ID: 901071190

View in Genome Browser
Species Human (GRCh38)
Location 1:6519549-6519571
Sequence CTGTGGCATTGGCATGTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 277
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 256}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901071190_901071195 0 Left 901071190 1:6519549-6519571 CCAGCCACATGCCAATGCCACAG 0: 1
1: 0
2: 0
3: 20
4: 256
Right 901071195 1:6519572-6519594 GCCTCTCTAATCAGACACACAGG 0: 1
1: 0
2: 0
3: 14
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901071190 Original CRISPR CTGTGGCATTGGCATGTGGC TGG (reversed) Intronic
900736491 1:4302544-4302566 CTGGGCCACTGCCATGTGGCTGG + Intergenic
900989002 1:6089335-6089357 CTGTGGCAGAGGCATGGGGCAGG - Intronic
901071190 1:6519549-6519571 CTGTGGCATTGGCATGTGGCTGG - Intronic
902204288 1:14856039-14856061 ATGTGACATTGGGATATGGCAGG + Intronic
902395741 1:16131768-16131790 CTTTGGCATTGTCATGTGGGAGG - Exonic
903382888 1:22909102-22909124 CTACGGCATTGTCATGTGGGAGG + Exonic
903609087 1:24596983-24597005 CTGTGGTTCTGGCAGGTGGCTGG + Intronic
903885602 1:26539335-26539357 CTGCGGAACTGGCATTTGGCTGG + Intronic
904970346 1:34414531-34414553 CAGTGGCATTGGCAGGCAGCAGG + Intergenic
907714097 1:56911758-56911780 CTGTGGCAGCTACATGTGGCTGG - Intronic
908508162 1:64826809-64826831 CAGAGGCAGTGACATGTGGCTGG + Intronic
909496695 1:76286687-76286709 CTGAGGCATGGCCATGAGGCCGG - Intronic
911587273 1:99705215-99705237 GTGTGGAATGGGGATGTGGCTGG - Intergenic
912149483 1:106839998-106840020 CTGTGGAACTTGAATGTGGCAGG - Intergenic
912940723 1:114042400-114042422 CTGTGGCATAGGGAGGTGTCAGG + Intergenic
914320060 1:146550690-146550712 CTGTGGCTTTCGCCTGTGGCAGG - Intergenic
914369147 1:147006913-147006935 CTGTGGCACTGGAACATGGCAGG + Intergenic
916579081 1:166091655-166091677 CCGTGGCAATGTCAGGTGGCAGG - Intronic
920515454 1:206581776-206581798 CTGTGGGATTGGAAAGTGGAAGG + Intronic
921176602 1:212600478-212600500 CTGTGGGTCTGGCATGTGCCTGG + Intronic
923262874 1:232284144-232284166 CTGTGGCAAAGACATGTAGCCGG - Intergenic
923525355 1:234768447-234768469 CAGTGGCAATGGCGTGCGGCTGG - Intergenic
923835208 1:237603459-237603481 ATTTGGCATGTGCATGTGGCCGG - Intronic
924802516 1:247337761-247337783 CTGGTGCATTGGAATGTCGCTGG + Intergenic
1063016645 10:2084593-2084615 CTGTGGTGTTGGCATGTGAGAGG + Intergenic
1066658150 10:37713390-37713412 CTGTGGGGTTGGCATTGGGCTGG + Intergenic
1068695049 10:59958857-59958879 TGGTGGTATTGGCTTGTGGCAGG + Exonic
1070585921 10:77766073-77766095 CTGTGGTCTTTGCAAGTGGCTGG + Intergenic
1073693917 10:105844276-105844298 CTGAGCCATTGGCAGGTGCCTGG - Intergenic
1074306078 10:112279714-112279736 CTGGGGCATTGGTATGGGGGCGG + Intergenic
1074571223 10:114626225-114626247 CAGTGGCTTTTGGATGTGGCAGG + Intronic
1076699170 10:132261205-132261227 CTGTGGAGTTGCCAGGTGGCTGG + Intronic
1077217000 11:1399107-1399129 CTGTGGCTCTGGCCTGGGGCGGG - Intronic
1078614312 11:12850857-12850879 CTGTGGCTTGGGGAAGTGGCAGG + Intronic
1079182271 11:18204320-18204342 CAGTGGCAGTGGCATGAGGCAGG - Intronic
1079525316 11:21380025-21380047 CTGTGGCAAGGGCATCTGGGGGG + Intronic
1081389478 11:42512711-42512733 CTGTGGTTTTAGAATGTGGCTGG + Intergenic
1081663330 11:44901930-44901952 CTGCGGAGTTGGCATGTGACTGG + Intronic
1081786595 11:45751899-45751921 CTGTGGCCCTGGCATGTAGTAGG - Intergenic
1082277814 11:50240541-50240563 CTGTGGCATAGTCATCTCGCTGG - Intergenic
1083889378 11:65588369-65588391 CTGAGGCTTTGGCATGAGGCTGG + Intronic
1084805542 11:71576597-71576619 CTGTGGGAATGGCAGGTGGTGGG + Intergenic
1085045557 11:73350960-73350982 ATGGGGCATTGGCTTGTGCCAGG + Intronic
1085474182 11:76779333-76779355 CTGTAGATGTGGCATGTGGCAGG - Intergenic
1085531349 11:77194105-77194127 CTCTGGCACTGGCATGGAGCTGG - Intronic
1088744402 11:112793558-112793580 CAGTGGGATTAGCATCTGGCTGG - Intergenic
1088881174 11:113974856-113974878 CTGTGGCACTGGGCTGGGGCAGG - Intergenic
1089416492 11:118296399-118296421 CTGGGGCATTTGCCTGTGGGAGG + Intergenic
1089559267 11:119335530-119335552 CTGTGCCATTGCCATGAGCCTGG + Exonic
1089774511 11:120826939-120826961 CTGAGGCATGGGCACCTGGCAGG + Intronic
1089781426 11:120875687-120875709 CTGTGTCATTGGCATGGGGGTGG - Intronic
1091447688 12:553431-553453 CTGCTGCACTGGAATGTGGCTGG - Exonic
1091763539 12:3103650-3103672 CTGTGACTTTGGGAAGTGGCTGG + Intronic
1092051334 12:5472761-5472783 CTGTGGCAGAGGGACGTGGCAGG + Intronic
1092186071 12:6479358-6479380 CCGTGGCCTTGTCATCTGGCTGG - Intergenic
1093811192 12:23493954-23493976 CTGTGGCATTACCCTATGGCAGG + Intergenic
1094525213 12:31226824-31226846 CTGGGGCCTTGCCATCTGGCAGG + Intergenic
1095783234 12:46083823-46083845 CTTTGGAATTGGAATGAGGCTGG + Intergenic
1101356028 12:103978303-103978325 TTCTGGCATTGGCATTTGGTTGG + Intronic
1101727229 12:107398148-107398170 CTCTGGCATTGGGTTGGGGCTGG + Intronic
1101738767 12:107483499-107483521 CTGGGGGACTGGCATCTGGCAGG - Intronic
1101944899 12:109129392-109129414 CTGTGTCACTGGCATGTGTGTGG - Intronic
1102407522 12:112686645-112686667 CTGGGGAATTGGCTGGTGGCTGG - Intronic
1103428979 12:120865222-120865244 CAGTGGCATTTTCATGTGGGAGG - Intronic
1103812947 12:123630442-123630464 CTGTGGCAGTGTCCTCTGGCGGG - Exonic
1105216857 13:18292483-18292505 CTGTGGCATGTGCCTGTGTCAGG - Intergenic
1105719533 13:23100328-23100350 TAGTGGCATAGGCATGTGGCAGG - Intergenic
1105851817 13:24341773-24341795 CTGTGGCCCAGGCATGTGGCAGG + Intergenic
1109370588 13:61415468-61415490 CTGTGGACTTGGCATCTGACTGG - Exonic
1110831513 13:80037016-80037038 GTGAGGCAATTGCATGTGGCAGG - Intergenic
1114231360 14:20785863-20785885 CTGTGGCTGAGGCAGGTGGCTGG + Intergenic
1117468720 14:56020456-56020478 CTGTGGCAGTGAAATCTGGCTGG - Intergenic
1119828744 14:77681769-77681791 CTGTGATTTTGGCATGTGTCAGG + Intronic
1122499339 14:102186288-102186310 CTGTGGAATTGGCATCTGTGTGG + Intronic
1122841034 14:104463059-104463081 CTGCGGCCCGGGCATGTGGCAGG + Intergenic
1123029763 14:105446171-105446193 CTGTGTCAGTAGCATGTGGAGGG - Intronic
1125275149 15:37980809-37980831 TTGTTGCATTATCATGTGGCAGG - Intergenic
1125345145 15:38711783-38711805 CTGTGGCCTTGGCTATTGGCAGG + Intergenic
1125690922 15:41595563-41595585 CTATGGCATTTGCATGGTGCTGG + Intergenic
1126226583 15:46277783-46277805 CTGAGGCTTTGTCATGTGTCAGG - Intergenic
1129889976 15:79065531-79065553 CTGGGGCATTGGCAGGAGGAAGG + Intronic
1130231731 15:82102395-82102417 TTGTGGCATTGGGCTGGGGCTGG + Intergenic
1130298876 15:82665519-82665541 CTGTGGCCTTGGCATTAAGCAGG + Exonic
1131130786 15:89898970-89898992 CTGTGGCATAGGCATCTGCATGG - Exonic
1131310502 15:91286188-91286210 CTGTGACATTGGCAAGTGCATGG + Intronic
1133756652 16:8767219-8767241 CTGTGCCATTTGCTTGGGGCTGG + Intronic
1134183084 16:12063188-12063210 CAGGGGCCTTGGCATGTGCCTGG - Intronic
1134817603 16:17218909-17218931 CTGGGGCAGTGGCAGGGGGCAGG + Intronic
1136453669 16:30369041-30369063 CTGTGACATTGGCATGTTAGTGG - Intronic
1137427147 16:48389339-48389361 CTGTGGGTTGGGCATGAGGCAGG - Intronic
1138795422 16:59962611-59962633 CTGTGGCTGTGGTTTGTGGCAGG + Intergenic
1139319479 16:66101846-66101868 ATGGGCCCTTGGCATGTGGCAGG - Intergenic
1139664678 16:68447673-68447695 GGGTGGAATTGGAATGTGGCAGG - Intronic
1140013465 16:71159387-71159409 CTGTGGCTTTCGCCTGTGGCAGG + Intronic
1140411827 16:74745640-74745662 GTGTGGCCTTGGACTGTGGCTGG - Intronic
1141763397 16:86043673-86043695 CTGTGGCATGCACATGTGACTGG + Intergenic
1142475601 17:187258-187280 CTGTGGGATTGGAAAGAGGCCGG + Intergenic
1143615682 17:8047843-8047865 ATGTGGCATTGACAGGTGGGAGG - Exonic
1144125844 17:12202382-12202404 CTGTGGAATTGGCATGTTTTGGG - Intergenic
1144723036 17:17485488-17485510 CAGTGGCAATGGGAGGTGGCTGG + Intronic
1145265844 17:21379273-21379295 CGGAGGCCTTGGCATATGGCTGG + Intronic
1149127653 17:53254862-53254884 TGGTGGCAGTGGCATGGGGCAGG - Intergenic
1151043096 17:70886979-70887001 CTGTGGAATTGTTGTGTGGCTGG + Intergenic
1151153914 17:72111199-72111221 CTGTTGCATTGGCTTGGGGGTGG - Intergenic
1152747870 17:82049554-82049576 AGGTGGGATTTGCATGTGGCTGG - Intronic
1154025195 18:10700875-10700897 CTGGGTCATTGGGTTGTGGCAGG - Intronic
1155784898 18:29884015-29884037 CTGTGTCAGCAGCATGTGGCTGG + Intergenic
1155838230 18:30613764-30613786 CTGTGTCAGGGGCATGAGGCTGG - Intergenic
1156341024 18:36210894-36210916 CTGTGGCAGTGGCATGGGATTGG + Intronic
1156377901 18:36531278-36531300 CTGGGCCATGGTCATGTGGCAGG - Intronic
1157731750 18:50010086-50010108 CTGTGTAATTGGCATTTGGCAGG + Intronic
1157815598 18:50727640-50727662 CTGTGGCATAGGGTTGTGCCAGG + Intronic
1158832102 18:61290786-61290808 CTTTGGGATTGGCTTTTGGCTGG + Intergenic
1161116280 19:2498449-2498471 ATGTGGGTTTGGCATTTGGCAGG + Intergenic
1163068246 19:14815539-14815561 CTGTGGGATTGCCATCTTGCAGG + Intronic
1164281373 19:23771809-23771831 TTGTGTTATTGACATGTGGCTGG + Intronic
1164448699 19:28339949-28339971 CTGTGGCACTGGCATCTGCTTGG - Intergenic
1166148354 19:40852359-40852381 CTGTGACATGAGCATGAGGCAGG + Intronic
1166171369 19:41029668-41029690 CTGTGACATGAGCATGAGGCAGG + Intergenic
1166319137 19:42005723-42005745 CTACGGCATTGGCATGCCGCTGG - Exonic
1166816267 19:45548162-45548184 CAGTGGCAATGGCTTGTAGCTGG - Intronic
1166975625 19:46603472-46603494 CTCTGGCATTGGCTGGGGGCTGG + Intronic
1168448373 19:56443956-56443978 CTGAGGAATTGAAATGTGGCTGG + Intronic
927212896 2:20649638-20649660 ATGTGGCAATGACATGTGGGAGG + Intronic
929883809 2:45860860-45860882 CAGTGGCTTTGGCATGGGGAGGG - Intronic
933912656 2:86956949-86956971 CTGTGTCAGTGGCAAGTGGATGG + Intronic
933969296 2:87457299-87457321 TTGTGGCATTAGGGTGTGGCAGG - Intergenic
934010338 2:87812941-87812963 CTGTGTCAGTGGCAAGTGGATGG - Intronic
934297467 2:91754202-91754224 CTGTGGCATGTGCCTGTGTCAGG + Intergenic
934780457 2:96966532-96966554 CTGTAGCTTCGGGATGTGGCAGG - Intronic
935173534 2:100628870-100628892 CTGAGGGCCTGGCATGTGGCTGG - Intergenic
935236120 2:101139569-101139591 CTGAGGCATGGGCAAGGGGCAGG - Intronic
935673165 2:105572546-105572568 CAGTGGCCTTGGCTTGTGGGTGG + Intergenic
935773905 2:106453661-106453683 CTGTGTCAGTGGCAAGTGGATGG - Intronic
935906158 2:107842252-107842274 CTGTGTCAGTGGCAAGTGGATGG + Intronic
935992627 2:108734775-108734797 CTGTGTCAGTGGCAAGTGGATGG + Intronic
936127946 2:109807417-109807439 CTGTGTCAGTGGCAAGTGGATGG + Intronic
936216751 2:110564068-110564090 CTGTGTCAGTGGCAAGTGGATGG - Intronic
936425890 2:112418649-112418671 CTGTGTCAGTGGCAAGTGGATGG - Intronic
936896192 2:117430522-117430544 CTGTGTCGTTGACAGGTGGCAGG - Intergenic
937096510 2:119239038-119239060 CTGGGGCATTGCGCTGTGGCTGG - Intronic
938161003 2:128984337-128984359 CTGAGGCAGTAGCATATGGCTGG + Intergenic
939662814 2:144911397-144911419 CAGGGGTATTGGCTTGTGGCTGG + Intergenic
941967706 2:171315946-171315968 CAGTGTCATTGGCAAGTGCCTGG - Intergenic
942020615 2:171864520-171864542 CTGTGGCATTGCTTTGTTGCTGG - Intronic
942956045 2:181774608-181774630 CTTTGGCATTTCCATGTTGCCGG + Intergenic
944445911 2:199788261-199788283 CTGTGCCCTTGGCATGAAGCAGG + Intronic
944574700 2:201080644-201080666 CTGTGGTATTGGCATAAGGGTGG - Intronic
945042853 2:205756550-205756572 CTGTGCCCTTGGAATGTGGCTGG - Intronic
945746314 2:213723239-213723261 CTGTGTGGATGGCATGTGGCTGG + Intronic
946162216 2:217842111-217842133 CTGTAGCCTTGGAATGTGGGAGG + Intronic
947266098 2:228283696-228283718 AGGTGGCATTTGCATGTGGGAGG - Intergenic
947884608 2:233557292-233557314 CTGTGGCATGGCCATGTGTGTGG - Intronic
947912488 2:233810601-233810623 CTGTGGCCCTGCCATGTGGCAGG + Intronic
948180708 2:235977854-235977876 CTGTGGCATTTTGATATGGCAGG - Intronic
949073587 2:242041172-242041194 CTGTGGAACTGGCCAGTGGCTGG - Intergenic
1170163310 20:13337593-13337615 CTGGGGAATTCACATGTGGCAGG + Intergenic
1173638381 20:44581064-44581086 CATTGGCATTGGCATGTGTGTGG + Intronic
1175100309 20:56574656-56574678 CTATGGCATTTGCATTGGGCTGG + Intergenic
1175192286 20:57219509-57219531 ATGTGTCATTGGCATCTGGTGGG + Intronic
1175218676 20:57404827-57404849 CAGAGGCATTGGCAGGTGCCAGG + Intronic
1175643150 20:60648750-60648772 ATTTGGCAATGGCATTTGGCAGG - Intergenic
1176063575 20:63182763-63182785 CTGTGGAAATGGCTTGTGGTGGG - Intergenic
1176070412 20:63223328-63223350 CTGGGGGATGTGCATGTGGCTGG - Intergenic
1176171604 20:63698850-63698872 CAGTGGCTGTGGCACGTGGCAGG + Exonic
1177323193 21:19548180-19548202 CTCTGGCATTGCCGTGTGGTTGG - Intergenic
1179065595 21:38021593-38021615 CAGTGGCATTGGCATCTCCCAGG + Intronic
1179527140 21:41987330-41987352 TTGTGGCATTCCCATGTGACTGG - Exonic
1180180538 21:46116968-46116990 GTGGGGCAGTGGGATGTGGCAGG - Intronic
1184737988 22:46410348-46410370 CTGCCGCAGTGGCATCTGGCTGG - Intronic
1185182941 22:49373437-49373459 CTGTGGCAGCAGCATGAGGCTGG - Intergenic
949387288 3:3517329-3517351 CGGTGGCATTGGAGTGTGGGTGG + Intergenic
953233522 3:41085612-41085634 CAGGGGCATAGGCATGTGGATGG - Intergenic
954381352 3:50220816-50220838 CTGTGGCCCAGGCTTGTGGCAGG - Exonic
954422860 3:50427731-50427753 CTGTGGCTCTGGGTTGTGGCTGG - Intronic
954613315 3:51957533-51957555 CTGGGGGAGTGGCATGGGGCAGG - Exonic
954999969 3:54918632-54918654 CAGTGGCAATGGCATGACGCAGG + Exonic
956443560 3:69303964-69303986 CTGTGGTATTGTTATGTGTCTGG - Intronic
958711316 3:97720341-97720363 CTATGGCATTGTCATGTGGGAGG + Exonic
958935785 3:100253979-100254001 CTGATGCAGTGGCATATGGCTGG + Intergenic
959943814 3:112106732-112106754 CTGTGGCAGTGACACATGGCAGG - Intronic
960106902 3:113807781-113807803 CTGTAGCATTGTTTTGTGGCTGG + Intronic
960359226 3:116690705-116690727 CTGTGGTATAGGCATGTAGCAGG - Intronic
961057251 3:123799635-123799657 CTGGGGCATTTGCACGTGGGTGG - Intronic
961179810 3:124867644-124867666 GTTAGGCATTGCCATGTGGCTGG + Intronic
961185849 3:124914530-124914552 CAGAGGCATTTTCATGTGGCAGG - Intronic
963021860 3:140879438-140879460 CTGAGGAAGAGGCATGTGGCTGG + Intergenic
964082891 3:152782122-152782144 CTGTTGGCTTGGCAAGTGGCTGG + Intergenic
965516196 3:169624112-169624134 CTGTGACCTGGGCATGTGTCAGG - Intronic
967776513 3:193391716-193391738 TTGGGGCAGTGGCATATGGCAGG - Intergenic
969076008 4:4578267-4578289 CATTGGGCTTGGCATGTGGCAGG + Intergenic
969254036 4:5990524-5990546 CTGTGGCTTTGGGAGGAGGCGGG + Intergenic
970361299 4:15311129-15311151 CTGTGGCATTTCCATGTGCACGG - Intergenic
974932826 4:68378797-68378819 CTGGGGCAGAGGCATGGGGCAGG + Intergenic
976660383 4:87534610-87534632 CTATGGCATTGGGATGCAGCAGG - Intergenic
978777174 4:112515877-112515899 CTGTGACTTTGGCCTGTGCCGGG + Exonic
979937117 4:126711743-126711765 CAGTGGCAGTGGCATTTGGGAGG - Intergenic
980549296 4:134313153-134313175 TTCTGGCATAGGCATGTAGCAGG - Intergenic
980929730 4:139174095-139174117 TTGTGGCATGCGCCTGTGGCAGG + Intronic
982131764 4:152235012-152235034 CTGTGGTATTGGCACATGACTGG + Intergenic
984726662 4:183028411-183028433 CTGTGGCACTGGCATCTGATCGG + Intergenic
985480861 5:109423-109445 CTGTGGCCTTTGCCTCTGGCTGG - Intergenic
985616043 5:922622-922644 CTGGGGCATAGGGATTTGGCAGG + Intergenic
985790838 5:1926249-1926271 CTGTGGCATTGGCAGGGGCTGGG - Intergenic
985826188 5:2193289-2193311 ATGTGGCACTGGCTTGTGGCTGG - Intergenic
986069031 5:4264343-4264365 CTGTGGCTCTGGCATGTTGCTGG + Intergenic
990225985 5:53654372-53654394 CTGTGGAATTGGCCTGATGCAGG + Intronic
990289956 5:54340002-54340024 CTTTGGCATTGACCTGTTGCAGG - Intergenic
990540743 5:56770550-56770572 CTGTACCATTGGCCTGGGGCTGG - Intergenic
991647400 5:68815036-68815058 CTGTGGCCTTGGCAGGGGGAGGG - Intergenic
995657050 5:114438356-114438378 CTGGGTCATTGGCATTTGGGAGG + Intronic
996041219 5:118814185-118814207 CTGTGGCCTTGTCATATGACAGG - Intergenic
998826501 5:146106942-146106964 CTGAGGCAGGGGCATGTAGCTGG - Intergenic
999007867 5:148002238-148002260 CAGTGGCAGTGGTGTGTGGCTGG - Intergenic
1001326077 5:170725850-170725872 CTGTTGCATTGACATATGGGTGG - Intronic
1002094430 5:176822760-176822782 CTGGGACCTTGGCATGTGGTGGG + Intronic
1003683209 6:8276135-8276157 CTGTGACATGGGTATATGGCGGG + Intergenic
1008877806 6:56348550-56348572 CTGTAGCATGGGAAGGTGGCTGG + Intronic
1015897146 6:138028420-138028442 ATGTGGCACTGGCATGAGACAGG - Intergenic
1017518041 6:155175134-155175156 CTTTGGCATTGGCACGTGTGGGG + Intronic
1019521112 7:1460889-1460911 TTGTGGCCTGGGAATGTGGCTGG + Intergenic
1019549706 7:1595870-1595892 CTGTGGCACGGGCATGGGGTGGG + Intergenic
1019670271 7:2274190-2274212 CTGTGGCCTTCACATGCGGCGGG + Intronic
1022561053 7:31349943-31349965 CTGTGGCAATGTCCTGTGGTTGG + Intergenic
1023041785 7:36178982-36179004 TTATGGCCTTGGCATTTGGCGGG + Intronic
1023809122 7:43897803-43897825 CAGCAGCAATGGCATGTGGCTGG + Intronic
1025229148 7:57188414-57188436 GTGTGACATTGGCACGTAGCTGG - Intergenic
1026146958 7:67754790-67754812 CTGTGGGATTGGAATGTCTCTGG + Intergenic
1027056807 7:75055333-75055355 CTGTGGCTTTGTAATCTGGCAGG + Intronic
1027133983 7:75611595-75611617 CCCAGGCATTGGCCTGTGGCGGG - Intronic
1028492250 7:91425342-91425364 CTGTTGCATTGCCATATGGGAGG - Intergenic
1028829447 7:95311527-95311549 CTGTGGACTTGGCATCTGGATGG + Exonic
1031913609 7:127542508-127542530 CTGGGGAAGAGGCATGTGGCTGG + Intergenic
1033356423 7:140603802-140603824 CTGAGTCCTTGACATGTGGCAGG - Intronic
1033635261 7:143206158-143206180 CTGAGGCTTTGGGCTGTGGCAGG - Intergenic
1034272136 7:149808475-149808497 CCCTGGCAGTGGCCTGTGGCTGG + Intergenic
1034421522 7:150993481-150993503 CTGGGGCATTGGGGAGTGGCAGG - Intronic
1034941606 7:155234257-155234279 CTGTGGCATGGGCATCAGTCAGG + Intergenic
1035075884 7:156176990-156177012 CTGTTGGATTGCCATGAGGCCGG - Intergenic
1035421211 7:158730145-158730167 CTGAGGCAGTGGGAGGTGGCTGG + Intergenic
1035680524 8:1484152-1484174 CTGTGGCCTTGGCACCTGGAGGG - Intergenic
1037801130 8:22036628-22036650 CTGTGGCTTTGGCCTGTGGAGGG - Exonic
1038166970 8:25094861-25094883 CTGTAGCATTGTCTTTTGGCAGG + Intergenic
1038408989 8:27343599-27343621 CTGTGGCATTGGGCTGAGACTGG - Intronic
1040311212 8:46237800-46237822 GTGTGGCATGGGCAAGTGGCAGG + Intergenic
1041433693 8:57814480-57814502 CTGGGACATTGCCAGGTGGCAGG - Intergenic
1042485080 8:69339153-69339175 CTGTGGAACTGGCAAGTAGCTGG - Intergenic
1047596606 8:126383912-126383934 CAGTGACATTGGCATCTGGTGGG + Intergenic
1049159721 8:141089492-141089514 CTGTGGGGTTGGCATGGAGCTGG + Intergenic
1049178773 8:141209730-141209752 CTGTGGCAAGGCCATGTGGAGGG + Intronic
1049405513 8:142450301-142450323 CGGTGGCGATGGAATGTGGCAGG + Intronic
1049618760 8:143588466-143588488 CAGATGCATGGGCATGTGGCTGG - Intronic
1049750408 8:144280460-144280482 CTCTGGGAATGGCAGGTGGCAGG - Intronic
1049808610 8:144553012-144553034 CTGTGGGGCTGGCATGGGGCTGG + Intronic
1051522466 9:18004488-18004510 CTCTCCCCTTGGCATGTGGCAGG - Intergenic
1052250707 9:26394133-26394155 CTGTGGCATTGGGACCTGCCAGG + Intergenic
1052787046 9:32838537-32838559 GTGTGGCTTTGCAATGTGGCTGG - Intergenic
1055182758 9:73408771-73408793 CTATGGCATTCAAATGTGGCTGG - Intergenic
1055730731 9:79277293-79277315 CCGGGGTATTGGGATGTGGCTGG - Intergenic
1058419342 9:104819680-104819702 CTGTGGCCTTGGCCTTTGTCGGG - Exonic
1059051786 9:110934276-110934298 CTGTGGGAGAGCCATGTGGCAGG - Intronic
1060462304 9:123868541-123868563 CTCTGAGATTGGCATGTGGAGGG + Intronic
1060823153 9:126672919-126672941 CTGTGCCAGTGTCATGTGCCTGG - Intronic
1061680263 9:132239572-132239594 CTGTGACTCTGGCAGGTGGCAGG + Intronic
1062214160 9:135380041-135380063 CTGTGTCAGTGCCAGGTGGCAGG + Intergenic
1203666387 Un_KI270754v1:22845-22867 CTGTGGGATTGGCCAGTGCCAGG - Intergenic
1203667537 Un_KI270754v1:28484-28506 CTGTGGGATTGGCCAGTGCCAGG - Intergenic
1203668685 Un_KI270754v1:34123-34145 CTGTGGGATTGGCCAGTGCCAGG - Intergenic
1190117841 X:47637687-47637709 CAATGGGATTGGCATGTGGCGGG - Intronic
1190500373 X:51070461-51070483 CTGTGGCATAGGCCTATGGTAGG + Intergenic
1193053374 X:77124824-77124846 GTGTTGAATTGGCATGTGGTGGG - Intergenic
1193638719 X:83985097-83985119 TGGTGGCATTGGCATGCGGATGG - Intergenic
1195671159 X:107471203-107471225 CTGCGGCAGTGGCCTGTGGGAGG - Intergenic
1197302007 X:124792358-124792380 CTGTGACATTGGCATGTTTAAGG - Intronic
1199233706 X:145467753-145467775 CTGTGGCAGTGGTGCGTGGCTGG - Intergenic
1199508985 X:148598449-148598471 CTGTGCCATGGCCAGGTGGCAGG + Intronic
1201064975 Y:10088916-10088938 CAATGGCAGTGGCATGTGGCTGG + Intergenic