ID: 901079417

View in Genome Browser
Species Human (GRCh38)
Location 1:6575384-6575406
Sequence GTGGGCTCTCTTACCTGCCA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 3, 3: 21, 4: 141}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901079417_901079422 -3 Left 901079417 1:6575384-6575406 CCCTGGCAGGTAAGAGAGCCCAC 0: 1
1: 0
2: 3
3: 21
4: 141
Right 901079422 1:6575404-6575426 CACCCCAGCACCTCCTGTCAGGG 0: 1
1: 0
2: 0
3: 36
4: 285
901079417_901079429 28 Left 901079417 1:6575384-6575406 CCCTGGCAGGTAAGAGAGCCCAC 0: 1
1: 0
2: 3
3: 21
4: 141
Right 901079429 1:6575435-6575457 CAATCCTGAGATGAGCAGAGTGG 0: 1
1: 0
2: 1
3: 22
4: 215
901079417_901079430 29 Left 901079417 1:6575384-6575406 CCCTGGCAGGTAAGAGAGCCCAC 0: 1
1: 0
2: 3
3: 21
4: 141
Right 901079430 1:6575436-6575458 AATCCTGAGATGAGCAGAGTGGG 0: 1
1: 0
2: 7
3: 29
4: 207
901079417_901079421 -4 Left 901079417 1:6575384-6575406 CCCTGGCAGGTAAGAGAGCCCAC 0: 1
1: 0
2: 3
3: 21
4: 141
Right 901079421 1:6575403-6575425 CCACCCCAGCACCTCCTGTCAGG 0: 1
1: 0
2: 2
3: 38
4: 430

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901079417 Original CRISPR GTGGGCTCTCTTACCTGCCA GGG (reversed) Exonic
900197146 1:1382197-1382219 GTGGACTCTCTAAACTGTCAAGG - Intergenic
900715483 1:4141093-4141115 GTGGGATGTCCTCCCTGCCATGG + Intergenic
901079417 1:6575384-6575406 GTGGGCTCTCTTACCTGCCAGGG - Exonic
902114383 1:14108843-14108865 GTGTGTTCTCCTTCCTGCCAAGG - Intergenic
902241746 1:15094549-15094571 GAGGGCTCTCTGCCTTGCCAGGG - Intronic
906447226 1:45912686-45912708 TTTGGCTCTCTTAGCTGCCAGGG + Intronic
907394030 1:54177258-54177280 GTGTGCTCTCTCCCCTGCCTGGG - Intronic
912490412 1:110059698-110059720 CTGGGCTCTGTCACCTGCCTAGG - Intronic
920100579 1:203514675-203514697 GAGGCCTTTCTTACATGCCAGGG + Intergenic
922749600 1:228064372-228064394 ATGGCCTCCCTCACCTGCCAAGG + Intergenic
924645121 1:245870420-245870442 GTGGGCTCGCTTACCTCTCCTGG + Intronic
1063421233 10:5914261-5914283 GTGGGCTCCCTTACCGGCAAAGG - Exonic
1069608075 10:69752831-69752853 CTGGGCTCTCCCACCAGCCAGGG - Intergenic
1070721565 10:78760782-78760804 AAGGGCTCCCTTTCCTGCCATGG + Intergenic
1071179305 10:82964262-82964284 GTGGGCTCTCATCTGTGCCAAGG + Intronic
1071750595 10:88471428-88471450 GTGGGCACTCTCACCAGCAATGG + Intronic
1072171007 10:92861618-92861640 CAGGGCTCTCTTTCCTGCCAGGG - Intronic
1072609795 10:97010636-97010658 GTGGGCCCTCCAACCTCCCAGGG + Intronic
1072750792 10:97977170-97977192 CTGGGCCCTCTTATCTGTCAGGG - Intronic
1073550521 10:104396328-104396350 GTGGACTCTGTAGCCTGCCATGG + Intronic
1074787359 10:116852725-116852747 GAGGGGTCTCGTATCTGCCAAGG - Intronic
1075173676 10:120139718-120139740 GTGGTCACTCCTACCTTCCAGGG - Intergenic
1076266658 10:129114035-129114057 CTTGGCTCTCTTACCTGCAGAGG - Intergenic
1076454555 10:130580876-130580898 GTGGGTTCTCTGAACTGGCAAGG + Intergenic
1076529702 10:131136167-131136189 GTGTCCTCTCTTCCCTTCCATGG - Intronic
1076990508 11:271084-271106 GGGGGCTCTCCCAGCTGCCAAGG - Intergenic
1077893370 11:6435791-6435813 GTGGGCTCTCTCAACAGCTATGG + Intronic
1078508602 11:11969194-11969216 GAGGGCACTGTGACCTGCCATGG + Intronic
1079328891 11:19517762-19517784 GTGGGCTTTCTTACCTGCAAAGG - Intronic
1082988673 11:59188788-59188810 GGGGTTTCTCTTACCTGCCAAGG - Exonic
1084973268 11:72782641-72782663 CTGGGCTCTCTTACCTCCCCAGG + Intronic
1089159159 11:116424387-116424409 GTGGGCTCCAGTGCCTGCCAGGG - Intergenic
1093310015 12:17568517-17568539 GTGGGCTCTCTAGCCTGCCCTGG - Intergenic
1097769942 12:63572168-63572190 GTGGGCTCTCTTCCAGCCCAGGG - Intronic
1098567599 12:71953400-71953422 TTGGGCTCTTGTGCCTGCCATGG + Intronic
1100166661 12:91924283-91924305 GCTGGCTCTCTTAGCTGGCAGGG - Intergenic
1102640407 12:114361824-114361846 GAGGGCTCTCTGTCCTGCCTAGG - Intronic
1112398309 13:99053674-99053696 GAGGGTTCTCCTTCCTGCCAGGG + Intronic
1113744867 13:112737237-112737259 GTGGACCCTCCCACCTGCCAAGG - Intronic
1113815233 13:113165112-113165134 GAGCGCTCTGTTACCTGCCACGG - Exonic
1118757530 14:68855713-68855735 GTGGGCTCCCTTACCAGACACGG - Intergenic
1118770583 14:68940151-68940173 GTGTGCTCTCAGACCTGCAAGGG - Intronic
1119324294 14:73750498-73750520 TTGGGCTCTCTTGGCTTCCAGGG - Intronic
1120080438 14:80210422-80210444 GTGGTCTCCCTTACCTGCTCAGG - Intronic
1121690622 14:95875608-95875630 GTAGGCCCTCTAACCTGCCTCGG - Intergenic
1123962917 15:25425182-25425204 GTGGGTTCTTTTACTTACCATGG - Intronic
1125737502 15:41937454-41937476 GTGAGCTCTCTAGCCAGCCAAGG - Intronic
1126581478 15:50246167-50246189 GTGGTCACTCTAACCTGGCAAGG - Intronic
1127785519 15:62351618-62351640 GTGGGCTCTCTGACCTGGCAGGG + Intergenic
1128877060 15:71210547-71210569 TTGGGCTCTGTTAGTTGCCAAGG + Intronic
1130647662 15:85742980-85743002 CTGGGTTCTCTTAGCTGCCTGGG - Intronic
1132867079 16:2098551-2098573 GTGGCCTCTGGTTCCTGCCACGG + Intronic
1134016040 16:10889152-10889174 AAGGGCTCTCTCTCCTGCCACGG + Intronic
1134524698 16:14934564-14934586 GTGGCCTCTGGTTCCTGCCACGG - Intronic
1134548210 16:15126377-15126399 GTGGCCTCTGGTTCCTGCCACGG + Intronic
1134712286 16:16333051-16333073 GTGGCCTCTGGTTCCTGCCACGG - Intergenic
1134720143 16:16376345-16376367 GTGGCCTCTGGTTCCTGCCACGG - Intergenic
1134947284 16:18335540-18335562 GTGGCCTCTGGTTCCTGCCACGG + Intronic
1134954542 16:18375643-18375665 GTGGCCTCTGGTTCCTGCCACGG + Intergenic
1137690761 16:50425587-50425609 GAGGGCTCACTGACCAGCCACGG - Intergenic
1138473153 16:57254519-57254541 GTGAGCTCTCTAACTTGCCTGGG + Intronic
1138505797 16:57477725-57477747 GCCGGCTCTCCTACCTGCCAGGG - Intronic
1139251958 16:65505271-65505293 TTGGGCTCTCTGCCCTGCCAGGG + Intergenic
1142064316 16:88052066-88052088 TTGGGCACTCTTAACAGCCAAGG + Intronic
1143510780 17:7394090-7394112 TTGCGCGCACTTACCTGCCATGG + Exonic
1144864300 17:18324988-18325010 GTGGGCTCCCTTATCTGTTACGG + Intergenic
1149340316 17:55679254-55679276 GTAGGGTCTCTTACATGCCCTGG - Intergenic
1151261293 17:72917978-72918000 ATCGGCACTGTTACCTGCCAGGG + Intronic
1151474316 17:74337122-74337144 GTGGGCACTCTTGCCGGGCACGG - Intronic
1151529662 17:74696181-74696203 GGGGGCTATCTTACCTGCTCTGG + Exonic
1151880036 17:76889293-76889315 GTGGGCTCAGTCACCTCCCATGG - Intronic
1152718035 17:81909195-81909217 GGTGGCTCTCTTCCCTGCGAGGG + Intronic
1152747614 17:82048631-82048653 GTGGGCTCCCTCAGGTGCCACGG - Exonic
1152786812 17:82252526-82252548 CTGGGCTCTCTCCCCTGGCAGGG - Exonic
1154064581 18:11095057-11095079 AAGGGCTCTCATTCCTGCCAGGG + Intronic
1156503367 18:37574076-37574098 GTGGGGGCTCCTACCTGACATGG - Intergenic
1157414379 18:47489844-47489866 TTGGGCTCTCCTACCTTCAATGG + Intergenic
1157696901 18:49730372-49730394 GTACGCTCTCTGACCTTCCATGG + Intergenic
1160806057 19:992642-992664 GTGGGCTCCCTTACCTTCTGAGG + Intronic
1161096745 19:2396504-2396526 GTGGGCTCTCTCACGGGCCCTGG + Intronic
1161434120 19:4251748-4251770 AGGGGCTCTCTTTCCTGCCTTGG - Intronic
1161762363 19:6183439-6183461 GTGGGCTCTCTTACCATCCAGGG - Intronic
1166855003 19:45778996-45779018 GGGGGGTCTCTTACCTGGAATGG - Intronic
1167424960 19:49425481-49425503 CTGGGGTCTCTTACCTGCTCTGG - Exonic
1168722393 19:58561299-58561321 CTGGGGTCTCTTAGCTGGCAGGG - Intergenic
931577565 2:63735249-63735271 TTGGTCTCTCTTAACTGCAAGGG - Intronic
934560863 2:95312680-95312702 GTGACCTCTCTGAGCTGCCATGG - Intronic
942845924 2:180425206-180425228 GAGGGCTCTTGTACCTCCCATGG - Intergenic
948076172 2:235166861-235166883 TTGGGCTCCTTTACCTGCCAGGG - Intergenic
948587200 2:239026878-239026900 CGGGGCTCTCTTCCCCGCCAGGG + Intergenic
948880262 2:240853228-240853250 GTGGCCTCTCTGATCTGCCAGGG + Intergenic
1168898189 20:1338286-1338308 GCAGGCTCTCCTAGCTGCCATGG - Intronic
1169292718 20:4366365-4366387 CTGGGCTTTCTCACCTGCCTGGG - Intergenic
1170788191 20:19485967-19485989 GTGGGCACTGTTACCTGCAAGGG + Intronic
1173339044 20:42137534-42137556 CTGTGGTCTCTTGCCTGCCAGGG - Intronic
1175289625 20:57866952-57866974 GTTGGCGTTCCTACCTGCCATGG + Intergenic
1175382085 20:58570330-58570352 GTGGGCTCACCGACCTGCCATGG + Intergenic
1177770193 21:25505347-25505369 ATGGGCACTCCTACCTGCAAGGG + Intergenic
1179795151 21:43778220-43778242 GTCCTTTCTCTTACCTGCCAGGG + Intergenic
1180238418 21:46480552-46480574 GTGGGCTTTCCCAGCTGCCATGG + Intronic
1180968230 22:19801476-19801498 CTGGGCTCTCCTAGCTGGCATGG - Intronic
1183442109 22:37829158-37829180 CTGAGCTCTCTTTCCTGCCCTGG + Intergenic
1183733672 22:39631870-39631892 GTGGCCCCTCTTCCCTGGCAAGG + Intronic
1184301895 22:43566298-43566320 GTGGGATCTCTTACCACACAAGG + Intronic
1184609474 22:45593603-45593625 CTTGTCTGTCTTACCTGCCAGGG - Intronic
950035720 3:9883881-9883903 GTGGGCTCCCTGAGCAGCCATGG - Intergenic
954145947 3:48634370-48634392 GAGGGATCTCTGACCTACCAGGG + Intronic
954562262 3:51567312-51567334 GCAGGGTCTCTTAACTGCCAAGG + Intronic
955338248 3:58104754-58104776 GTGGACTCTCTCACTTTCCAGGG + Intronic
956314281 3:67916688-67916710 GTTAGTTCTCTTTCCTGCCAAGG + Intergenic
961627748 3:128275494-128275516 TTGGGCTCTGATACCTGTCAGGG - Intronic
961782752 3:129330572-129330594 CTGGGCTCTCTTACCCTCCCTGG + Intergenic
962271472 3:133980733-133980755 GTGGGGTTTCCTTCCTGCCAGGG + Intronic
962323093 3:134407213-134407235 GTGGGCTCCCTGAGCTGCTATGG + Intergenic
962944358 3:140153799-140153821 GTGTTCTCTCTCACCTCCCATGG - Intronic
963002780 3:140698033-140698055 GAGGACTCTATTACATGCCATGG + Intronic
963600416 3:147373490-147373512 TTGGACTCTCTCACCTGCCAGGG + Intergenic
964410251 3:156390494-156390516 GTGGAGTTTCTTAGCTGCCAAGG - Intronic
970409877 4:15794339-15794361 GTAGTCTCCCTTATCTGCCAGGG - Intronic
971259607 4:25044120-25044142 ATGGGCTCTTATTCCTGCCAAGG - Intergenic
971992539 4:33918180-33918202 GTGGGCTCACATACTTTCCAAGG + Intergenic
976543250 4:86302543-86302565 TTGAGTTCTCTCACCTGCCAGGG + Intronic
978321484 4:107500713-107500735 ATTGGCTCTTTTTCCTGCCAGGG + Intergenic
979596855 4:122543836-122543858 GGGGACTCTCTTGCCTGCCAAGG - Intergenic
980541910 4:134206986-134207008 TTGGGCACTCTCACCTGCCAGGG - Intergenic
986753433 5:10811508-10811530 ATGGGTTATCTTACCTGCCCAGG + Intergenic
989110822 5:37905277-37905299 GTGGTATCTCTTACCTACCTGGG - Intergenic
990718050 5:58660830-58660852 GGGCGCACTCTTACCTGGCATGG + Intronic
990830780 5:59954690-59954712 AAGTGCTCTCTTACCTGACATGG - Intronic
994263669 5:97689126-97689148 CTAGGCTCTCTTACCTCACAGGG + Intergenic
996948142 5:129094610-129094632 GCGCGCTCTCTTACCCGCCCCGG - Intergenic
1002419353 5:179137640-179137662 GTGGGCTCTCCTGCCAGCCCAGG + Intronic
1003251330 6:4431430-4431452 GAGGGCTCCCTCGCCTGCCAAGG + Intergenic
1005520904 6:26599465-26599487 GAGGACTCTATGACCTGCCATGG - Exonic
1005577696 6:27205419-27205441 GTGGACCCTATTACCTACCATGG + Intergenic
1007844539 6:44742412-44742434 GTGGTCTCTCTTACCTGGCTTGG + Intergenic
1010939388 6:81897758-81897780 GTGGGTTCTCTTTCCTTCCCAGG - Intergenic
1014688825 6:124536002-124536024 GCCTGCTCTCTGACCTGCCATGG - Intronic
1015786164 6:136922859-136922881 GGGGGCCCGCTCACCTGCCAGGG - Exonic
1016616502 6:146054884-146054906 GTTGTCTCTCTTATCTGCTATGG + Intronic
1016623790 6:146142791-146142813 GTGGGCTCTCTTCTCACCCAGGG + Intronic
1018070582 6:160161182-160161204 TTGGGCTCTCTTACCAGCCGAGG - Intergenic
1020153481 7:5702132-5702154 GTGGGCTCTGCCACCTGCCGGGG + Intronic
1022881721 7:34594927-34594949 GTGGGCTCTCCCACTTGCAATGG + Intergenic
1024093949 7:45969737-45969759 ATGGGCTGTCTCAGCTGCCAGGG - Intergenic
1024658716 7:51473572-51473594 GTGGTCCCTCTTCCATGCCAGGG + Intergenic
1024975826 7:55112754-55112776 GAGGGCTCTGTAACCGGCCAAGG + Intronic
1029825311 7:103186857-103186879 GTGGGCTCTCTTCCAGCCCAGGG - Intergenic
1036374338 8:8187522-8187544 GTGGGCTCTGCTGGCTGCCAGGG - Intergenic
1037615180 8:20512612-20512634 GATGGCTCTATTACCTGCTAAGG - Intergenic
1039735077 8:40323212-40323234 GAGGGTTATCTTACCTGACACGG + Intergenic
1040074196 8:43212949-43212971 GTGGGCTTTATTACCCACCAAGG + Intergenic
1044208669 8:89522962-89522984 GAGGACTCTCTTACCCTCCAGGG + Intergenic
1044839751 8:96327610-96327632 GTGCGCTCTCTTACCAGGCCAGG - Intronic
1047224298 8:122943580-122943602 TTGGCCTCTCTTCCCTACCATGG - Intronic
1047927527 8:129696037-129696059 CTGGGCTCTCTGCCTTGCCATGG - Intergenic
1049767837 8:144363189-144363211 GTGGGCTATCCTGCCTCCCAGGG - Intergenic
1056237971 9:84614885-84614907 GTGTGCTCTCTTCCTTGCCAGGG - Intergenic
1059452978 9:114382306-114382328 GTGAGCTCTCCTACCTGGCCTGG - Intronic
1060527978 9:124331356-124331378 GTGGTCTCTCTTACTTCCCTGGG - Intronic
1062056894 9:134473503-134473525 GTGGGCTCCCTCACCTGGCCTGG + Intergenic
1062209093 9:135353594-135353616 GTGGGAACTCTGGCCTGCCAAGG - Intergenic
1185501545 X:600379-600401 GTGGGCTCTCTTTCCAAACAAGG - Intergenic
1186350402 X:8733167-8733189 CTGGGCTCTCCTACCTGCAAGGG - Intergenic
1193220087 X:78913784-78913806 GTGGGCTCTCTTCCAGCCCAGGG + Intergenic
1202115038 Y:21464495-21464517 GTGGCCTGTCTTATCTGGCAAGG + Intergenic