ID: 901072783

View in Genome Browser
Species Human (GRCh38)
Location 1:6530906-6530928
Sequence GTGTAGTCAAAGTTGAGGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 116}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901072783_901072788 8 Left 901072783 1:6530906-6530928 CCTAGCCTCAACTTTGACTACAC 0: 1
1: 0
2: 0
3: 9
4: 116
Right 901072788 1:6530937-6530959 GCAAGCTGACTCCCAGTCCCTGG 0: 1
1: 0
2: 1
3: 16
4: 201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901072783 Original CRISPR GTGTAGTCAAAGTTGAGGCT AGG (reversed) Intronic
901072783 1:6530906-6530928 GTGTAGTCAAAGTTGAGGCTAGG - Intronic
901891063 1:12265431-12265453 GAATAATAAAAGTTGAGGCTGGG - Intronic
904800171 1:33086919-33086941 GAGTAGTGAAAGTGGAGGCTGGG - Intronic
904860678 1:33535667-33535689 ATGTAGTCAAGAGTGAGGCTAGG - Intronic
907398742 1:54210974-54210996 GAGGAGGCAAAGATGAGGCTGGG - Intronic
908515350 1:64886733-64886755 GTGTAGACAAGGTTGGGGCGGGG - Intronic
909714150 1:78687222-78687244 GTGTAGTTCAAGGTGAGTCTTGG + Intergenic
913096277 1:115519107-115519129 CTGTAGTCAAATTTGAAGTTAGG + Intergenic
913374337 1:118133836-118133858 GTATTGTCAAAATTCAGGCTAGG - Intronic
914720628 1:150285851-150285873 CTGTAGTCCCAGCTGAGGCTGGG + Intronic
919826897 1:201509405-201509427 GTTGAGTCAAAGGTGATGCTGGG + Intronic
920611287 1:207440247-207440269 GTGAAGTCAGGGATGAGGCTTGG - Intergenic
920611379 1:207441190-207441212 GTGAAGTCAGGGATGAGGCTTGG + Intergenic
923091716 1:230745984-230746006 AACTAGTCAAAGTTGAGGTTTGG - Intergenic
923517431 1:234709497-234709519 GAGCAGTCAAAGATGAGGCGGGG + Intergenic
923898503 1:238299965-238299987 TTGGAGTCAAAGCAGAGGCTGGG - Intergenic
1067483155 10:46619155-46619177 TTGTAGTCAAGGTGTAGGCTGGG - Intergenic
1068851905 10:61751835-61751857 GTGTAGTCAGAGTTCTGGATTGG - Intronic
1075482278 10:122792137-122792159 GTGTAGACACAGTTGTGGTTTGG - Intergenic
1077806812 11:5598322-5598344 CTCTTGTCAAAGCTGAGGCTTGG - Intronic
1083530018 11:63411826-63411848 GTGTATTCTAAGTTGAAGCAAGG + Intergenic
1086079042 11:82883704-82883726 GTGTAAGCAAAGATGAGACTTGG + Intronic
1087177127 11:95106245-95106267 GTGAGGTCAGAGCTGAGGCTTGG + Intronic
1089441854 11:118524269-118524291 GTGTAGTCCAAGTAGAGGGTGGG + Exonic
1092075098 12:5666159-5666181 GAATAGTGAAGGTTGAGGCTGGG + Intronic
1092691496 12:11115688-11115710 TTGTGGTCAGAGTTGATGCTTGG - Intronic
1097383957 12:58927273-58927295 CTGTAGTCACAGTTGTGCCTGGG - Intergenic
1105234836 13:18540311-18540333 GTGTATACAAACTAGAGGCTAGG - Intergenic
1108668508 13:52656151-52656173 ATGCAGTCAAAGTAGAGACTGGG + Intronic
1109821782 13:67666523-67666545 GTTTATATAAAGTTGAGGCTGGG - Intergenic
1113184415 13:107671369-107671391 GATTATTCAAAGTTGGGGCTGGG + Intronic
1113328782 13:109308981-109309003 GTGTTGTCAAGGTTGAGGATCGG + Intergenic
1119430577 14:74565682-74565704 CTGTAGACACAGTTGGGGCTGGG + Intronic
1120177091 14:81306076-81306098 GTGTATTGCAAGTTGAGGGTGGG - Intronic
1122738927 14:103859633-103859655 GTTTAGTGAATGTTGAGGGTGGG + Intergenic
1123025851 14:105423527-105423549 TTTTAATAAAAGTTGAGGCTGGG + Intronic
1125102002 15:35925001-35925023 GAGAAGTCAAGGTTGAGTCTTGG + Intergenic
1125495594 15:40190308-40190330 TTTTAGTGAAAGTTGAGGCTGGG + Intronic
1127115377 15:55721249-55721271 CTGTAGGCAGAGTGGAGGCTGGG - Intronic
1128541064 15:68533601-68533623 GAGAAGTCAAACCTGAGGCTGGG + Intergenic
1129294559 15:74592759-74592781 GGGTCCTCAAAGTTGGGGCTGGG + Intronic
1130141433 15:81229457-81229479 GTGGAGTCAAGTTTGAGGCAGGG + Intronic
1130159177 15:81382005-81382027 GTGGAGAAAAAGGTGAGGCTGGG + Intergenic
1130769133 15:86906820-86906842 GTGTCCTCAACCTTGAGGCTTGG - Intronic
1132955942 16:2593594-2593616 GTGTGGTGAAAGCTGAGGATGGG + Intronic
1138004229 16:53315944-53315966 TTTTAATCAAAGATGAGGCTGGG + Intronic
1138184637 16:54967011-54967033 GAGTGGTCAGAGTTGAGCCTCGG - Intergenic
1140390656 16:74583673-74583695 GAGAAGTCAAAGTTTAGGCTGGG - Intronic
1148851599 17:50558310-50558332 GTGATGTCAGAGCTGAGGCTTGG + Intergenic
1151857425 17:76731754-76731776 GTGTAGTAAAAGTTAAGAGTGGG - Intronic
1154514704 18:15149561-15149583 GTGTATACAAACTAGAGGCTAGG + Intergenic
1157313646 18:46570988-46571010 GTGTAGTCAGTGATGGGGCTGGG - Intronic
1160003867 18:75053758-75053780 GTGTAGAAAAGGCTGAGGCTGGG + Intronic
1163971875 19:20806149-20806171 GTGTAGTAAAGGTTGAGGACCGG - Exonic
1163996824 19:21057373-21057395 GTGTAGTAAGGGTTGAGGATTGG - Exonic
1164002645 19:21118137-21118159 GTTTAGTAAGAGTTGAGGATTGG - Exonic
1164009228 19:21183869-21183891 GTTTAGTAAGAGTTGAGGATTGG - Exonic
1164032925 19:21425636-21425658 GTGTAGTAAGGGTTGAGGATTGG - Exonic
1164166807 19:22685928-22685950 GTGTAGTAAGGGTTGAGGATTGG - Intergenic
1164215821 19:23146178-23146200 GTATAGTAAGAGTTGAGGATTGG - Exonic
1164238448 19:23360113-23360135 GTGTAGTAAGGGTTGAGGATTGG + Exonic
1164252480 19:23492934-23492956 GTGTAGTAAGGGTTGAGGATTGG + Intergenic
1164269071 19:23653945-23653967 GTGTAGTAAGGGTTGAGGATTGG + Exonic
1164319349 19:24127500-24127522 GTGTAGTAAGGGTTGAGGATTGG - Exonic
1164790823 19:30978973-30978995 GAGTAGGCAAAGTTAACGCTTGG - Intergenic
1168046064 19:53795202-53795224 ATGCAATCAAAGTTTAGGCTGGG - Intronic
928963083 2:36949662-36949684 GTTGAGTGAAAGCTGAGGCTAGG + Intronic
932726336 2:74182893-74182915 CTGTAGTCCCAGCTGAGGCTGGG + Intergenic
936539391 2:113337610-113337632 GTGTGCTCTAAGTTCAGGCTCGG - Intergenic
940367067 2:152860258-152860280 GTTAAGACAAATTTGAGGCTGGG + Intergenic
941558537 2:167015084-167015106 CTGTGGTCAAAGGTGAGTCTTGG - Intronic
945475461 2:210276869-210276891 GAGTAGTGAAAGATGAGGCTTGG + Intergenic
947309620 2:228786926-228786948 TTGAAGCAAAAGTTGAGGCTCGG + Intergenic
1170280723 20:14644737-14644759 GTGTAGCCAGAGTTCAGGCAAGG - Intronic
1172157827 20:32841358-32841380 GAGTGGTTAATGTTGAGGCTGGG + Intronic
1173482932 20:43417128-43417150 GTGTTGGCAAACGTGAGGCTGGG - Intergenic
1174704069 20:52637954-52637976 GTATAGTGACATTTGAGGCTAGG + Intergenic
1175372382 20:58500741-58500763 GGGTAGTCAAAGGTGTGGCCTGG - Intronic
1176778829 21:13168590-13168612 GTGTATACAAACTAGAGGCTAGG - Intergenic
960618678 3:119619035-119619057 GTGTAGTGAGAGATGAGGCTGGG - Intronic
964178286 3:153852533-153852555 GTATAGCCAGAGTTGAGGCTAGG - Intergenic
966505069 3:180691782-180691804 ATGTACTCAGAGTTGAGGTTTGG - Intronic
972006900 4:34120772-34120794 ATGTAGGCAAAGTTGATTCTAGG - Intergenic
974742053 4:66020271-66020293 ATGTAGTATAATTTGAGGCTGGG - Intergenic
974878148 4:67722342-67722364 GTGTAGGCAATGTTTAGGCAGGG - Intergenic
978268921 4:106864210-106864232 GTGAAGTCAAAGTTCAGAGTTGG - Intergenic
978770394 4:112450410-112450432 GTGTAATAAAAGTTGATACTTGG - Intergenic
979165949 4:117531735-117531757 CAGTATTCAAAGTTGAGGGTGGG - Intergenic
981867995 4:149449944-149449966 GTGTAGTATAAGTTGAAGTTAGG - Intergenic
983724514 4:170903824-170903846 GTGTAGTTCTAGTTCAGGCTTGG + Intergenic
988483784 5:31651464-31651486 GGGTAGTCACAGTGGAGCCTGGG + Intronic
993264924 5:85713274-85713296 GTGAAGGCAAACTGGAGGCTAGG + Intergenic
996401036 5:123062773-123062795 GTGTAGTGAAAGGTGAGTCAGGG + Intergenic
999147905 5:149407854-149407876 TTGTGGTCAAAGTTCAGACTCGG - Intergenic
1000855065 5:166387995-166388017 CTTTAAACAAAGTTGAGGCTGGG + Intergenic
1011881173 6:92029654-92029676 ATGAAATCAAAGTTGAGCCTTGG - Intergenic
1015462022 6:133502321-133502343 GTGTAGTGAATGTTGAGTTTAGG - Intronic
1016844772 6:148559517-148559539 GTTAAGTCAAAGTTAAGCCTTGG - Intergenic
1018480366 6:164183651-164183673 GTGTAGGAAAAGTCAAGGCTAGG + Intergenic
1020717969 7:11701987-11702009 CTGTGGTCAGAGTTGAGGCCTGG - Intronic
1021576587 7:22110941-22110963 GTGAAGTCAAAGTTGAAGTATGG + Intergenic
1023556519 7:41429266-41429288 GAGTAGTGAAGGTTAAGGCTGGG - Intergenic
1023586578 7:41737332-41737354 CTGTGGACAAAGTTAAGGCTGGG - Intergenic
1025792916 7:64708578-64708600 GTGTAGTAAGATTTGAGGATAGG - Exonic
1026200283 7:68208267-68208289 GTGTGTTCAAAGTTCTGGCTGGG - Intergenic
1026636242 7:72084276-72084298 GTGTGGTAGAAGTTGAGGTTTGG - Intronic
1029139079 7:98397133-98397155 ATGTAGTCTAAGGTGGGGCTGGG + Intronic
1030532866 7:110732049-110732071 GTGATGTCAAAGCTGAGACTGGG + Intronic
1031475226 7:122212983-122213005 GTGTGGTCAGAGATGATGCTGGG - Intergenic
1032834650 7:135661992-135662014 GTGTAATCAAGGTAGAGGCTGGG - Intergenic
1033598469 7:142872498-142872520 GAGAAGTCAGAGATGAGGCTGGG + Intronic
1034692409 7:153024313-153024335 TTATAGCCAAAGTTGAGGCCTGG + Intergenic
1035626025 8:1071238-1071260 GTGTAGTCTAACTTAATGCTGGG - Intergenic
1038029417 8:23624123-23624145 GTGGAATAAAAGTTGAAGCTTGG + Intergenic
1039831750 8:41220982-41221004 CTGTCTTCAAAGTTGAGGCGTGG + Intergenic
1045216315 8:100152135-100152157 GTGCAGTCAAGCTTGAGGATAGG + Intronic
1051455260 9:17248119-17248141 GTATAGTGAAAGACGAGGCTGGG - Intronic
1053869916 9:42480212-42480234 GTGTAGCCAAATTGGAGGTTAGG - Intergenic
1056084603 9:83133591-83133613 GTCTAGTCAAAGTTAGAGCTAGG + Intergenic
1059315128 9:113417805-113417827 GAGTGGTCAGAGATGAGGCTGGG + Intronic
1061224683 9:129274049-129274071 GTGCAGTCAGAGATGAAGCTGGG - Intergenic
1186471797 X:9827611-9827633 GTGTAGTCTGTGCTGAGGCTGGG + Intronic
1188550466 X:31358820-31358842 GTGTAGGTAAAGTTAAGGCGGGG + Intronic
1190119659 X:47650009-47650031 GTCTCCTGAAAGTTGAGGCTAGG + Intronic
1190964811 X:55289098-55289120 GTGTAATAAAAGTTTAGGGTAGG + Intergenic
1195395165 X:104402553-104402575 CTGAAGTCAAAGTTGTGGTTAGG + Intergenic