ID: 901074570

View in Genome Browser
Species Human (GRCh38)
Location 1:6545400-6545422
Sequence TTCTCTGGAGTCTCCTGCGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 146}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901074570_901074573 -8 Left 901074570 1:6545400-6545422 CCTCCGCAGGAGACTCCAGAGAA 0: 1
1: 0
2: 1
3: 14
4: 146
Right 901074573 1:6545415-6545437 CCAGAGAAAAAGAAAATGCCTGG 0: 1
1: 0
2: 4
3: 82
4: 1002
901074570_901074576 25 Left 901074570 1:6545400-6545422 CCTCCGCAGGAGACTCCAGAGAA 0: 1
1: 0
2: 1
3: 14
4: 146
Right 901074576 1:6545448-6545470 CTGCACAGGAAACATTCAGCAGG 0: 1
1: 0
2: 1
3: 29
4: 370
901074570_901074575 11 Left 901074570 1:6545400-6545422 CCTCCGCAGGAGACTCCAGAGAA 0: 1
1: 0
2: 1
3: 14
4: 146
Right 901074575 1:6545434-6545456 CTGGTAAGACATGACTGCACAGG 0: 1
1: 0
2: 0
3: 8
4: 95
901074570_901074577 28 Left 901074570 1:6545400-6545422 CCTCCGCAGGAGACTCCAGAGAA 0: 1
1: 0
2: 1
3: 14
4: 146
Right 901074577 1:6545451-6545473 CACAGGAAACATTCAGCAGGAGG 0: 1
1: 0
2: 1
3: 32
4: 294

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901074570 Original CRISPR TTCTCTGGAGTCTCCTGCGG AGG (reversed) Intronic
900610162 1:3541370-3541392 TCCACGGGAGTCTCCTGGGGAGG - Intronic
900802506 1:4746114-4746136 CCCTCTGGAGGCTCCTGGGGAGG + Intronic
901074570 1:6545400-6545422 TTCTCTGGAGTCTCCTGCGGAGG - Intronic
901381256 1:8876219-8876241 TTCTCTGGAATGTCCTGAGGTGG + Intronic
901942003 1:12669577-12669599 TTCTTTGAAGTCTCCTAGGGTGG - Intergenic
904297636 1:29531798-29531820 GGCTCTGGAGTCTCCTGCACAGG - Intergenic
905148505 1:35907172-35907194 TTCCCTGGGGTCTCCTGGGAAGG + Intronic
905316554 1:37085218-37085240 CTCTCTGGACTCTCCTCCGGGGG + Intergenic
906274429 1:44505761-44505783 CTCTCTGCATTCTCCTGCCGTGG - Intronic
908354472 1:63317217-63317239 TGCTCTGGAGACTCCCGGGGCGG + Intergenic
911389424 1:97220308-97220330 CTCTCTGGAGAGTCCTGAGGTGG - Intronic
912493590 1:110076832-110076854 TCCTCTGGAGTCTCCAGGGAAGG + Intergenic
913068792 1:115281613-115281635 TTCTCTGCAGGCTGCTGTGGTGG + Intergenic
914686789 1:149987213-149987235 TTCTCTGGAGTCAGCTGGGCTGG - Intronic
915544173 1:156586493-156586515 TCCTCTGGCGGCTCCTGCTGAGG - Exonic
915625882 1:157113835-157113857 TTCCCTGGGGTCTCCTGCACTGG + Intergenic
919651966 1:200159002-200159024 TTCTCAGGAGTCTGAGGCGGGGG - Intronic
920933042 1:210406808-210406830 TTCTCTTGAGTCTCATTCTGGGG + Intronic
922929980 1:229381430-229381452 CTCATTGGAGTCCCCTGCGGGGG - Intergenic
924582885 1:245336573-245336595 TTCTCTGCAGGCTCGTGCGGCGG + Intronic
1063161480 10:3421826-3421848 GTCCCTGGAGTCTGCTGGGGTGG - Intergenic
1063366248 10:5492768-5492790 AACCCTGGAGTCTCCTGCAGTGG - Intergenic
1067068193 10:43115279-43115301 CTCCCTGGAGGCTCCTGCCGAGG - Intronic
1068996287 10:63208628-63208650 CTCTCTCCAGTCTCCTGGGGTGG + Exonic
1069147307 10:64910420-64910442 TTCTCTGGAGTCATTTGCTGAGG - Intergenic
1073054016 10:100687488-100687510 ATCTCTGGGGTCTCCAGCGTGGG - Intergenic
1074426849 10:113358793-113358815 TTCTGCAGGGTCTCCTGCGGAGG + Intergenic
1075776680 10:124993735-124993757 ATCTCTGGAGTTTCCTGCCCAGG + Intronic
1076519893 10:131074970-131074992 TCCTCTGGAGACTCCTGCAAGGG + Intergenic
1079008967 11:16812790-16812812 TTCTTCGGAGTCTCCAGTGGGGG - Intronic
1080457737 11:32431111-32431133 TTCTCTGCAGCCGCCGGCGGGGG - Intronic
1080712218 11:34759672-34759694 TTTTCTGGAGTCTCCTTAGATGG - Intergenic
1088039834 11:105366277-105366299 TTTTCTTGAGTCTCCTGCCTGGG + Intergenic
1091130968 11:133146985-133147007 TTCATTGGAGTCTCCTGCAGAGG - Intronic
1094219148 12:27974702-27974724 TTCTCTGGAGTCTCCTGCCCTGG + Intergenic
1096217168 12:49804071-49804093 TTCCCTGGAGTAGCCTGCCGGGG - Exonic
1096536487 12:52278356-52278378 TGCTCTGGGGTCTCCTGTAGAGG + Intronic
1098503691 12:71224508-71224530 TTCTCTGGATGCTCCTTTGGGGG - Intronic
1103974729 12:124695104-124695126 TCCTCTGGAGGCTCTAGCGGAGG - Intergenic
1117736189 14:58771248-58771270 TTCTCTGAAGTCTCTAGTGGAGG + Intergenic
1118458283 14:65964622-65964644 CTCTCTGGAGGCTCCAGGGGAGG - Intronic
1119136300 14:72223944-72223966 CTCTCAGGTGTCTCCTGCAGTGG - Intronic
1119258817 14:73224519-73224541 GTCTGTGGAGTCTCCTACAGAGG + Intergenic
1119323742 14:73746476-73746498 ATCTGCTGAGTCTCCTGCGGAGG - Intronic
1119739704 14:77006372-77006394 TTCTCTGCAGTCTTGGGCGGTGG - Intergenic
1127160103 15:56173670-56173692 TACTCTGGAGGCTACTCCGGAGG + Intronic
1127720786 15:61697232-61697254 TTCTCTGTAGCATCCTGGGGAGG - Intergenic
1128529215 15:68432357-68432379 TTCTCTGGAGTTTTCTCCAGAGG - Intergenic
1129076826 15:73004204-73004226 TTCTCAGGAGTCTCTTGTGGTGG + Intergenic
1130012459 15:80162237-80162259 GTCTGTGTAGTCTCCTGCAGAGG - Exonic
1132500643 16:283254-283276 TCCTCTGGAGGCTCCTCCGAGGG - Exonic
1133457397 16:5954390-5954412 TTCTCAGCAGTGTCCAGCGGTGG - Intergenic
1133826376 16:9281840-9281862 TTCTCTGGAAAATCCTGGGGAGG + Intergenic
1134816660 16:17211400-17211422 TTGTCAGGAGTCTCCTGGGGTGG + Intronic
1136018559 16:27424708-27424730 ACCTCTGCAGTCTCCTACGGAGG - Intronic
1138334256 16:56240172-56240194 TTCCCTGGAGGCTGCTGAGGTGG - Intronic
1138764919 16:59590845-59590867 TCCTCTGGACACTCCTGGGGTGG - Intergenic
1141443922 16:84046132-84046154 TTCTCTGGAGTTTTCTGGGGTGG - Intergenic
1141494054 16:84394634-84394656 CTCTCTGGAGGCTCCAGGGGAGG + Intronic
1141546953 16:84776638-84776660 TCCCCTGGAGGCTCTTGCGGGGG + Intronic
1141588549 16:85051508-85051530 TTCTCTGGGGTCTCCTTTTGAGG - Intronic
1143392764 17:6569797-6569819 TTCTGTGCAGTTTCCTGCAGAGG - Intergenic
1145060598 17:19730954-19730976 TTCTCTGGAGTCACCTTGAGTGG - Intergenic
1146159698 17:30553284-30553306 GTCTCTGGAGTCTCCAGCAGGGG - Intergenic
1147142479 17:38467111-38467133 GGCCCTGGAGCCTCCTGCGGAGG + Exonic
1149444845 17:56705475-56705497 CTCACTGCTGTCTCCTGCGGGGG - Intergenic
1150076689 17:62198284-62198306 TTCACAGGAGTCTTCTGCTGAGG - Intergenic
1152455781 17:80415351-80415373 TGCTTTGGAGTCTCGGGCGGTGG - Intronic
1152477439 17:80527245-80527267 CTCACTGGCCTCTCCTGCGGAGG + Intergenic
1153537729 18:6120305-6120327 TCCTCTGGAGTGTCATGAGGTGG + Intronic
1156234401 18:35187368-35187390 TTCCCTGGGGTCCCCTGCTGTGG + Intergenic
1157293747 18:46427373-46427395 TTCTCTGGAGCCTCATTAGGAGG - Intronic
1157293881 18:46428003-46428025 TTCTCTGGAGACTCATTAGGAGG - Intronic
1157399763 18:47377653-47377675 TTCTCAGGACTCTCCTGAGCTGG - Intergenic
1160151980 18:76402262-76402284 TTCTCTGGAGGCAGCTGCGCGGG - Intronic
1161292640 19:3503415-3503437 CTCTCTGGAGGCTCCAGGGGAGG + Intergenic
1161301453 19:3544828-3544850 GTCTCTGTAGCCTCCTGCTGTGG - Exonic
1168104280 19:54157012-54157034 TTCTCTTGCCTCTCCTGAGGGGG + Exonic
925073162 2:987392-987414 GTCTGTGAAGTCTCCTGGGGTGG + Intronic
925701864 2:6646917-6646939 TTCTCTGGAGTCTCCCTCTAAGG - Intergenic
926652239 2:15359031-15359053 TTCTCAGGAAACTCCTGTGGAGG - Intronic
927185653 2:20480224-20480246 TTCTCTGCAGTCTGCTTCTGGGG + Intergenic
927415698 2:22878313-22878335 TTCACAGGAGTCTCCTGAGAAGG - Intergenic
927973034 2:27317585-27317607 TTCTCTGCAGTCTCCTGGGCTGG + Intronic
933858295 2:86440779-86440801 TGCTCTGGAGGCTCGTGCGCAGG - Exonic
936085311 2:109463536-109463558 TCCTCTGGACCCTCCTGGGGTGG + Intronic
940810533 2:158237807-158237829 AGCTTTGGAGTCTCCTGGGGTGG - Intronic
944428871 2:199611979-199612001 TTCTCTGCAGAGTCCTGAGGTGG - Intergenic
944675544 2:202032641-202032663 CTCTCTGGTTACTCCTGCGGGGG - Intergenic
946767152 2:223051358-223051380 TCCTCTGAAGCCTCATGCGGAGG - Intergenic
947748054 2:232519637-232519659 TCCTCTGGAGTCTCATGGGCAGG - Intergenic
1169046713 20:2538858-2538880 TCCTCTGGAGTCACCTGCGACGG + Intronic
1169812686 20:9624670-9624692 GGCTCTGGAGTCTCCTGAGCTGG + Intronic
1169947997 20:11010103-11010125 TTCTCTTGAAACTCCTGCTGTGG + Intergenic
1172987994 20:39008605-39008627 CTTTCTGGAGGCTCCTGTGGAGG - Intronic
1174976224 20:55338549-55338571 ATCTCTGGAGTCTCCCAGGGTGG + Intergenic
1175788446 20:61726322-61726344 TTCTCTGAGGTGCCCTGCGGTGG + Intronic
1178379716 21:32097592-32097614 TTCTCTGTAGTCTGCTGCCATGG - Intergenic
1178697469 21:34807039-34807061 TTTTCTCCAGTCTCCTGAGGTGG - Intronic
1178744067 21:35230735-35230757 TTATCTGGAGTCTCATGCACAGG - Intronic
1179779101 21:43688069-43688091 TTTTCTGCAGCCTCCTGCGCTGG - Exonic
1179955500 21:44736017-44736039 GTCTCTGGAGGCTCCAGGGGAGG + Intergenic
1181363161 22:22354327-22354349 TTCTCAAGAGTTTCCTGGGGAGG - Intergenic
1181582269 22:23834919-23834941 TGCTCTGAAGTCCCCTGCGGAGG + Exonic
1184428845 22:44429236-44429258 TTCTCTTCATTCTCCTGCAGAGG - Intergenic
950860594 3:16144621-16144643 TTCTCTGGAGTCTTCTGGAAGGG + Intergenic
951078945 3:18428203-18428225 TTCTCTGCAGAGTCCTGTGGTGG + Intronic
953292781 3:41683270-41683292 TTCATTGGAGCCTCCTGAGGTGG - Intronic
953869462 3:46613829-46613851 TTATCTGAAGTCCCCTGAGGAGG + Intronic
962284532 3:134075170-134075192 CTCTTTGGAGTCTCCTGAAGGGG - Intronic
963575976 3:147060716-147060738 TCCTCTGGAGTGTCCTCCTGTGG - Intergenic
968593151 4:1469665-1469687 CTCTCTGCAGTCTCCAGGGGAGG + Intergenic
969609672 4:8219897-8219919 TTCTCTGGAGACTCTAGGGGAGG + Intronic
970437444 4:16049079-16049101 CTCTCTGGATTCTCCAGGGGCGG - Intronic
975546385 4:75564394-75564416 CTCTCTGGAGTCTTCTTCTGGGG - Exonic
981323614 4:143421747-143421769 ATTTATTGAGTCTCCTGCGGTGG + Intronic
985488905 5:167654-167676 TTCTCTGGGTTCTGCTGGGGTGG - Intronic
985553061 5:543020-543042 GTGTCTGGGGTCACCTGCGGAGG + Intergenic
989704251 5:44309249-44309271 TTCTCTGGATTCTACTGAAGGGG - Intronic
991578500 5:68129765-68129787 TTCTGTGGAGTCTACTTTGGTGG + Intergenic
997777450 5:136623935-136623957 TTCTCTGGAGTTTGCTGAGATGG - Intergenic
999351887 5:150879767-150879789 TTCTCTGGAATCTCATGCCTTGG - Intronic
999840604 5:155421838-155421860 TCCTCTAGAGGCTCCTGGGGAGG + Intergenic
1001248465 5:170124652-170124674 TTCTCTGTAGTCTCTTACTGGGG - Intergenic
1001789695 5:174445481-174445503 TTCTCTGGATGCTACTGCAGCGG + Intergenic
1003616419 6:7659038-7659060 TTCTCTGCAGTGTCCTGAGGTGG + Intergenic
1004824746 6:19406740-19406762 TTCTCTGGAGTCTGCTTAGACGG + Intergenic
1006183205 6:32166302-32166324 TTCTCAGGAGCCTTCTGCTGGGG + Intronic
1007547764 6:42707457-42707479 TCCTCTGGTCTCTCCTGCTGGGG + Intronic
1007721023 6:43885536-43885558 TCCTCTGGACTCTCCTGTTGGGG + Intergenic
1013495218 6:110691078-110691100 TTCTCTGGAATCTCCTTGAGTGG - Intronic
1017312210 6:152987141-152987163 TTGTCAGATGTCTCCTGCGGGGG + Intergenic
1019530346 7:1499998-1500020 CTCTGTGTAGCCTCCTGCGGCGG - Exonic
1019621894 7:1996457-1996479 CTCTCTGGGGTCTCCTGTGCAGG - Intronic
1019637165 7:2082134-2082156 TTCTCTGGCATCTCCTGCGCAGG - Intronic
1021122980 7:16818012-16818034 TTCTCTGAAGGATCCTGTGGAGG + Intronic
1022323453 7:29308583-29308605 ATCTCTGCAGTCACCTGCTGAGG + Intronic
1022611223 7:31875458-31875480 TTCTCTGGAGTCCCCACTGGAGG - Intronic
1024053417 7:45644510-45644532 CTATCTGGATTCTCCTGCAGTGG + Intronic
1026606994 7:71824864-71824886 TTATCTGGGGTCTCCTGATGGGG + Intronic
1032502227 7:132408814-132408836 TTCTCTGCAGTCATCTGCAGAGG - Intronic
1032585706 7:133144575-133144597 TTCTCTTGTGTCTCCTGGAGAGG + Intergenic
1033546455 7:142405688-142405710 TTCTCTGAGTTCTCCTGAGGAGG - Intergenic
1037876814 8:22552500-22552522 TTCCCTGGAGGTTCCTGTGGTGG + Intronic
1038040446 8:23719882-23719904 TTCTCTGGAGTCTCCTATACTGG - Intergenic
1039449804 8:37663315-37663337 TTCTCTGCAGGGTCCTGAGGAGG + Intergenic
1041358830 8:57029057-57029079 CTCTCTGCAGTATCCTGAGGCGG - Intergenic
1042613327 8:70621625-70621647 TTCACTGGACTCTCCTGGTGAGG - Intronic
1043428453 8:80171539-80171561 TTCGCGGGAGTCGCCGGCGGAGG - Intronic
1045882189 8:107054324-107054346 CTCTCTGGATTTTCCTGCTGTGG - Intergenic
1048042347 8:130743564-130743586 TTCTCTGGTCTCTCCTGCTAAGG - Intergenic
1048377896 8:133838430-133838452 ATGTCTGGAGACTCCTGCTGGGG + Intergenic
1049035843 8:140075138-140075160 TTTTCTGGAGTCACCTGCTCTGG - Intronic
1055473816 9:76641740-76641762 GTCTCAGGAGACTCCTGGGGGGG - Intronic
1056737549 9:89222898-89222920 TTCTCTGGAGGCTTCTGGGCTGG + Intergenic
1058127370 9:101210450-101210472 CTCTCTTGAGTCTTCTGCAGGGG + Intronic
1061387529 9:130299255-130299277 GTCTCTGGAGTGTCCTACAGTGG + Intronic
1186068418 X:5791184-5791206 TTCCCTGGAGCCTCCAGAGGGGG + Intergenic
1187472421 X:19580855-19580877 TTCTCCGTAATCTCCTGCAGTGG + Intronic
1193255486 X:79343395-79343417 TTCTCTGGTATCTCCTGGAGTGG - Intergenic
1196504386 X:116424332-116424354 TTATCTGAAGTCTCCTGTGAAGG + Intergenic
1199998654 X:153044529-153044551 TTCTCTGGAGGCTCCAGGGGAGG - Intergenic