ID: 901071711

View in Genome Browser
Species Human (GRCh38)
Location 1:6523287-6523309
Sequence CCGCACCCGGCTGGTGGCAG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 197}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901071711_901071725 24 Left 901071711 1:6523287-6523309 CCACTGCCACCAGCCGGGTGCGG 0: 1
1: 0
2: 0
3: 16
4: 197
Right 901071725 1:6523334-6523356 CTTTGGGAGGCCAAGGCAGGTGG 0: 25113
1: 73031
2: 147530
3: 156446
4: 127492
901071711_901071724 21 Left 901071711 1:6523287-6523309 CCACTGCCACCAGCCGGGTGCGG 0: 1
1: 0
2: 0
3: 16
4: 197
Right 901071724 1:6523331-6523353 ACACTTTGGGAGGCCAAGGCAGG 0: 4504
1: 70378
2: 188418
3: 232456
4: 177655
901071711_901071722 17 Left 901071711 1:6523287-6523309 CCACTGCCACCAGCCGGGTGCGG 0: 1
1: 0
2: 0
3: 16
4: 197
Right 901071722 1:6523327-6523349 CCCAACACTTTGGGAGGCCAAGG 0: 6346
1: 95043
2: 216067
3: 233638
4: 146425
901071711_901071717 7 Left 901071711 1:6523287-6523309 CCACTGCCACCAGCCGGGTGCGG 0: 1
1: 0
2: 0
3: 16
4: 197
Right 901071717 1:6523317-6523339 TGCCTGTAATCCCAACACTTTGG 0: 7114
1: 109335
2: 242763
3: 237820
4: 206209
901071711_901071720 11 Left 901071711 1:6523287-6523309 CCACTGCCACCAGCCGGGTGCGG 0: 1
1: 0
2: 0
3: 16
4: 197
Right 901071720 1:6523321-6523343 TGTAATCCCAACACTTTGGGAGG 0: 20711
1: 314656
2: 260585
3: 140497
4: 126854
901071711_901071718 8 Left 901071711 1:6523287-6523309 CCACTGCCACCAGCCGGGTGCGG 0: 1
1: 0
2: 0
3: 16
4: 197
Right 901071718 1:6523318-6523340 GCCTGTAATCCCAACACTTTGGG 0: 16492
1: 240790
2: 271963
3: 174140
4: 134914

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901071711 Original CRISPR CCGCACCCGGCTGGTGGCAG TGG (reversed) Exonic
900120875 1:1048195-1048217 GGGCACACGGCTGGGGGCAGTGG - Exonic
900208528 1:1441749-1441771 GAGCACCCTGCAGGTGGCAGCGG + Exonic
900423790 1:2567139-2567161 CCACACCCGGCTTCAGGCAGGGG + Intergenic
901071711 1:6523287-6523309 CCGCACCCGGCTGGTGGCAGTGG - Exonic
901529930 1:9846539-9846561 CGGCACCTGGGTGGTGTCAGGGG + Intergenic
902939304 1:19788428-19788450 ACGCACCAGGATGCTGGCAGTGG + Intronic
903202587 1:21754631-21754653 CTGCAGCAGGCTGGTGACAGAGG - Intronic
905672264 1:39799565-39799587 CAGCACCTGGGGGGTGGCAGCGG - Intergenic
905674696 1:39817243-39817265 CAGCACCTGGGGGGTGGCAGCGG + Intergenic
906389887 1:45405933-45405955 CAGAACCCAGCTGGTTGCAGTGG + Intronic
912520866 1:110243737-110243759 CTGCACCCGGCTGTGGGCAGAGG + Intronic
915444237 1:155965744-155965766 CCGCTCCCGGATGGTTGCTGTGG + Exonic
915526790 1:156480983-156481005 TCTCACCCAGCTGATGGCAGTGG - Intronic
919902848 1:202056922-202056944 CCCCACCCCGCAGGTGGCATGGG - Intergenic
920385542 1:205568610-205568632 CCGCACCCGGGCTGTGGCAGTGG - Intergenic
921030241 1:211329876-211329898 CCACTCCTGGGTGGTGGCAGCGG - Intronic
921252382 1:213310112-213310134 CTGCACCTGGCTTTTGGCAGTGG + Intergenic
921967659 1:221107803-221107825 CCACTCCCGGCTGGGCGCAGTGG + Intergenic
922783193 1:228269578-228269600 CCTCACCCGCCTGGAGGCGGAGG - Intronic
1063167871 10:3480153-3480175 CCCCAACAGGCTGGAGGCAGCGG - Intergenic
1063665104 10:8056108-8056130 CCTCTCCCGGCTGGTGGCCCTGG + Intronic
1064629324 10:17293491-17293513 CCGCACCAGGCTGGTAGCTATGG + Intergenic
1069111512 10:64453219-64453241 CAGGAGCAGGCTGGTGGCAGGGG + Intergenic
1069827521 10:71263151-71263173 CCACACCGGGGTGGAGGCAGTGG + Intronic
1072613671 10:97035490-97035512 CCGCCCCTGGCTGGTGGCCCTGG + Intronic
1073136966 10:101225543-101225565 CGGCACACCGCTGGGGGCAGAGG - Intergenic
1074899669 10:117805209-117805231 CCTCGCCCGGCTGGAGGGAGAGG + Intergenic
1075012617 10:118887567-118887589 CAGGAGCAGGCTGGTGGCAGGGG - Intergenic
1075101164 10:119507266-119507288 CCTCTCCTGGGTGGTGGCAGAGG - Intronic
1075636452 10:124034154-124034176 CAGCACCCAGCCTGTGGCAGGGG + Intronic
1075714847 10:124550251-124550273 CCGCAGCTGCCTGGGGGCAGAGG - Intronic
1075958546 10:126546446-126546468 CCCCACCAGGATGGTGCCAGAGG + Intronic
1076778966 10:132713629-132713651 CGGGACCAGGCTAGTGGCAGGGG - Intronic
1076873482 10:133204890-133204912 GGGCACCTGGCTGGGGGCAGAGG - Intronic
1077109766 11:857064-857086 CCGAGCCCGTCTGGTGACAGTGG + Intronic
1077985753 11:7349486-7349508 CCTCAACTGGCTGGAGGCAGGGG - Intronic
1079630295 11:22666755-22666777 CCCCACCAGCCTGGCGGCAGCGG - Exonic
1080829964 11:35883617-35883639 CTGCACCCGGCTGGGCGCGGTGG - Intergenic
1082029474 11:47594142-47594164 CCTCACCTGGCTGGGGGCGGCGG + Exonic
1083582253 11:63832485-63832507 CCGCACCCCAGTGGTGGCACTGG + Intergenic
1083655460 11:64227066-64227088 CCGCTCCCGGCAGGTGGCTGAGG + Exonic
1083922750 11:65789310-65789332 CCTCACCTGGATGGTGCCAGCGG - Intronic
1084212297 11:67629851-67629873 CTGCCGCCGGCTGCTGGCAGGGG - Exonic
1084431890 11:69115841-69115863 CTGCACCCGCCTGCTGGGAGAGG - Intergenic
1084760185 11:71265989-71266011 ACGCTCCCTGCTGGGGGCAGGGG + Intergenic
1088294390 11:108276751-108276773 CGGCACCCGCCAGATGGCAGCGG + Intronic
1088314982 11:108498306-108498328 CCTCGCCCTGCTGGTGGCCGCGG - Exonic
1090183163 11:124718442-124718464 GCGCTCCCGGCTGGCGGCTGCGG + Intergenic
1092089986 12:5796691-5796713 CTGCAGCCGGGTGGAGGCAGGGG + Intronic
1093032720 12:14303386-14303408 TGGCACCAGGCTGGAGGCAGTGG - Intergenic
1096841630 12:54383437-54383459 CCAGACGGGGCTGGTGGCAGTGG - Intronic
1098659268 12:73072445-73072467 CCCCTCCATGCTGGTGGCAGGGG - Intergenic
1102970082 12:117159599-117159621 AAGCACCCGGCTGGAGGTAGAGG - Intronic
1113457382 13:110458237-110458259 CAGCACCATGCTGGCGGCAGGGG - Intronic
1114516282 14:23302091-23302113 CCGCAGCGGGCTTGTGGGAGTGG - Intronic
1115646169 14:35369717-35369739 CCGCACCCGGCTTGGTACAGCGG - Intergenic
1115910789 14:38255078-38255100 CGGCACGGGGCTGGTTGCAGTGG + Exonic
1117459986 14:55935862-55935884 CCCCACACATCTGGTGGCAGAGG - Intergenic
1118971468 14:70641838-70641860 CCGCAACCTGCGGGTGGCGGGGG - Exonic
1119793638 14:77376765-77376787 CAGGGCCCGGGTGGTGGCAGCGG + Intronic
1119852174 14:77874045-77874067 CCACAGCTGGGTGGTGGCAGTGG + Intronic
1120405519 14:84090389-84090411 CTGCAGCCGGCTGATGGCAGTGG - Intergenic
1120765426 14:88323522-88323544 CGGCACCCGGCTCGGGGCAGCGG + Intronic
1120860041 14:89246824-89246846 CCGCATCCGGCTGGGCACAGTGG - Intronic
1121719028 14:96096470-96096492 CCCCACCCTGCTGATGGCAAAGG + Intergenic
1122421627 14:101581525-101581547 CAGCCCCCGGCTGGCGGCAAAGG + Intergenic
1122569374 14:102684140-102684162 CCGCAGCGGGTTGGGGGCAGGGG - Intronic
1122779862 14:104139030-104139052 CCACACCCTGCAGGTGGCCGAGG + Exonic
1122788965 14:104176438-104176460 GCCCACACGGGTGGTGGCAGAGG - Exonic
1124610938 15:31208012-31208034 CCCCACCAGGCTGGGTGCAGTGG + Intergenic
1127259899 15:57319917-57319939 CCGAGCCCAGCTGGAGGCAGAGG - Intergenic
1127289101 15:57554552-57554574 CAGCACGCAGCAGGTGGCAGGGG - Intergenic
1128105719 15:65043277-65043299 TTGGACCAGGCTGGTGGCAGTGG - Intergenic
1129412958 15:75359924-75359946 CTGCATCCAGATGGTGGCAGAGG - Exonic
1129655968 15:77526054-77526076 CCACACGTGGCTGGTGCCAGGGG + Intergenic
1129658154 15:77538312-77538334 CCCCACCCGGCTGGGGACAGTGG - Intergenic
1130018348 15:80204443-80204465 CCGCCCCGGGCTGGGGGAAGGGG - Intergenic
1131511569 15:93051987-93052009 CCTTACCTTGCTGGTGGCAGTGG + Exonic
1132088979 15:98932437-98932459 CCGCTCCTGGCTGGTGGCACTGG + Intronic
1132551346 16:555055-555077 CAGCACCCGTGTGGGGGCAGAGG - Intergenic
1132589669 16:721164-721186 CGGCTCCCGGCAGGAGGCAGAGG + Exonic
1132688516 16:1172146-1172168 CCGCACACGGTGGGTGTCAGGGG + Intronic
1135543301 16:23348778-23348800 CCGCCCTCGTCTGCTGGCAGTGG + Exonic
1135985920 16:27184208-27184230 CCACACCTGGCTGGGGTCAGTGG - Intergenic
1136247788 16:28985312-28985334 CCGGACCCGGCAGGGAGCAGGGG - Intronic
1136576768 16:31129949-31129971 CCCCACCCAGCTGGTTCCAGCGG - Intronic
1137445825 16:48531612-48531634 CCCCACCCGGCTGCTGGATGGGG - Intergenic
1137703517 16:50517665-50517687 CAGCACCCAGCTGGTGCCAGTGG - Intergenic
1138522203 16:57577570-57577592 CATCACCCAGATGGTGGCAGGGG - Intronic
1141150972 16:81564553-81564575 TGGCTCCCGGCTGCTGGCAGAGG - Intronic
1141615509 16:85207425-85207447 CGGCCCCCGGGTGATGGCAGTGG + Intergenic
1141620762 16:85235604-85235626 CCCCACCCCCGTGGTGGCAGAGG - Intergenic
1141913289 16:87075668-87075690 CCTCACGCGGCTGGGGCCAGTGG + Intergenic
1142114963 16:88351728-88351750 CTGCACCCTGCTGGTGGGGGAGG - Intergenic
1142605287 17:1078039-1078061 CCGCAGCTGGCTGGGGGCTGGGG - Intronic
1142815521 17:2422019-2422041 CCGCGCCCGGCAGGTGCCATTGG - Intronic
1142896030 17:2979750-2979772 ACACACCTGGCTGGGGGCAGTGG - Intronic
1143056286 17:4164452-4164474 CCACCCCAGCCTGGTGGCAGAGG - Intronic
1143203324 17:5127015-5127037 CCGCACCAGGGTGGGGGGAGGGG + Intronic
1143681705 17:8480712-8480734 CTGCATCTGGGTGGTGGCAGCGG - Intronic
1144873224 17:18382989-18383011 CCCCACCCTGCTGCTGGCGGCGG + Intronic
1144874491 17:18390340-18390362 CCGCACCAGGGTGGGGGGAGGGG + Intergenic
1146492349 17:33292121-33292143 CAGCCCGCGGCTGGCGGCAGCGG + Exonic
1147201634 17:38806132-38806154 CCTCACATGGCTGGAGGCAGGGG + Intronic
1147325426 17:39667541-39667563 CCGGACCCGGGTGAGGGCAGAGG - Intergenic
1149491028 17:57085371-57085393 CCGCACCCCGATGGTAGCCGAGG + Intronic
1150394395 17:64809966-64809988 CCCCACCCGCCTGGGGCCAGGGG - Intergenic
1151559780 17:74864087-74864109 CAACACCAGGCGGGTGGCAGAGG + Intronic
1151748017 17:76022042-76022064 CCCCACCCTGCTGCTGGCGGCGG - Intronic
1151765842 17:76132748-76132770 GCGCTCCCGGCAGGGGGCAGTGG - Intergenic
1151804854 17:76398981-76399003 CTGCACCCGCAGGGTGGCAGTGG - Exonic
1152341785 17:79729671-79729693 CCGGACCAGGGTGGTGGCTGTGG - Intergenic
1152875580 17:82784823-82784845 CCTTACCCGGCTGGTGGCATGGG + Intronic
1152926441 17:83089924-83089946 GCTCACCCGGCTGACGGCAGGGG - Intronic
1153918018 18:9762909-9762931 CCCTACCCTGCTGGTGGCAAAGG - Intronic
1153997549 18:10454885-10454907 CCGCACCCGGCCGGAGGCGGAGG + Exonic
1157545472 18:48543455-48543477 CCGCACACAGCGGGAGGCAGGGG - Intronic
1157591994 18:48841702-48841724 AGGCACCGGGCTGGTGGGAGAGG - Intronic
1157706784 18:49813923-49813945 CCGCCCCCAGCTGGCGGCCGCGG - Exonic
1160673758 19:377828-377850 CGGCCCCACGCTGGTGGCAGGGG - Intergenic
1160935521 19:1592769-1592791 GCGCGCCCGGCTGGGGGCGGAGG - Intronic
1161401503 19:4067696-4067718 CCCCACCCGGCTGCGGGCCGCGG + Intergenic
1161699983 19:5789267-5789289 CCGCACGGGGCTGCTGGGAGGGG + Exonic
1162926591 19:13933331-13933353 CCGCATCCGGCAGGTGGAGGCGG - Exonic
1163126990 19:15249666-15249688 CCACACCTGGCTGGTGGGACAGG - Intronic
925368127 2:3324855-3324877 CCTCACCAGGCTGGGGTCAGTGG + Intronic
930754215 2:54959163-54959185 CCTCATCCGGCTGGTGGCCAAGG + Exonic
932571557 2:72941020-72941042 CCGCCCCCGGATGGAGGCTGTGG + Intergenic
932801791 2:74747756-74747778 CCCCACCAGGCTGGTGGAGGTGG - Intergenic
935016494 2:99187536-99187558 CCACACCCGGCTGGGCGCGGTGG + Intronic
937871295 2:126788153-126788175 CCTCACCAGGCTGTTGGCATAGG - Intergenic
940517420 2:154698625-154698647 GCGCACCCGGCAGGTAGCTGCGG - Exonic
941096559 2:161244762-161244784 CCTCACCCGCCTGGAGGCGGAGG - Intergenic
942046521 2:172102306-172102328 CAGCACCCGGCGGGCGGCGGCGG - Exonic
944496030 2:200307402-200307424 CCGCACCCGGCTGGGATCCGAGG - Intronic
946418302 2:219551529-219551551 CCACACACGGCTGCTGGTAGAGG - Exonic
947523893 2:230866904-230866926 CCGCAGCCTGCTGATGGCATGGG + Intronic
948636010 2:239338064-239338086 CTGCACCTGGCTGGTGGGCGGGG - Intronic
948859898 2:240747708-240747730 CTTCACCCAGATGGTGGCAGAGG - Intronic
1170991208 20:21303374-21303396 CGGCACACGGCTGGAGGCGGCGG - Exonic
1171266726 20:23777188-23777210 CCACATGTGGCTGGTGGCAGTGG + Intergenic
1171276271 20:23858832-23858854 CCACATGTGGCTGGTGGCAGTGG + Intergenic
1171508123 20:25655978-25656000 GTGCACCCGGCTGGGTGCAGTGG - Intergenic
1172056509 20:32158023-32158045 CCGCACCCTTCTGGTGGCGGAGG - Intronic
1172484284 20:35288946-35288968 CCCCACCCAGGTGGTGGCTGTGG - Exonic
1175190795 20:57211081-57211103 AATCACCCGGCTGGTGGCCGGGG + Intronic
1175318831 20:58071283-58071305 CCAAGCCAGGCTGGTGGCAGTGG - Intergenic
1175761897 20:61566931-61566953 CAGCACACGGCTGTTGCCAGCGG + Intronic
1178365037 21:31983088-31983110 CAGCACACGGCTGGGTGCAGTGG - Intronic
1180014429 21:45073429-45073451 CCGCACCTGGGTGGGGGAAGCGG - Intergenic
1181173391 22:21022772-21022794 CCCCACCCTGCTGGGGGCACTGG - Intronic
1182422386 22:30254757-30254779 CCCCACCCGGCAGGTGGGGGTGG - Intergenic
1182610215 22:31541180-31541202 AAGCACCCAGCTGGTGGCACAGG - Intronic
1182664203 22:31945102-31945124 CGGAACCCGGCCGGGGGCAGAGG + Intronic
1183287561 22:36977102-36977124 CCTCACCTGGCTTGGGGCAGAGG - Intergenic
1184265966 22:43346158-43346180 TCACACCCAGCTGGAGGCAGGGG - Intergenic
1184504637 22:44893417-44893439 CCCCACCCTCCTGGTGGCATGGG + Intronic
949634038 3:5962965-5962987 CCTCACTCGGGTGGTGGCAGAGG - Intergenic
950336772 3:12200966-12200988 CTTCACCGGGCTGGAGGCAGTGG - Intergenic
951558688 3:23945478-23945500 CCGCCCCGGGCTGGAAGCAGCGG - Exonic
954348681 3:50023933-50023955 TCACACCCGGCTGGGAGCAGTGG - Intronic
954810611 3:53245014-53245036 CCCCTCCAGGCTGGGGGCAGTGG + Intronic
958605204 3:96349903-96349925 CGGCAGCTGGCTGGTTGCAGTGG - Intergenic
958962821 3:100526171-100526193 TAGCACCCTGCTGCTGGCAGAGG + Intronic
960708467 3:120504437-120504459 CCAAACCCAGCTGGAGGCAGAGG - Intergenic
963081864 3:141402294-141402316 CCGCCCCCGGCGCGGGGCAGAGG - Intronic
968664850 4:1815387-1815409 CCGCCCCCAGCTGGTGGCACTGG - Intronic
968740673 4:2330310-2330332 ACGCAACCTGCTGGTGGGAGAGG + Intronic
969459615 4:7322075-7322097 CCCCACCTGTCTGATGGCAGAGG - Intronic
969501473 4:7556146-7556168 CCTCACCTGGATGGTGGCAATGG - Intronic
970512959 4:16799141-16799163 CCGCGCCCGGCTCGTGACTGGGG + Intronic
976445643 4:85127767-85127789 CAGCAGCCACCTGGTGGCAGGGG - Intergenic
987084054 5:14452469-14452491 CCACACCCAGCAGGTGGCAGGGG + Intronic
990165377 5:52988937-52988959 CAGCGCCCGGCTCCTGGCAGCGG - Intergenic
996978408 5:129461170-129461192 GTGGACCCGGCTGGCGGCAGCGG + Exonic
1002471816 5:179439984-179440006 CTGCGCCAGGCTGTTGGCAGTGG + Intergenic
1002693847 5:181070853-181070875 CCCCACTCTGCTGATGGCAGTGG - Intergenic
1003076743 6:2989086-2989108 CTGCAGCGGGCTGGTTGCAGAGG - Intronic
1007902268 6:45422975-45422997 CCGCTCCCGGCCGGGGGCGGGGG - Intronic
1013211787 6:107993427-107993449 CCTCGCCCGGCCGATGGCAGGGG + Intergenic
1014533323 6:122586904-122586926 CCCCACCCAGGTGGAGGCAGAGG - Intronic
1017717628 6:157223482-157223504 CCCCCCCCGCGTGGTGGCAGTGG + Intergenic
1019032656 6:169025592-169025614 CAGCTCCCCGCTGGTGGCTGAGG - Intergenic
1019473480 7:1233234-1233256 CCGCAGGCGGCTGGCAGCAGCGG - Exonic
1020023076 7:4880700-4880722 CCACAGCTGCCTGGTGGCAGAGG - Intronic
1020107326 7:5428154-5428176 CCGACCCCGGCTGGAGGAAGAGG - Intergenic
1024571211 7:50724056-50724078 CCGCCACTGGCTGGAGGCAGTGG + Intronic
1032806346 7:135358744-135358766 CCCCACCTGGCTGGGAGCAGTGG + Intergenic
1034195371 7:149242312-149242334 CCGCACCCGGCCTAAGGCAGAGG + Intronic
1035865096 8:3074018-3074040 CCTCACCCTGAGGGTGGCAGCGG + Intronic
1037838556 8:22228619-22228641 CGGCACCTGACAGGTGGCAGAGG + Intronic
1038592390 8:28851722-28851744 CCACCCCCGGCTGGGTGCAGTGG - Intronic
1039425209 8:37479667-37479689 CAGCACTGGGCGGGTGGCAGGGG + Intergenic
1040534602 8:48297687-48297709 CCCCACCAGGGTGGTGTCAGTGG - Intergenic
1047180110 8:122579342-122579364 CTGCATCCTGCTAGTGGCAGGGG - Intergenic
1047956964 8:129983809-129983831 CCGCACCCAGCGGGAGGGAGAGG - Intronic
1050788453 9:9435221-9435243 CAGGACCCGGCTGGTTGCGGTGG + Intronic
1051658972 9:19408744-19408766 CAGCACCCGGCAGGTGGCCAGGG - Intergenic
1052951575 9:34217524-34217546 CCGTGCCTGGCTGGTGGCGGTGG + Intronic
1053053062 9:34977328-34977350 CCTCTCTCGGCTGTTGGCAGGGG - Intronic
1053507507 9:38655814-38655836 CTGCACCCAGGTGGTGGCAGAGG - Intergenic
1054998852 9:71425559-71425581 CTGGACCAGGTTGGTGGCAGTGG - Intronic
1057877030 9:98765525-98765547 ACTCACCTGGCTGGTGGCTGAGG - Intronic
1058058667 9:100473668-100473690 CAGCCCCCGGGTGGTGGCGGCGG + Exonic
1060270095 9:122133972-122133994 ACACAGCTGGCTGGTGGCAGAGG - Intergenic
1062180246 9:135187549-135187571 CCTCACCCGGCTGCGAGCAGTGG - Intergenic
1062425124 9:136502538-136502560 ACGCAGCAGGCTGGTGGCCGGGG + Intronic
1062472107 9:136710761-136710783 ACGATCCGGGCTGGTGGCAGTGG + Intergenic
1062527010 9:136981988-136982010 CAGCACCGGCCTGGTGGCAGTGG - Intronic
1185545856 X:943727-943749 CAGCACCAGGCTGGAGGCGGTGG + Intergenic
1187353299 X:18542301-18542323 CCCCGCCAGGCTGGTGTCAGTGG - Intronic
1187859323 X:23666456-23666478 ACGCACACGGCAGGTTGCAGCGG + Intronic
1192363273 X:70452453-70452475 CCCCGCCCCGCTGGCGGCAGCGG + Intronic
1193270033 X:79517924-79517946 CTTCACCTGGGTGGTGGCAGTGG - Intergenic