ID: 901072217

View in Genome Browser
Species Human (GRCh38)
Location 1:6526756-6526778
Sequence CTGTGCCCCCGGAAGAGCTA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 119}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901072217_901072223 -9 Left 901072217 1:6526756-6526778 CCTTAGCTCTTCCGGGGGCACAG 0: 1
1: 0
2: 0
3: 2
4: 119
Right 901072223 1:6526770-6526792 GGGGCACAGGGGTGAGGATGTGG 0: 1
1: 0
2: 15
3: 139
4: 866

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901072217 Original CRISPR CTGTGCCCCCGGAAGAGCTA AGG (reversed) Exonic
901072217 1:6526756-6526778 CTGTGCCCCCGGAAGAGCTAAGG - Exonic
903226249 1:21895558-21895580 CTGTGCCCCCAGGAGGGCTCTGG + Intronic
904377316 1:30090068-30090090 CTGACCTCCTGGAAGAGCTAGGG - Intergenic
905284171 1:36868449-36868471 CTGTGCCCACAGCAGAGCTCAGG - Intronic
905803701 1:40861634-40861656 CTCTGGCCCAGGAAGAGCTCGGG + Exonic
906198954 1:43947232-43947254 CTGTGACCCCTCAAGAGCCAGGG + Exonic
909741722 1:79037443-79037465 CTGTGTGCCTAGAAGAGCTATGG + Intergenic
915343211 1:155187343-155187365 CAGTGCCGCCGAAAGAACTACGG - Exonic
920544336 1:206802957-206802979 CTGTGGCCCTGGAAGGGCGAGGG + Intronic
924300423 1:242632316-242632338 CTGTGTCCCCAGAATACCTAGGG - Intergenic
1067144655 10:43686377-43686399 CTGAGCCCCGGGAAAAGCTGTGG - Intergenic
1067270812 10:44789986-44790008 CTGTGTCTCCAGAAGAGATACGG - Intergenic
1072690731 10:97570914-97570936 CTGTGCCCAGGGGAGAGCCAGGG - Exonic
1073234448 10:102001943-102001965 CTGAGCCCCCAAAATAGCTATGG + Intronic
1073328438 10:102656150-102656172 ATGTGCCCCCGGGAGGGCTAGGG - Intronic
1078393387 11:10956081-10956103 CTGTGCACCTGGAAAAGCAATGG - Intergenic
1078630802 11:13002076-13002098 CTGTACCCCTGGAAAACCTACGG + Intergenic
1078747414 11:14128558-14128580 CTGTGTACCTGGAAAAGCTATGG - Intronic
1082692022 11:56317547-56317569 CTGTACCACCCGAAGAGATAAGG + Intergenic
1085264061 11:75225968-75225990 CTGAGGCCCCGGAAGGGGTAGGG - Intergenic
1088298607 11:108329528-108329550 CTGAGCCCCCGAAATAGCTGGGG + Intronic
1089618031 11:119706145-119706167 CTGTGCCCAGGGAAGAGGTGGGG - Intronic
1089634591 11:119804148-119804170 GTGTGCCCAAGGAAGAGCCACGG + Intergenic
1093182172 12:15979260-15979282 TTGTGCCACAGGAAGAGCTTGGG + Intronic
1098038507 12:66331379-66331401 CCGTCCCCACGGAAGAGCTCTGG + Exonic
1101819096 12:108169420-108169442 CTGTGCTCTCAGCAGAGCTAGGG - Intronic
1104449726 12:128859374-128859396 CTCTGCCTCCGGAAGAGCATGGG + Intronic
1104951597 12:132443213-132443235 CGGAGCCCCCGGAACAGCCACGG - Intergenic
1106421823 13:29591682-29591704 CTGTGCCCCCAGAAAAGGGAGGG + Intronic
1107479360 13:40772402-40772424 CTGTGACCCCAGAAGAGATGTGG + Intergenic
1113424790 13:110199164-110199186 ATGTGCCCCTGGGAGAGCTGAGG + Intronic
1113697738 13:112358994-112359016 CTGTTCCCCAGGAAGAGTGATGG + Intergenic
1118070938 14:62245996-62246018 CTGTGCACCTGGAAAAGCCAGGG + Intergenic
1119413895 14:74456834-74456856 CTGTGCCCCTGCAGGAGCCATGG + Intergenic
1119420095 14:74503218-74503240 CTGTGTCCCCCGAGGAGCTCTGG - Exonic
1121096698 14:91222319-91222341 CTGGGCCCCAGGAAGGGCTGTGG - Intronic
1122261335 14:100524778-100524800 CTGAGGCCCAGGAAGAGGTACGG - Intronic
1123627628 15:22238642-22238664 CTGTGCCCCGGGCAGAGGGAGGG - Intergenic
1124786865 15:32689776-32689798 CTGTGTCTCCTTAAGAGCTAGGG - Intronic
1125361976 15:38873900-38873922 CTGTCCCCCGGGAAGAGTGAGGG - Intergenic
1126558145 15:50013301-50013323 ATGTCCCCCTAGAAGAGCTATGG - Intronic
1128337712 15:66798068-66798090 CTATTCCCCGGGAAGAGCTCGGG - Intergenic
1128511092 15:68314251-68314273 CTGTGCCCACGGAGGAGGGATGG + Intronic
1131943891 15:97597989-97598011 CGGTGCCCCAGGGAGAGCTGGGG - Intergenic
1132251292 15:100337413-100337435 CTGTGGCAACAGAAGAGCTATGG + Intronic
1132567588 16:630541-630563 CTGTGCCCCTGAAACAGCCATGG + Intronic
1132665526 16:1079823-1079845 CTGTGCCTCCGCAAGGGCTCTGG + Exonic
1132951272 16:2563744-2563766 CTCTGCCCCCGTATGAGCCACGG + Intronic
1132963078 16:2636426-2636448 CTCTGCCCCCGTATGAGCCACGG - Intergenic
1133321796 16:4918787-4918809 GTGTGCCCCTTGGAGAGCTATGG + Intronic
1134109598 16:11506863-11506885 CTGGGCCCCCGGGAGGGCTGAGG - Intronic
1134445924 16:14331347-14331369 GTGTGCCCCCTGAAGAAGTAGGG + Intergenic
1138429736 16:56961040-56961062 CTGTGCCCCGGGCAGGGCCAAGG - Intergenic
1142066942 16:88068156-88068178 CTGTGGCCCCTGCAGAGCTCCGG + Intronic
1143611591 17:8020870-8020892 CTGGGCTCCCGGAAGACTTAGGG - Intergenic
1152248352 17:79198115-79198137 CTGTCATCCCGGAAGTGCTACGG + Intronic
1152248361 17:79198157-79198179 CTGTCATCCCGGAAGTGCTACGG + Intronic
1155447035 18:25923098-25923120 CTGTGCCCCCACAAGTGCTGTGG - Intergenic
1156445996 18:37237078-37237100 CTGGGCCCCAGGAATAGGTAAGG + Intergenic
1165178128 19:33945118-33945140 CTGTGCCCCCTGCAGGGCAAAGG - Intergenic
1165391291 19:35540380-35540402 CTGTGCCCCCAGAAGACCCCAGG - Intronic
1167482440 19:49741420-49741442 CAATGCCCCAGGAAGAGCTGTGG + Intronic
925439736 2:3874517-3874539 CAATGCTCCCAGAAGAGCTATGG - Intergenic
927249524 2:20985132-20985154 CTGGGCCCCTGGAAGGGCGAAGG - Intergenic
927843642 2:26460545-26460567 CTGTGGCCCAGGAAGAGATGGGG + Intronic
928387237 2:30880965-30880987 CTCTGCACCTGGAAGAGATAAGG + Intergenic
933572507 2:84029957-84029979 CTGTGATCCTGGAAGAGCAAGGG + Intergenic
938015859 2:127866691-127866713 CTGTGCCCCCAGCTCAGCTATGG + Intronic
948248812 2:236508419-236508441 CTCTGCCCCCTGAAGGGCTTTGG - Intergenic
948801925 2:240436922-240436944 CTGTGGTCCCGGAGGAGCTTTGG + Intronic
1171378669 20:24714991-24715013 CTGTGCCCCCACAAGAGCATCGG + Intergenic
1172252664 20:33490490-33490512 CTGCGCCGCCCGAAGAGCTCGGG + Intronic
1172358336 20:34295066-34295088 CTGTGACCCCCGAAGGGCCAAGG + Intronic
1175922065 20:62454814-62454836 CTGGGCCCCCACAAGAGCTGGGG + Intergenic
1181185733 22:21102392-21102414 CTGTGTCCCTGGAAGAGTGAGGG + Intergenic
1183714941 22:39528123-39528145 CTCTGCCCCCGGAAGATGTGTGG + Intergenic
1184452131 22:44589460-44589482 ATGTGCCCCGGGAAGAGATCTGG - Intergenic
1184822315 22:46918481-46918503 GTGTGCCCCGGGGAGAGGTATGG + Intronic
950920438 3:16688896-16688918 CTTTGCCCTGGGAAGAGCTGGGG + Intergenic
953768541 3:45761894-45761916 CTGTGTCCCCGGAAAGGCCAGGG - Intronic
954625958 3:52022051-52022073 CTGGGCCCCATGAAGAGCTTAGG + Intergenic
957165674 3:76669677-76669699 CTGTGTCCCAGGGAGAACTATGG - Intronic
958726506 3:97911700-97911722 CTGTGGATCAGGAAGAGCTAGGG + Intronic
960530381 3:118757508-118757530 CTTTGCCCACAGAAGAGATAAGG + Intergenic
965811240 3:172593187-172593209 CTGTGACCTCTGAAGTGCTATGG + Intergenic
966943582 3:184761949-184761971 CTGTCCCTCCGGAAGAGCCTGGG + Intergenic
970583219 4:17492219-17492241 CTGTGCTCCCGTAAGTGCTTGGG - Exonic
972784991 4:42318446-42318468 CTGTGACCACTGAAGAGCAAGGG + Intergenic
973718388 4:53700181-53700203 CTGTGCACCTGGAAAAGCCACGG - Intronic
974521567 4:62987386-62987408 CTGGGCCCCCAGAAAAGCCATGG + Intergenic
977553056 4:98462526-98462548 TTGAGCCCCCTGAAGAGCTTTGG + Intergenic
983020414 4:162669730-162669752 CTGTGCACCTGGAAAAGCCATGG - Intergenic
986401194 5:7383400-7383422 CTGTAACCCCAGAAGAGGTAAGG + Intergenic
992533434 5:77673616-77673638 CTGAGTCCCCGGAACAGCCATGG + Intergenic
994645291 5:102461119-102461141 TTGTGTACCCGGAAGAGGTAGGG + Intronic
995121829 5:108544464-108544486 CCCTGCCCCCTGAAGATCTAGGG + Intergenic
996157140 5:120115647-120115669 CTGTGAACCTGGAAAAGCTATGG + Intergenic
998141328 5:139701266-139701288 CTCTGCCCTCAGAGGAGCTAAGG + Intergenic
1004555871 6:16697510-16697532 CAGTGCTCTCTGAAGAGCTAAGG + Intronic
1009994764 6:70885839-70885861 CTGTGCAGCCTGAAGATCTAGGG - Intronic
1013352284 6:109316680-109316702 CTGTGCCCCCAGAAGCACTTGGG + Intergenic
1016902654 6:149117551-149117573 CTGTGCCCTCAGAAGAGCATGGG - Intergenic
1018529222 6:164745096-164745118 CTGTGGCCCCTGAAGAGCATGGG - Intergenic
1019602100 7:1889900-1889922 CTGTGGCCCCTGACGAGCTGTGG - Intronic
1019623559 7:2004006-2004028 CTGTGCCCCCGGGAGTGCCCAGG - Intronic
1020261903 7:6535573-6535595 CTGTGCCCCACCAAGAGGTAAGG - Intronic
1020272926 7:6607704-6607726 CTGCGCGCCCGGGAGTGCTACGG + Intronic
1021576383 7:22109485-22109507 CTGTGGTCCTGGAAGAGCTATGG - Intergenic
1026913407 7:74105964-74105986 ATGTGCCCCTGGACGAGGTACGG + Exonic
1030252586 7:107463839-107463861 CTGTGCTCCTGGAAGTGCTTGGG + Intronic
1033865541 7:145686879-145686901 CTGTGCACTGGGAAAAGCTATGG + Intergenic
1036163222 8:6407487-6407509 CTGTGCACCTGGAAGAGCCCAGG + Intronic
1036783793 8:11671760-11671782 CTGAGTCTCCAGAAGAGCTAAGG - Intergenic
1040611113 8:48983115-48983137 CTTTGCCCCGGGATGAGCCAAGG - Intergenic
1049600227 8:143504150-143504172 CAGTGCCCAGGGCAGAGCTAGGG + Intronic
1056918472 9:90764733-90764755 CTGTGACCCCTGAAGAGGCAAGG + Intergenic
1060778307 9:126392855-126392877 CTGTGCAGCTGGAAGAGCCAGGG + Intronic
1191141727 X:57121650-57121672 CTGTAGCCCCGGCGGAGCTATGG + Intergenic
1193360737 X:80575617-80575639 TTGTGTCCCCGGAAGAGATGCGG - Intergenic
1199044045 X:143147819-143147841 CTGTGCACCTGGAAAAGCTGCGG + Intergenic
1200679605 Y:6194564-6194586 CTGTGCACCTGGAAAAGCTGCGG - Intergenic
1202059368 Y:20869711-20869733 CTGTGCCACAGGAAGGTCTAGGG + Intergenic