ID: 901068830

View in Genome Browser
Species Human (GRCh38)
Location 1:6507383-6507405
Sequence ATTTCTGAAGGGCTGCCCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 213
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 186}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901068830_901068833 -9 Left 901068830 1:6507383-6507405 CCATGGGGCAGCCCTTCAGAAAT 0: 1
1: 0
2: 1
3: 25
4: 186
Right 901068833 1:6507397-6507419 TTCAGAAATCCAGACTTGAACGG 0: 1
1: 0
2: 2
3: 27
4: 247
901068830_901068834 -8 Left 901068830 1:6507383-6507405 CCATGGGGCAGCCCTTCAGAAAT 0: 1
1: 0
2: 1
3: 25
4: 186
Right 901068834 1:6507398-6507420 TCAGAAATCCAGACTTGAACGGG 0: 1
1: 0
2: 1
3: 16
4: 169
901068830_901068838 0 Left 901068830 1:6507383-6507405 CCATGGGGCAGCCCTTCAGAAAT 0: 1
1: 0
2: 1
3: 25
4: 186
Right 901068838 1:6507406-6507428 CCAGACTTGAACGGGGCCAAGGG 0: 1
1: 0
2: 0
3: 5
4: 76
901068830_901068836 -1 Left 901068830 1:6507383-6507405 CCATGGGGCAGCCCTTCAGAAAT 0: 1
1: 0
2: 1
3: 25
4: 186
Right 901068836 1:6507405-6507427 TCCAGACTTGAACGGGGCCAAGG 0: 1
1: 0
2: 1
3: 4
4: 77
901068830_901068840 14 Left 901068830 1:6507383-6507405 CCATGGGGCAGCCCTTCAGAAAT 0: 1
1: 0
2: 1
3: 25
4: 186
Right 901068840 1:6507420-6507442 GGCCAAGGGCAGCTTGCACTGGG 0: 1
1: 0
2: 2
3: 13
4: 166
901068830_901068839 13 Left 901068830 1:6507383-6507405 CCATGGGGCAGCCCTTCAGAAAT 0: 1
1: 0
2: 1
3: 25
4: 186
Right 901068839 1:6507419-6507441 GGGCCAAGGGCAGCTTGCACTGG 0: 1
1: 0
2: 1
3: 22
4: 221
901068830_901068842 27 Left 901068830 1:6507383-6507405 CCATGGGGCAGCCCTTCAGAAAT 0: 1
1: 0
2: 1
3: 25
4: 186
Right 901068842 1:6507433-6507455 TTGCACTGGGCTCCCCAGCCAGG 0: 1
1: 0
2: 0
3: 40
4: 466
901068830_901068835 -7 Left 901068830 1:6507383-6507405 CCATGGGGCAGCCCTTCAGAAAT 0: 1
1: 0
2: 1
3: 25
4: 186
Right 901068835 1:6507399-6507421 CAGAAATCCAGACTTGAACGGGG 0: 1
1: 0
2: 0
3: 5
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901068830 Original CRISPR ATTTCTGAAGGGCTGCCCCA TGG (reversed) Intronic
900913070 1:5615868-5615890 ATTTCTGCTCGGCAGCCCCAGGG - Intergenic
901068830 1:6507383-6507405 ATTTCTGAAGGGCTGCCCCATGG - Intronic
901130326 1:6958504-6958526 ATTTCTGGAGCGCATCCCCAGGG + Intronic
905797229 1:40822619-40822641 ATTGGTGAAGCCCTGCCCCATGG + Intronic
906210067 1:44007817-44007839 ATTTCTGACGGCCTTCCTCACGG + Intronic
906256689 1:44355789-44355811 ATTTGTGAAGGGCCGTCCTAAGG + Intergenic
910765522 1:90778690-90778712 ATTAGTCAAGGGTTGCCCCAGGG - Intergenic
912048345 1:105490009-105490031 ATTTGTGAAAGAATGCCCCAAGG - Intergenic
913093443 1:115495304-115495326 TTATCTGAAGAGCTGCCCCCAGG + Intergenic
917084590 1:171292854-171292876 ATTTTTTATGGGTTGCCCCAAGG + Intergenic
917487579 1:175468852-175468874 ATTTCTGAAGGGCTCTCATAAGG + Intronic
920272529 1:204776856-204776878 ACTTTGGAAGGGCTACCCCAAGG + Intergenic
921314159 1:213874904-213874926 ATAGATGAAGGGCTGCCCCGGGG - Intergenic
922619858 1:226982875-226982897 TTTTCTGAAGGGCAGGGCCAGGG - Exonic
923535948 1:234851954-234851976 ATCTGTTAAGGGCTGCCCCAGGG - Intergenic
924611814 1:245579896-245579918 ATTTCTGAAGGTTTCCCCCTTGG + Intronic
1063465112 10:6238119-6238141 ATTTCTCAGGGACTGCGCCAGGG - Intergenic
1063649456 10:7918614-7918636 ATGTCTGGAGGCCTGCCCCCTGG - Intronic
1065187729 10:23185283-23185305 ATCTCTGGAGGGCTCCTCCAGGG + Intergenic
1065741463 10:28800756-28800778 AATTCAGCAGGGCTGCCCCTTGG + Intergenic
1065856427 10:29834286-29834308 ATATTTGAAGGGCTGTCACAGGG + Intergenic
1068950463 10:62771289-62771311 ATTTCTGAAGTGCTATGCCAAGG - Intergenic
1069681063 10:70285527-70285549 ACCTCTGAAGGGCTGCCCTAGGG - Intergenic
1070580084 10:77712399-77712421 ATTTCTCTAGGGCCTCCCCATGG - Intergenic
1070667844 10:78358136-78358158 ATTTCTGTAGGAGAGCCCCATGG - Intergenic
1071253119 10:83841210-83841232 ATTTCTGAAGACCTGCATCATGG + Intergenic
1071911219 10:90236180-90236202 AATTCTGAAGGGTTGCTACAAGG + Intergenic
1073564903 10:104526639-104526661 CCTTCTGCAGGGCTGCACCATGG - Intergenic
1074180733 10:111060333-111060355 GTTTCTGCAGGGGTGACCCATGG - Intergenic
1074784355 10:116826009-116826031 ATGTGTGAAGGGCTGTCACATGG + Intergenic
1075541710 10:123319179-123319201 ATTTCTGAATGACAGCCCGAGGG + Intergenic
1076906805 10:133366643-133366665 GTTTCTGTGGGGCTCCCCCATGG + Intronic
1078270199 11:9788025-9788047 ATTTCCCATGGGCTGCCCAAGGG - Intronic
1083300364 11:61736925-61736947 AAATCAGAAGGGCTTCCCCAAGG + Intronic
1083937904 11:65879980-65880002 GTTTCTGAAGGGGTGACCCCAGG - Intronic
1085284376 11:75350535-75350557 CTGTCTGAAGGGCTGCCCCCAGG + Intronic
1085733247 11:79017325-79017347 ATTTCTGCAGGGCTTTTCCAGGG + Intronic
1088736075 11:112728797-112728819 GTTGCTGCAGGGCTGGCCCAGGG - Intergenic
1088784569 11:113169422-113169444 ATTTTTGAGGAGCTGCCACAGGG - Intronic
1091391627 12:129586-129608 ATTCCTAAAGGGCTCCCCAAAGG - Intronic
1092249369 12:6884079-6884101 GCTTCTGCAGGTCTGCCCCATGG - Intronic
1093075703 12:14756432-14756454 CTCTCAGAAGAGCTGCCCCACGG - Intergenic
1094024318 12:25946412-25946434 ATTTCTCCAGGAATGCCCCATGG + Intergenic
1094097484 12:26723515-26723537 ATTTATGAAGGATTGCCCCAGGG + Intronic
1097036081 12:56125154-56125176 ATATTTGAAGGGCTGCCCAGTGG + Exonic
1098011248 12:66054810-66054832 ATTTCTGAATGGGTGACCTAGGG - Intergenic
1102147032 12:110661755-110661777 ATACCGGAAGGGCGGCCCCAAGG + Intronic
1102623009 12:114211661-114211683 ATTGGTTAAGGGCTGCCCCATGG + Intergenic
1103322525 12:120100306-120100328 ATCTCTGAAAGGCTGGCCCTTGG + Intronic
1103597815 12:122034883-122034905 CTTTGAGAAAGGCTGCCCCAGGG + Intronic
1103745735 12:123122148-123122170 ATTTCTAAAGAGATTCCCCAGGG - Intronic
1104914611 12:132258165-132258187 ATCTCTGAAGGGCTGCCCAGGGG + Intronic
1104944987 12:132411830-132411852 AAAACTGAAGTGCTGCCCCACGG + Intergenic
1105846876 13:24301019-24301041 ATTTTTGAACAGCTTCCCCAGGG - Intronic
1106116411 13:26821438-26821460 ATGTCTGAAGGGCTGTATCAAGG + Intergenic
1106118380 13:26837100-26837122 GTTTCTGAAGGGCTAGTCCAAGG - Intergenic
1106769708 13:32950162-32950184 ATGTCTGCTGGGCTGCTCCAGGG + Intergenic
1108072315 13:46641088-46641110 AGTTCTGAATGTGTGCCCCATGG + Intronic
1108619585 13:52168302-52168324 TTTCCTCAAAGGCTGCCCCATGG + Intergenic
1109665840 13:65535418-65535440 AATTTTGAAGGGCTGCTCCATGG + Intergenic
1110728055 13:78849159-78849181 ATTTCTGCAGGGCTGCAGCGGGG - Intergenic
1113829942 13:113287847-113287869 TTTTCTGAAGGCCAGCACCAAGG + Intergenic
1119459848 14:74791586-74791608 ATTACTGAAGTGCTGCCCCAGGG - Intronic
1119849420 14:77856487-77856509 AGTTCTGAAGGGGAGTCCCATGG + Intronic
1120824280 14:88941322-88941344 ATTCCTCAAGGGCTTCCTCAAGG + Intergenic
1122043681 14:99008408-99008430 ATGTCCAAAGGGCTGCCCCTTGG + Intergenic
1124150343 15:27172293-27172315 ATTTCAAAAGGGCTACTCCAAGG - Intronic
1124384847 15:29198323-29198345 AGTTCTGCAGGGGTGCTCCACGG - Intronic
1124578273 15:30928125-30928147 ATTTCTTCAGGGGTGGCCCAGGG + Intronic
1126430787 15:48581947-48581969 AAATATGAAGGGTTGCCCCAAGG + Intronic
1126928254 15:53615948-53615970 ATTACTGAAAGCCTGGCCCAAGG - Exonic
1128556849 15:68637686-68637708 TATCCTGATGGGCTGCCCCATGG + Intronic
1129517894 15:76167944-76167966 ATGTTAGAAGGGCTGGCCCAGGG + Intronic
1131682634 15:94740025-94740047 ATCACTGATAGGCTGCCCCAAGG + Intergenic
1132507316 16:317576-317598 ATTTCCCAAGAGCGGCCCCATGG - Intronic
1135488402 16:22885933-22885955 ATTTCTGATGGCCTGACCCTTGG - Intronic
1136654909 16:31703844-31703866 CTTCCTGAAGGGGTGCTCCAGGG - Intergenic
1137486325 16:48894464-48894486 ATTGCTGCAGGTTTGCCCCATGG - Intergenic
1138413682 16:56859001-56859023 GTTTCTGAAAAGCTGGCCCAGGG - Intergenic
1139893954 16:70273314-70273336 ATTTGTGAAGTGCTGCATCAAGG - Intronic
1142436215 16:90059461-90059483 AGCTCTGAAGGGATGACCCATGG + Intronic
1142486621 17:251681-251703 ATCTCTGAAGAGCTGCTGCAAGG + Intronic
1143373303 17:6453801-6453823 ATTTCAGCCAGGCTGCCCCAGGG - Exonic
1144208740 17:12997302-12997324 ATTTCAGAAGCTCTGCTCCAAGG + Intronic
1146840973 17:36153941-36153963 ATTTCTGAAGTGCTCCACCCTGG - Intergenic
1147193561 17:38750255-38750277 AATCCTGGAGGGCTGCCCGAGGG + Exonic
1149387208 17:56154052-56154074 ATCTCTGAAGAGCTGAGCCAGGG + Intronic
1149858557 17:60107027-60107049 ATTTCTGAAGTGCTCCACCCTGG + Intergenic
1150027062 17:61687867-61687889 TTTTCTGGGAGGCTGCCCCAGGG + Intronic
1153212509 18:2783316-2783338 CTTTGAGAAGGGCTGTCCCAGGG + Intronic
1153730063 18:8002124-8002146 ATTTATGAAGCACTCCCCCAAGG + Intronic
1153995760 18:10440191-10440213 CTTTCTGCATGGCTGCCCCATGG - Intergenic
1157183243 18:45516462-45516484 ATTTTTCAAGTGCTGCCCCAGGG + Intronic
1157224359 18:45849186-45849208 ATATCTAAAGGTCTGCCTCAAGG + Exonic
1157869551 18:51217654-51217676 AGTTCAGAAGGGCTGCCTCAGGG - Intronic
1159163612 18:64674995-64675017 ATTTCTGAAGCTGTGACCCAGGG - Intergenic
1160445481 18:78924319-78924341 GATTCTGAAGGGCGGCCACAGGG - Intergenic
1161587070 19:5111322-5111344 ATTTCAGAAGGCCGGCCCCGGGG + Intronic
1162561811 19:11421643-11421665 ATCTCTGGAGCTCTGCCCCATGG + Intronic
1163802772 19:19377266-19377288 AATTCTGATGGGCTTCCCAAAGG + Intergenic
1165345713 19:35248088-35248110 ATTTCCGGAGGGCTGACCCGGGG + Intergenic
1166229071 19:41415053-41415075 CCTGCTGAAGGGCTGTCCCAGGG - Intronic
1166407202 19:42529467-42529489 CCTTGTCAAGGGCTGCCCCAGGG + Intronic
1166637611 19:44464770-44464792 CTTCCTGAGGGGCTGCCCTATGG - Intergenic
1167517211 19:49930252-49930274 ATTGCTGAAGGGCTGCGGCCTGG + Intronic
1168544857 19:57241691-57241713 ATGTCTGAAGGGCTGAGCCAGGG - Intronic
927210446 2:20635958-20635980 TCTGCTGAAGGGCTGCTCCACGG - Intronic
928387523 2:30883158-30883180 TGTTCCGAAGGGCTGCCACATGG - Intergenic
929372362 2:41241644-41241666 ATGTCTGTAGGGTTGCCCCTAGG + Intergenic
931943417 2:67278381-67278403 ATTTCTTAAGGGGTTGCCCATGG + Intergenic
932347460 2:71004992-71005014 ATTTCTTCAGGGCTTCCACAGGG + Intergenic
933321685 2:80783283-80783305 ATCTCTGCAGGACTGTCCCAGGG - Intergenic
934900479 2:98155824-98155846 ATTTCTGTAGGGCAGACACAGGG + Intronic
935536088 2:104296263-104296285 ACTTGTGAAGGGATGCCTCAGGG + Intergenic
935591785 2:104851909-104851931 ATTAATGAAAGGCGGCCCCATGG + Intergenic
935667822 2:105527463-105527485 ATCTCTGAAAGGCTGCACCCTGG + Intergenic
936888081 2:117336856-117336878 GTCTCTGAAGTGCTGCCTCAAGG + Intergenic
939061692 2:137430515-137430537 ATTGCCCAAGGGCTGCCCCATGG + Intronic
939647302 2:144716540-144716562 CTTTCAGAAGGGCTGCCCTTTGG - Intergenic
943541963 2:189226782-189226804 CTTTTTGAGGGGCTGCCCAAGGG + Intergenic
945488086 2:210422277-210422299 TTGTTTGGAGGGCTGCCCCAAGG - Intergenic
946438505 2:219675609-219675631 ATTTGTGAAGGGCTGCCTGTGGG + Intergenic
948209402 2:236181389-236181411 ATCTTTTAAGGGCTGCCCAAGGG - Intergenic
1169950506 20:11038178-11038200 ATTTCTGAACCTCTGCCACATGG + Intergenic
1170349046 20:15419281-15419303 ATTGGTAAAGGGCTGCCCCTGGG + Intronic
1170622171 20:18005357-18005379 ATTGCTTAAGTGTTGCCCCAGGG - Intronic
1173017028 20:39234937-39234959 ATTTCAGAAGAGTTGCCACAAGG + Intergenic
1173033125 20:39380622-39380644 CTCTCTGCAGGGCTGCCTCATGG - Intergenic
1173285922 20:41671384-41671406 ACTTGTTAAGGGCTGTCCCAGGG + Intergenic
1173402815 20:42740089-42740111 ATGTCTGAAGGCCAGTCCCAGGG - Intronic
1173442683 20:43092303-43092325 ATTGACCAAGGGCTGCCCCATGG + Intronic
1176908325 21:14531897-14531919 CTTTCTAAAGGTCTGCCCAAGGG + Intronic
1177482985 21:21716463-21716485 ATTTCTGAATAGCTGGCCAACGG - Intergenic
1179620026 21:42608048-42608070 ATTTCCCAAGGGCTGCGTCACGG - Intergenic
1180011481 21:45054278-45054300 ATTTGCGACGGGCTGCCCCAGGG + Intergenic
1180865355 22:19115489-19115511 ATTTTTGCAGGACTGCCACAAGG + Intronic
1183092894 22:35535547-35535569 ATTTCTGTAAGGCAGCTCCATGG + Intergenic
1184394044 22:44222198-44222220 GTCTCTGCAGGGCTGCCCCCTGG + Intergenic
949871911 3:8596293-8596315 ATATCTGAAGGGCTGTCACAAGG + Intergenic
950520795 3:13496673-13496695 ATTTCTCACGGGTTGCCTCAGGG + Intronic
952133969 3:30396398-30396420 ACTTGTGAAGGGTTGCTCCAAGG - Intergenic
952272097 3:31843248-31843270 ATTGATCAAGGGCTGCCCCAAGG - Intronic
952744201 3:36762595-36762617 ATTGAGGAGGGGCTGCCCCAGGG + Intergenic
961011998 3:123442714-123442736 ATTCCTGAAGTCCTCCCCCAGGG + Intronic
961376913 3:126473337-126473359 TTTTCTGAAGGCCTGAGCCAGGG - Intronic
962840633 3:139229472-139229494 AAATGTGAAGCGCTGCCCCAGGG + Intronic
962956912 3:140275051-140275073 ATTGGTTAAGGGCTGCCCCAGGG - Intronic
966203778 3:177384766-177384788 ACTTCTGAAGGGATGCCCGAGGG + Intergenic
969619207 4:8270453-8270475 ATTTCTGAAGGGCCACCCGGTGG - Intronic
970146895 4:13045282-13045304 ATTGACTAAGGGCTGCCCCAGGG + Intergenic
977682200 4:99809033-99809055 ATTTCTGAAGTCCTACCCCAAGG + Intergenic
977848703 4:101798240-101798262 ATTTCTAAAGGGCGTCTCCATGG - Intronic
978555963 4:109980659-109980681 ATTTCAGAAGAGTTCCCCCAAGG - Intronic
979955975 4:126954799-126954821 CTTTCTGATGGCCTGCCCTAAGG + Intergenic
980397836 4:132238738-132238760 TTTTCTGACAGGCTCCCCCAGGG + Intergenic
981665292 4:147217845-147217867 ATTCCTGAAGGGCTGCAAGAAGG + Intergenic
984407902 4:179357230-179357252 ATTTCTGAAGGTCTGCCCTCTGG - Intergenic
985426024 4:189831333-189831355 ATTTCTTAAGGGCTGTCCTGTGG + Intergenic
986325132 5:6667006-6667028 AGTGCTGAAGAGCTTCCCCATGG - Intronic
986355987 5:6926793-6926815 TCTTTTGGAGGGCTGCCCCACGG - Intergenic
987414530 5:17649099-17649121 AGTTCTGAAGGGCAGCAACAAGG + Intergenic
987522608 5:19006025-19006047 ATCTCTGAAGGGTTGCCCTTGGG - Intergenic
988417701 5:30966874-30966896 ATTTTGAAATGGCTGCCCCAGGG - Intergenic
993322196 5:86485545-86485567 ATTTCTGCAGGGCTGACCTTGGG - Intergenic
995433179 5:112105291-112105313 CTTTCTGAAGTGCTGCCTGAAGG + Intergenic
995946337 5:117651242-117651264 AGTTCTGATTGGCTGACCCATGG - Intergenic
998569748 5:143246529-143246551 AATTGTGAAGGGCTGCCGCTGGG - Intergenic
999097321 5:148991541-148991563 ATATCTGAAGGGTTTCCCCCAGG + Intronic
999317147 5:150591391-150591413 CTTCCTGCAGGCCTGCCCCAGGG + Intergenic
999482297 5:151959847-151959869 ACTTCTGAAGGGCTGCCATAGGG + Intergenic
999633602 5:153597304-153597326 ATCTCTGAAGGTCTGTGCCATGG + Intronic
1004339913 6:14799015-14799037 ACTTCTGAAGGACTGCTCCCAGG + Intergenic
1004982390 6:21039976-21039998 ATTTATTAAGGGTTGCACCAGGG - Intronic
1005079455 6:21942218-21942240 ATTTCTGAGTGGCTTCTCCATGG + Intergenic
1007826541 6:44605247-44605269 ATTTATGGAGGACTGCTCCATGG - Intergenic
1015148584 6:130015196-130015218 ATTTGTGAAGGGCTGGCTCATGG + Intronic
1015636964 6:135286577-135286599 ATTCCTGAAGGGCTTTCCCTGGG + Intronic
1015691620 6:135930494-135930516 ATTTCTGCACAGCTGCCCCAGGG - Intronic
1017328473 6:153168379-153168401 ATTTCCAAATGGCTGCTCCAGGG - Intergenic
1017538000 6:155369253-155369275 ATTTAAGAAGAGCTGTCCCAGGG - Intergenic
1017900979 6:158718364-158718386 ATTTGGGCAGGGCTGGCCCAAGG + Intronic
1021405404 7:20261859-20261881 GTTTCTAAAGTGCTTCCCCAGGG + Intergenic
1021607055 7:22418712-22418734 AGTGGTGGAGGGCTGCCCCAGGG - Intergenic
1023079597 7:36514696-36514718 ATTGCTGAAGGCCTGCCAGAGGG + Intronic
1026298546 7:69077571-69077593 ATCTCTAAAAGGCTGCCCCTAGG - Intergenic
1026940301 7:74283903-74283925 ATTCCTGCAGGGCTGCTCCCAGG - Intergenic
1027869182 7:83685011-83685033 AGTTCTGAAGCTCTGCCCGAGGG - Intergenic
1029178083 7:98679389-98679411 CTCTCTAAAGGGCTGCCCCTGGG + Intergenic
1033423110 7:141219959-141219981 TTTTCAGGAGGCCTGCCCCAAGG + Intronic
1033568277 7:142601222-142601244 AGTGCTGAAGTTCTGCCCCAAGG + Intergenic
1035263439 7:157675726-157675748 AGCTCTGAAGCGCTGCCCGAGGG - Intronic
1036137787 8:6178074-6178096 ATTTCAGATGTGCTGCCCAAGGG + Intergenic
1039405028 8:37305195-37305217 ATATCTCAGGGGCTGCCCCATGG - Intergenic
1042740615 8:72040602-72040624 ACTTCTAAGGGGCTGCCCAAGGG + Intronic
1044311209 8:90694940-90694962 ATTTCTCAAGGTCTGCTGCAGGG + Intronic
1047059202 8:121204399-121204421 GTTTCTGGAGGGCTGACACATGG + Intergenic
1049504582 8:142989157-142989179 AGTTCTGTGGGGCTGTCCCACGG + Intergenic
1050063782 9:1737700-1737722 ATTTATTAAGGAGTGCCCCAGGG + Intergenic
1050592750 9:7176777-7176799 ATTTCTGATTGGCTGCCACAGGG + Intergenic
1053440839 9:38115105-38115127 ATCTCTAAAGGGCTGCCCTGGGG + Intergenic
1055796133 9:79976756-79976778 ATTTCTAAATGACAGCCCCAGGG - Intergenic
1057040936 9:91846991-91847013 ATGTCTGCAGCTCTGCCCCATGG - Intronic
1061409186 9:130409410-130409432 AGTTGAGAGGGGCTGCCCCAGGG - Intronic
1186321127 X:8426548-8426570 AGTTCAGAAAGGCTGCTCCAGGG - Intergenic
1189420733 X:40855502-40855524 ATTTGAGAAGCACTGCCCCAGGG - Intergenic
1189617365 X:42797463-42797485 ATCTTTAAAGGGCTGCCTCAAGG - Intergenic
1189698152 X:43687079-43687101 ATGCCTGCAGGGCTGCCACAGGG + Intronic
1190274084 X:48889268-48889290 ATCTCTAAAGGTCTGCCCCTAGG + Intergenic
1190877736 X:54471475-54471497 CTTCCTGCAGGGCTGCACCAGGG - Exonic
1195062576 X:101210674-101210696 ATTTCCAAAGGGCTTCCCCAAGG + Intergenic
1195690192 X:107617862-107617884 CTTCCTGATGGCCTGCCCCACGG - Intergenic
1195707475 X:107748468-107748490 CTTTGGGAAGGGCTGACCCAAGG - Intronic
1198179057 X:134186848-134186870 TATTCTGAAGGTGTGCCCCAGGG - Intergenic