3: 19
4: 159
Right 901068580 1:6506245-6506267 CAGGGGGTTTCAGGGACCACTGG 0: 1
1: 0
2: 1
3: 18
4: 231
901068570_901068582 11 Left 901068570 1:6506213-6506235 CCTGGGGACGGGACGCAGGGAGT 0: 1
1: 2
2: 1
3: 19
4: 159
Right 901068582 1:6506247-6506269 GGGGGTTTCAGGGACCACTGGGG 0: 1
1: 0
2: 0
3: 72
4: 472

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901068570 Original CRISPR ACTCCCTGCGTCCCGTCCCC AGG (reversed) Intronic