ID: 901068701

View in Genome Browser
Species Human (GRCh38)
Location 1:6506731-6506753
Sequence CACTGAGCCGAGGCCCCCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 238
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 227}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901068688_901068701 23 Left 901068688 1:6506685-6506707 CCTGCCTGGACCCTCCCCAGGAA 0: 1
1: 0
2: 5
3: 43
4: 379
Right 901068701 1:6506731-6506753 CACTGAGCCGAGGCCCCCAGAGG 0: 1
1: 0
2: 2
3: 8
4: 227
901068691_901068701 13 Left 901068691 1:6506695-6506717 CCCTCCCCAGGAAGCTCAAGGCA 0: 1
1: 0
2: 8
3: 44
4: 398
Right 901068701 1:6506731-6506753 CACTGAGCCGAGGCCCCCAGAGG 0: 1
1: 0
2: 2
3: 8
4: 227
901068686_901068701 29 Left 901068686 1:6506679-6506701 CCAGCTCCTGCCTGGACCCTCCC 0: 1
1: 0
2: 10
3: 134
4: 1050
Right 901068701 1:6506731-6506753 CACTGAGCCGAGGCCCCCAGAGG 0: 1
1: 0
2: 2
3: 8
4: 227
901068689_901068701 19 Left 901068689 1:6506689-6506711 CCTGGACCCTCCCCAGGAAGCTC 0: 1
1: 0
2: 2
3: 33
4: 340
Right 901068701 1:6506731-6506753 CACTGAGCCGAGGCCCCCAGAGG 0: 1
1: 0
2: 2
3: 8
4: 227
901068692_901068701 12 Left 901068692 1:6506696-6506718 CCTCCCCAGGAAGCTCAAGGCAT 0: 1
1: 0
2: 0
3: 18
4: 208
Right 901068701 1:6506731-6506753 CACTGAGCCGAGGCCCCCAGAGG 0: 1
1: 0
2: 2
3: 8
4: 227
901068694_901068701 8 Left 901068694 1:6506700-6506722 CCCAGGAAGCTCAAGGCATGTCC 0: 1
1: 0
2: 0
3: 15
4: 160
Right 901068701 1:6506731-6506753 CACTGAGCCGAGGCCCCCAGAGG 0: 1
1: 0
2: 2
3: 8
4: 227
901068695_901068701 7 Left 901068695 1:6506701-6506723 CCAGGAAGCTCAAGGCATGTCCC 0: 1
1: 0
2: 0
3: 15
4: 154
Right 901068701 1:6506731-6506753 CACTGAGCCGAGGCCCCCAGAGG 0: 1
1: 0
2: 2
3: 8
4: 227
901068693_901068701 9 Left 901068693 1:6506699-6506721 CCCCAGGAAGCTCAAGGCATGTC 0: 1
1: 0
2: 0
3: 14
4: 158
Right 901068701 1:6506731-6506753 CACTGAGCCGAGGCCCCCAGAGG 0: 1
1: 0
2: 2
3: 8
4: 227

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901068701 Original CRISPR CACTGAGCCGAGGCCCCCAG AGG Intronic
900626123 1:3609469-3609491 CTGTGAGCAGAGGCCTCCAGTGG + Intronic
900792464 1:4689495-4689517 CTCTGAGCCGATGGCCCCTGGGG + Intronic
900924173 1:5692600-5692622 CACAGAGCCCAGGGCCCCTGAGG + Intergenic
901068701 1:6506731-6506753 CACTGAGCCGAGGCCCCCAGAGG + Intronic
901497224 1:9629096-9629118 CAGTGGCCCGAGACCCCCAGGGG - Intergenic
903890897 1:26569829-26569851 CCCTGAGCTCAGGCCACCAGGGG - Intronic
904603123 1:31684386-31684408 CACTGAGCGGAGGCTCCTCGGGG - Intronic
904755213 1:32765226-32765248 CTGTGGGCAGAGGCCCCCAGAGG - Intronic
905626057 1:39491374-39491396 CTCTGCGCCGAGGCCCGCGGCGG + Intergenic
905670860 1:39789098-39789120 CTCTGCGCCGAGGCCCGCGGCGG - Intergenic
908418002 1:63932273-63932295 CACTCAGCTGGGGCCCCCATAGG - Intronic
912145610 1:106790778-106790800 CACTGAACCGATAGCCCCAGAGG - Intergenic
914336987 1:146724527-146724549 CTCTGAGCAGAGGAACCCAGGGG - Intergenic
916066638 1:161141253-161141275 CGGTGAGCTGAGGCCCCCGGAGG + Intergenic
916952473 1:169794904-169794926 CAGTGAGTCGAGTCCTCCAGGGG + Exonic
917683530 1:177392330-177392352 CACAGAACCATGGCCCCCAGTGG - Intergenic
919753757 1:201053935-201053957 CACTGAGTCGAGGACCCTGGTGG + Intronic
920914993 1:210252130-210252152 GACTCTGCTGAGGCCCCCAGCGG + Intergenic
921181762 1:212637096-212637118 AACTTACCCAAGGCCCCCAGAGG + Intergenic
924282454 1:242451999-242452021 GACTGAGCCGAAGCCCCCGTGGG - Intronic
1063212435 10:3893074-3893096 CACACAGCAGAGGCCCTCAGAGG - Intergenic
1070880690 10:79850471-79850493 CCCTGAGCCCAGGCCCTCGGTGG - Exonic
1075592530 10:123703113-123703135 CCCTGAACCGAGGCCCAGAGAGG + Intergenic
1076426951 10:130373676-130373698 CACTGAGCCCAGGCCCTCCATGG - Intergenic
1076847156 10:133074959-133074981 CCCTGAGCCAAGGTCCCCACGGG - Intronic
1076848830 10:133083020-133083042 CACTCAGCAGAGCCCCCGAGAGG - Intronic
1077168400 11:1153879-1153901 GCCTGAGCCCAGGCCCCAAGAGG + Intergenic
1079231104 11:18649505-18649527 CAGTGAGCCAAGGCCACCACTGG + Intergenic
1079689796 11:23405199-23405221 CACTGAGCCCAGGTAGCCAGTGG - Intergenic
1084172135 11:67405827-67405849 GCCTGGGCAGAGGCCCCCAGAGG + Intronic
1084312718 11:68326212-68326234 GACAAAGCAGAGGCCCCCAGGGG - Intronic
1084874796 11:72123355-72123377 TACAGAGCCAAGGTCCCCAGAGG - Intronic
1085197677 11:74682298-74682320 CAGTGAGCCTGGGCCCCCATCGG + Intergenic
1089752134 11:120659531-120659553 CACTGAGCCGAGACACAGAGGGG + Intronic
1092865515 12:12757309-12757331 CAGTGGGCCGATACCCCCAGAGG - Intronic
1093179204 12:15949051-15949073 CTCTGAGACGAAGCTCCCAGAGG - Intronic
1094851703 12:34385200-34385222 CTGTGGGCCGAGGCCCTCAGTGG + Intergenic
1097016681 12:55992310-55992332 CACTGAGCCCTGGCTCCCAAGGG + Exonic
1097214654 12:57401282-57401304 CACCGAGCCCAGGCCTCAAGAGG + Intronic
1099313881 12:81061597-81061619 CACTGAGACGAAACCTCCAGAGG - Intronic
1101907753 12:108840241-108840263 CACTGCGCCCAGCCCCCGAGAGG - Intronic
1102503839 12:113371612-113371634 CACTGAGGCAAGGCCACAAGTGG + Intronic
1102964971 12:117118865-117118887 CAAAGAGCAGAGGCCCACAGGGG - Intergenic
1103239916 12:119404502-119404524 CTCTGAGCTGGGACCCCCAGAGG + Intronic
1103910295 12:124348441-124348463 CTCACAGCCGAGGCCTCCAGAGG + Intronic
1104972141 12:132535690-132535712 CACTGAGCAGAGACCCAGAGGGG + Intronic
1104972539 12:132538464-132538486 CACTGAGTGGGGGCCTCCAGTGG + Intronic
1109599197 13:64601019-64601041 CACTGAGCCGGGGCCCCAACAGG - Intergenic
1111337960 13:86846889-86846911 CACTGGGGAGAGGCTCCCAGAGG + Intergenic
1112392362 13:98997241-98997263 CACTGAGCTGTGGCCCTCTGTGG + Intronic
1112475906 13:99730591-99730613 CTCTGAGCAGAGGACTCCAGAGG + Intronic
1113896017 13:113764955-113764977 CACTGCACCGAGGCGGCCAGTGG - Intronic
1114988577 14:28261473-28261495 CACTGAGAGGAAGCTCCCAGGGG + Intergenic
1115754088 14:36516707-36516729 CGCTGAGCCTAGGCGGCCAGAGG + Exonic
1117358511 14:54948794-54948816 CTCTGAGACGAGGCTTCCAGAGG + Intronic
1119520497 14:75281019-75281041 CCCTGAGCCCAAGCCCTCAGTGG + Exonic
1120888355 14:89469646-89469668 CACTGGGGCAAGGCACCCAGAGG - Intronic
1121776190 14:96592690-96592712 CACTGAGCCGAGGGCCGGCGCGG - Intergenic
1122410780 14:101525277-101525299 CACTTTGCAGAGGCCCCAAGAGG + Intergenic
1122441879 14:101737517-101737539 CACTGGGAGGAGACCCCCAGTGG - Intergenic
1122662308 14:103305257-103305279 CATTGAGCCAAGACCCCCACCGG - Intergenic
1122818336 14:104326412-104326434 CACTGAGACCTGGACCCCAGAGG - Intergenic
1122927896 14:104917208-104917230 CACTGAGGCGAGACCCTCACCGG - Intergenic
1122999661 14:105286522-105286544 CACTGAGCCAGGAACCCCAGTGG + Intronic
1124104286 15:26722853-26722875 AGCTGAGCAGAGGCACCCAGTGG - Intronic
1126113080 15:45187064-45187086 CACTGAGCCGCTGCTTCCAGAGG + Intronic
1129796453 15:78381303-78381325 CTCTGAGACGAGGCTTCCAGAGG - Intergenic
1130232682 15:82108820-82108842 CACTCAACTGAGGACCCCAGAGG + Intergenic
1130938290 15:88488324-88488346 CCCTGAGCCGGGGCCCACACAGG - Intergenic
1132838210 16:1965244-1965266 CGGTGAGCTGAGGCCCCCGGGGG - Intergenic
1132995057 16:2818421-2818443 CATTGAGCCAAGGCCTCCAGGGG - Intronic
1136288373 16:29257548-29257570 CTCTGGGCCTGGGCCCCCAGAGG + Intergenic
1136714480 16:32266138-32266160 CACTGAGCAGAGGCCCATACTGG + Intergenic
1136753409 16:32663277-32663299 CACTGAGCAGAGGCCCATACTGG - Intergenic
1136814704 16:33207088-33207110 CACTGAGCAGAGGCCCATACTGG + Intronic
1136821180 16:33317168-33317190 CACTGAGCAGAGGCCCATACTGG + Intergenic
1136827743 16:33373707-33373729 CACTGAGCAGAGGCCCATACTGG + Intergenic
1136832809 16:33472478-33472500 CACTGAGCAGAGGCCCATACTGG + Intergenic
1137554701 16:49463255-49463277 CACTGAGGTGAGGCCCCCTCTGG - Intergenic
1137673480 16:50292417-50292439 CACAGAGCCCAGGGCCCGAGGGG - Intronic
1137691331 16:50430091-50430113 GACAGAGCCCAGGCCCTCAGGGG - Intergenic
1138638612 16:58364380-58364402 CAATGTGCACAGGCCCCCAGTGG + Intronic
1139494100 16:67303406-67303428 CACTGACCCAGGGGCCCCAGAGG + Intronic
1139997282 16:70992792-70992814 CTCTGAGCAGAGGAACCCAGGGG + Intronic
1142094054 16:88230331-88230353 CTCTGGGCCTGGGCCCCCAGAGG + Intergenic
1202993280 16_KI270728v1_random:30062-30084 CACTGAGCAGAGGCCCATACTGG + Intergenic
1203055570 16_KI270728v1_random:923631-923653 CACTGAGCAGAGGCCCATACTGG - Intergenic
1142892960 17:2957164-2957186 CATTGAACCGAGGCCTCCAGGGG - Intronic
1144303303 17:13943969-13943991 CTCTGAGCCGAGTCAACCAGTGG - Intergenic
1144872087 17:18377896-18377918 GACTGAGCAAAGGCTCCCAGGGG + Exonic
1145249630 17:21290048-21290070 CACTGTGCTGATGCCCCCAAGGG + Intronic
1146056213 17:29582594-29582616 CACTGAGCCCTGGGCCCCAAAGG - Intronic
1146370738 17:32264489-32264511 CACAGACCCCAGGGCCCCAGCGG + Intergenic
1146453930 17:32995106-32995128 CACTGAGCAGATGCTCCCGGAGG - Intronic
1147140625 17:38458740-38458762 CACTGAGCTGTGGCCAGCAGGGG - Intronic
1148133644 17:45277646-45277668 AACTGAGCTGAGGCACCCCGGGG + Intronic
1150565029 17:66331191-66331213 CACTGAGATGAGGCCATCAGAGG - Intronic
1151361741 17:73593188-73593210 CACTGAACACAGCCCCCCAGTGG - Intronic
1151653047 17:75481696-75481718 CAGTGAGACGAGGCAGCCAGGGG + Intronic
1152567860 17:81108141-81108163 CAGGGAGCCGAGGCCCCCGCAGG - Intronic
1152572513 17:81127007-81127029 CACTGAGCCGAGGCTGTCTGTGG - Intronic
1152757427 17:82092812-82092834 CACTGAGCCGAGCCCTCCGCAGG - Exonic
1152816388 17:82410562-82410584 CACTCAGCAGCAGCCCCCAGAGG + Intronic
1153515310 18:5895857-5895879 GTCTGAGCCGCGGGCCCCAGAGG + Exonic
1155051722 18:22153954-22153976 TACTGAGCCATTGCCCCCAGGGG - Intergenic
1159018991 18:63127586-63127608 AACTGAGCCGGGGCCCTCACTGG - Exonic
1160844543 19:1160585-1160607 CAGTGAGCCGAGACCCCCAGTGG - Intronic
1160853944 19:1207533-1207555 CAAGGAGCAGAGGCGCCCAGTGG + Intronic
1160880867 19:1319384-1319406 GGCTGAGCCGAGGCCCCGCGTGG - Intergenic
1161299107 19:3534363-3534385 CACTGTCCCGAGGCACCTAGAGG + Intronic
1162906271 19:13825906-13825928 CACTCAGGCCACGCCCCCAGAGG - Intronic
1162914270 19:13865714-13865736 CCCGGAGCCGGGGCCGCCAGGGG + Intronic
1163152907 19:15425362-15425384 CACTGAGCCCAGGTAGCCAGTGG + Exonic
1165060333 19:33202017-33202039 CAAGAAGCTGAGGCCCCCAGAGG + Intronic
1165138590 19:33686050-33686072 CACAGAGCTGAGGGTCCCAGAGG + Intronic
1165947134 19:39450427-39450449 CACTGCGCCCAGGCCCAGAGGGG + Intronic
1168589250 19:57619004-57619026 AGCTGAGCCTAGGCACCCAGGGG - Intronic
927890178 2:26743264-26743286 AAGTCAGCCGAGGTCCCCAGGGG + Intergenic
928262367 2:29779306-29779328 CACTCAGCCCAGGCCCCAGGTGG - Intronic
928310444 2:30205149-30205171 CACTGATTTGAGGCCCCCAAGGG - Intergenic
929588017 2:43128131-43128153 CACTTGTCCGAGGTCCCCAGTGG + Intergenic
931517558 2:63058972-63058994 GACTCAGCAGAGGCCCACAGGGG + Intergenic
932434460 2:71695043-71695065 AGGGGAGCCGAGGCCCCCAGGGG + Intergenic
934951469 2:98578604-98578626 CACTGAGCCCAGACCCGCAAGGG + Intronic
937991507 2:127664687-127664709 CACTGAGGTGAGGTCCACAGTGG + Intronic
938105986 2:128530189-128530211 CTCTGTGCCCAGGCCGCCAGGGG + Intergenic
944062404 2:195583382-195583404 GACTGTGCCCAGGCCCTCAGGGG - Intronic
946194410 2:218024539-218024561 CACTGAGCTGAGGCCATCTGTGG - Intergenic
946300512 2:218821110-218821132 CACAGAGCAGAGCCACCCAGAGG + Intergenic
947612470 2:231532535-231532557 CACTGTGCAGAGGGCCCTAGGGG + Intergenic
948662755 2:239516989-239517011 CACTGTCCTGAGGCCTCCAGAGG + Intergenic
948722999 2:239913058-239913080 CACTCAGCAGTGGCCCCGAGTGG - Intronic
948751774 2:240137176-240137198 CACTCAGCCGAGGCCCCTAGAGG + Intergenic
948753030 2:240143437-240143459 CTCTGAGGTCAGGCCCCCAGGGG - Intronic
1168765692 20:380752-380774 CACTGACCAGACGCCCCTAGGGG + Exonic
1170446595 20:16434314-16434336 CATTGAGCCGAGTCCTCCTGTGG - Intronic
1172848723 20:37945215-37945237 CACTGAGCTGCGGCAGCCAGAGG - Exonic
1173254893 20:41387277-41387299 CTCTGAGCAGGGGCTCCCAGGGG + Intergenic
1173556471 20:43969659-43969681 CAGTGAGCAGAGGCCCTGAGTGG - Intronic
1173918316 20:46725851-46725873 CACTGCGCCAAGCCCCACAGAGG - Exonic
1175460679 20:59149857-59149879 ATCTGAGCCGAGGCCCTGAGGGG + Intergenic
1175581269 20:60101814-60101836 CACTGAACTGAGCCCCCCACAGG - Intergenic
1175645784 20:60670324-60670346 CACCCAGTCGATGCCCCCAGTGG - Intergenic
1175774830 20:61646524-61646546 CAATGAGCTGAGGCCCAGAGGGG - Intronic
1176422344 21:6526363-6526385 CCCTGAGCTGAGGCTGCCAGGGG + Intergenic
1179697835 21:43134679-43134701 CCCTGAGCTGAGGCTGCCAGGGG + Intergenic
1180609451 22:17085794-17085816 CCCTCACCCGCGGCCCCCAGAGG + Intronic
1181306476 22:21920016-21920038 CTCTGAGCCCAGGCCTGCAGGGG - Exonic
1182698497 22:32212162-32212184 CAATGAGCAGATGCCACCAGGGG + Intergenic
1182989843 22:34756913-34756935 CACTGTGCAGAGCCTCCCAGAGG + Intergenic
1183780194 22:39994739-39994761 CCCTGAGGGGACGCCCCCAGGGG - Intergenic
1184679401 22:46062021-46062043 CACAGGGCCCAGGCCCGCAGCGG - Intronic
1184807242 22:46803094-46803116 CACAGAGTGAAGGCCCCCAGTGG - Intronic
1185064254 22:48622852-48622874 CACACAGCCGAGACCTCCAGGGG - Intronic
1185220046 22:49624645-49624667 CGCTGAGCCCAGGCCACCAACGG - Exonic
950422213 3:12905829-12905851 CACTGACCAGTGGCCCCCAGCGG - Intronic
951362619 3:21742539-21742561 AACTGAGCCGAGGCCGACTGAGG - Intronic
952882817 3:37995841-37995863 CACTGAGGTGAGGCTGCCAGGGG + Exonic
953013710 3:39052431-39052453 GTCGGAGCCGAGGCCTCCAGGGG + Intronic
954724624 3:52597067-52597089 AACTCAGCCGATGCCCACAGAGG - Intronic
958045390 3:88278494-88278516 CCTTGAGCCAAGGCCCACAGTGG - Intergenic
959505443 3:107151820-107151842 GAGTGAGCCAAGGCCCCAAGAGG - Intergenic
961215687 3:125158507-125158529 CACAGTGCCTGGGCCCCCAGTGG + Intronic
961636216 3:128334809-128334831 CCCTGAGCCTAGCTCCCCAGAGG - Intronic
964349695 3:155790738-155790760 AACTGAGCCGGGGCCCACAGAGG + Intronic
969843504 4:9901132-9901154 GACTGAGCTCAGGCCCCCAGGGG + Intronic
970981484 4:22103813-22103835 CTCAGAGCCAAGGCTCCCAGAGG - Intergenic
971204480 4:24550552-24550574 CACTTAACCTAGGCCCCCACAGG + Intronic
972173653 4:36377271-36377293 CACTGAGACGAAGCTTCCAGAGG + Intergenic
975166708 4:71186575-71186597 CACAGAGCCCAAGCCCCCGGCGG + Intergenic
977295538 4:95204927-95204949 TACTGAACCTATGCCCCCAGAGG + Intronic
981652926 4:147079447-147079469 CACTGGGCAGAGACCCTCAGTGG + Intergenic
982579766 4:157162688-157162710 CACTGAGACGAACCCTCCAGAGG - Intronic
983331302 4:166333087-166333109 CACTGGGCCGAAGCTTCCAGAGG - Intergenic
985150934 4:186946352-186946374 CACTGAGCAGAGGTCACCTGCGG + Intergenic
985318980 4:188687857-188687879 CACTGAGCCGATAGCCCCAGCGG - Intergenic
985650351 5:1104656-1104678 CACAGAGCCGAGGCCCACCGGGG + Intronic
985728164 5:1526447-1526469 CAAGGAGCGGAGGTCCCCAGAGG + Intergenic
986308560 5:6533535-6533557 CACTGAGCCCTGGCTCCCACGGG - Intergenic
988919541 5:35927607-35927629 CACTGAGACCAGTCCCCCATAGG + Intronic
991017355 5:61946145-61946167 CTCTGGGCCAATGCCCCCAGTGG - Intergenic
995565951 5:113433428-113433450 CACTGAGCCGTTGCGGCCAGTGG + Exonic
996523310 5:124450991-124451013 CAGTGAGAAGAGGCCACCAGGGG - Intergenic
998001501 5:138629543-138629565 CACTGAACTGTGGCCCACAGTGG - Intronic
999263810 5:150253619-150253641 CTGTGAGCCCAGGCCCCTAGAGG - Intronic
1000000688 5:157136060-157136082 CACTGTGCCTGGCCCCCCAGTGG + Intronic
1000483822 5:161813467-161813489 CACTGCGCTGAGCCCCCCACAGG + Intergenic
1001928748 5:175658174-175658196 CCCCGAGCCGAGGCCCCGCGGGG - Intronic
1003624287 6:7727823-7727845 CTGCGCGCCGAGGCCCCCAGAGG + Intronic
1004501175 6:16211477-16211499 CACTGCGCCCAGCCACCCAGGGG - Intergenic
1011746964 6:90415358-90415380 CACTGAGCTGGGGGCCCCATTGG + Intergenic
1015832984 6:137389667-137389689 CTCTGAGCCATGGCTCCCAGTGG + Intergenic
1016003644 6:139067466-139067488 CACTGAGCGGTGGCCCTCATGGG + Intergenic
1018823888 6:167394972-167394994 CACAGAGGAGAGGCCCGCAGAGG + Intergenic
1018963171 6:168463129-168463151 CAGTGAGCCTGAGCCCCCAGTGG - Intronic
1019225608 6:170505138-170505160 CACTGATCCCAGGGCCACAGGGG - Intergenic
1020111670 7:5451277-5451299 GACTGAGCAGAGGGACCCAGAGG - Intronic
1024099529 7:46015911-46015933 CACTGAGCCTGAGCCCCTAGGGG + Intergenic
1024716865 7:52088634-52088656 CCCGGAGCCAAGGCCCCGAGAGG + Intergenic
1026362966 7:69619641-69619663 CATGGAGCCAAGGCCCACAGAGG - Intronic
1029788862 7:102821305-102821327 CACTGGGCCCAGGCCTGCAGGGG - Intronic
1032913394 7:136459673-136459695 TACTGAGCTGAGGCCCAGAGAGG + Intergenic
1034238550 7:149591910-149591932 CTCTGAGCCCAGGCCCACCGGGG - Intergenic
1034417171 7:150971302-150971324 CACTGTGCCCAGGGCCTCAGAGG - Intronic
1034452212 7:151143092-151143114 CACTGAAGGGAGGCCCCCTGGGG - Intronic
1037679722 8:21086835-21086857 CACTGACCCCAGGCCCTCTGTGG - Intergenic
1037804377 8:22050825-22050847 CACTGGGCAGAGGCGCCGAGAGG - Intronic
1039344768 8:36691651-36691673 CACTGAGGCAAGGTTCCCAGAGG - Intergenic
1039685899 8:39801660-39801682 CCCTGAGCCTGAGCCCCCAGGGG - Intronic
1040431674 8:47349330-47349352 CTCTGAGACGAAGCTCCCAGAGG - Intronic
1044115410 8:88328226-88328248 CACCGACCCGAGCCACCCAGGGG - Intergenic
1045794259 8:106024091-106024113 CTCTGAGACGAAGCTCCCAGAGG + Intergenic
1046140466 8:110083781-110083803 CACTCAGAGGAGACCCCCAGTGG - Intergenic
1049585074 8:143429271-143429293 GTCCGAGCCGAGGCCCCGAGAGG + Exonic
1049592432 8:143468728-143468750 CCCTTAGTCGAGGCCCTCAGGGG + Intronic
1049651242 8:143771019-143771041 CGCGGAGCCCAGGGCCCCAGAGG - Intergenic
1050478205 9:6063006-6063028 CTCTGAGACGAAGCTCCCAGAGG - Intergenic
1051138438 9:13950811-13950833 AACTGAGCTGAAGCCTCCAGAGG - Intergenic
1053123558 9:35562588-35562610 CACTGAGCCAAGGCATCCTGGGG + Intronic
1056958382 9:91101008-91101030 CACTGACCCGAGGCCCCTTCCGG - Intergenic
1057385444 9:94602328-94602350 CACTGCGCCCAGCCACCCAGTGG - Intergenic
1059308525 9:113373139-113373161 CACTGACCCCAGGCTTCCAGAGG + Intergenic
1059394700 9:114027163-114027185 TTCTGAGCCGAGGGCCTCAGAGG - Intronic
1060822904 9:126671811-126671833 CCCACAGCCCAGGCCCCCAGCGG + Intronic
1062384440 9:136303609-136303631 CACAGAGCCGCTGCCTCCAGCGG + Intronic
1062523723 9:136969980-136970002 CACAGCGCCAGGGCCCCCAGAGG + Exonic
1187857729 X:23653299-23653321 CACTGAGGCAAGTCACCCAGAGG - Intergenic
1190753595 X:53382176-53382198 GACTGAACTGAGGCCACCAGAGG - Intronic
1192196770 X:69033933-69033955 CTCTCAGCCCAGGGCCCCAGAGG - Intergenic
1193384771 X:80857120-80857142 CATTGAGCTGAGGCCCCTGGAGG + Intergenic
1194063072 X:89228178-89228200 CACTGAGGCCATGCCACCAGTGG - Intergenic
1195107620 X:101616350-101616372 CACTGAGGACAGGCCCTCAGGGG - Exonic
1197413819 X:126150625-126150647 CACTGGGCAGAGGCTCCCTGTGG - Intergenic
1197774189 X:130109535-130109557 CGCTGAGCCGAGGTGCCAAGGGG + Intronic
1198394160 X:136206335-136206357 CCCTGAGCAGTGGCTCCCAGAGG - Intronic
1199990109 X:152982804-152982826 CCCTGAGCCATGGGCCCCAGAGG - Intergenic
1200033274 X:153312940-153312962 CCCTGAGCCATGGGCCCCAGAGG - Intergenic
1200137700 X:153883065-153883087 CACTCAGACAAGGCCCCCATGGG + Intronic