ID: 901079868

View in Genome Browser
Species Human (GRCh38)
Location 1:6577914-6577936
Sequence CAGGATACGACTGCTTTTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 71}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901079868 Original CRISPR CAGGATACGACTGCTTTTGT AGG (reversed) Intronic
901079868 1:6577914-6577936 CAGGATACGACTGCTTTTGTAGG - Intronic
901520657 1:9782555-9782577 CAGGATATGACTCATTTTTTAGG + Intronic
901580508 1:10238896-10238918 CAGCATACTGCTGCTTTTGATGG + Intronic
903332769 1:22604559-22604581 TAGGAAACAACTGGTTTTGTGGG - Intergenic
904679602 1:32219878-32219900 CAGTATACCATTTCTTTTGTTGG + Intronic
907508227 1:54937892-54937914 CAGGACCCTACTGGTTTTGTCGG - Intergenic
910066081 1:83152261-83152283 CAGAATTCGACTTCTTTTGTGGG - Intergenic
910408618 1:86915588-86915610 CTGGATACGAATTCTTTTGGGGG + Intronic
913065489 1:115249349-115249371 CAGGATATGGTTACTTTTGTAGG + Intergenic
915354207 1:155246158-155246180 CAGGATAGGATTGGTTGTGTTGG + Intergenic
917215667 1:172675701-172675723 CAGGAAAAGACTGCTTTTGGAGG + Intergenic
922033585 1:221826980-221827002 CAGGATGCCACTGCTGTTGGGGG + Intergenic
924659043 1:245999759-245999781 CAGGATACTACTGATCTTTTAGG + Intronic
1065209832 10:23392187-23392209 CAGGATAGGATTGCTGTTGTGGG - Intergenic
1067090775 10:43264943-43264965 CAGGATGGGACAGCTTTGGTTGG - Intronic
1067403854 10:46002615-46002637 CAGGAAACGACTGTTCTAGTTGG + Intronic
1068222418 10:54061102-54061124 CAGAATATGACTGCATTTGGGGG + Intronic
1069558534 10:69413642-69413664 CAGGAGAAGGCTGCTCTTGTGGG - Intronic
1076453191 10:130571082-130571104 CAGGGCTCGGCTGCTTTTGTGGG + Intergenic
1077410251 11:2400529-2400551 CCGGAAACGACGGCATTTGTTGG - Exonic
1079896522 11:26126258-26126280 CATGATAGGTCTGCCTTTGTCGG - Intergenic
1084985307 11:72865149-72865171 CAGATGACGAATGCTTTTGTTGG + Intronic
1090976746 11:131685929-131685951 CAGGATAGCACTTCTTATGTAGG - Intronic
1093557007 12:20488236-20488258 CAGGATAGGACTAATTTTGGAGG - Intronic
1096793277 12:54058357-54058379 TAGGATGCCACTGCTTTTGTAGG + Intergenic
1099298134 12:80856760-80856782 CAGGATACGACTGAAGTAGTAGG - Intronic
1107651813 13:42552598-42552620 AGGGATACGACTTCTTTTCTTGG - Intergenic
1111909693 13:94297097-94297119 CAGCATACCACTGCTTTTCTAGG + Intronic
1112325597 13:98441047-98441069 AGGGATATGACTGCATTTGTGGG - Intronic
1112410199 13:99156092-99156114 CAGGACACGACTGCTGCTCTTGG + Intergenic
1117445263 14:55798160-55798182 CAGCATACCGCTGCCTTTGTGGG + Intergenic
1117618578 14:57560274-57560296 CAGGAAACGATGGCTTCTGTAGG - Intergenic
1137960621 16:52878362-52878384 CAGGGAAAGACAGCTTTTGTAGG - Intergenic
1138373446 16:56545790-56545812 CAGGATACCACTATTTTTGCTGG - Intergenic
1138373703 16:56547838-56547860 CAGGTTACCACTACGTTTGTAGG - Intergenic
1150413703 17:64969534-64969556 CAGAAAAAGACTTCTTTTGTGGG - Intergenic
1150797927 17:68254104-68254126 CAGAAAAAGACTTCTTTTGTGGG + Intronic
1157425268 18:47579339-47579361 CAGGACAGGCCTGCTGTTGTGGG + Intergenic
929109151 2:38391882-38391904 CAGGATACGAATGCTAACGTTGG - Intergenic
934906821 2:98212281-98212303 CAGCAGACGTCTCCTTTTGTGGG - Intronic
937449818 2:121992833-121992855 CAGGATAAGACTGCATTCCTCGG - Intergenic
937684968 2:124685547-124685569 CACCATAAAACTGCTTTTGTTGG - Intronic
1169559489 20:6784712-6784734 CAGGTTACCATTGCTTTTGTCGG + Intergenic
1172202673 20:33137959-33137981 CAGGATAAGAATTCTGTTGTGGG - Intergenic
1182658320 22:31907036-31907058 CAGGATGGGACTGCTTCTGTGGG - Intergenic
1184471651 22:44699357-44699379 CAGGAGAGGACTGGCTTTGTGGG - Intronic
1184789443 22:46690323-46690345 GAGGATGCGACTGCTTGTGCAGG + Intronic
951510815 3:23500068-23500090 CAGGCTACGTCTGATTTTCTGGG - Intronic
956425625 3:69131601-69131623 CAGGAAGCAACTGCTCTTGTTGG + Intergenic
958095606 3:88940091-88940113 CATGGTAGGACTGATTTTGTAGG - Intergenic
963687037 3:148449273-148449295 AAGGATACTAGTCCTTTTGTTGG - Intergenic
966743846 3:183257260-183257282 CAGTATACATCTACTTTTGTTGG + Intronic
969655195 4:8493116-8493138 GAGGATCAGACTGCCTTTGTAGG + Intronic
978176588 4:105739663-105739685 AGGGGTATGACTGCTTTTGTTGG + Intronic
987537386 5:19206595-19206617 CTGGATACCACTGATTTTGCAGG - Intergenic
988145068 5:27294616-27294638 CAGAATATGACTGTTTTTGAAGG + Intergenic
993148546 5:84128965-84128987 GAGAATACGACTCCATTTGTTGG + Intronic
998025885 5:138815893-138815915 CAGTAGACGAATGCTTTTCTTGG + Intronic
1000490456 5:161906311-161906333 GAGAATAAGACTGATTTTGTGGG - Intergenic
1003123919 6:3340106-3340128 CTGGATAATACCGCTTTTGTGGG - Intronic
1009412255 6:63379319-63379341 GAGGAGACAACTGCTGTTGTTGG + Intergenic
1014947361 6:127514922-127514944 CAGGATCCGGCAGTTTTTGTTGG + Exonic
1019841861 7:3453955-3453977 CAATGTACGACTGGTTTTGTAGG + Intronic
1027278029 7:76582515-76582537 CAGAATTCGACTTCTTTTGTGGG + Intergenic
1030022162 7:105286260-105286282 CTGAATACGACTGGATTTGTAGG - Intronic
1030379828 7:108799576-108799598 GAGGATGCGACTGATATTGTTGG - Intergenic
1031399271 7:121312454-121312476 CAGGTTATGACTGCTTGTGATGG - Intergenic
1035446382 7:158945722-158945744 CAGGCTGCGTCTGCTTTTGCAGG + Exonic
1039731819 8:40287784-40287806 GGGGATTAGACTGCTTTTGTAGG - Intergenic
1043030791 8:75131115-75131137 CAGGATACAACTGCTTTCATGGG - Intergenic
1044512188 8:93095222-93095244 CAGGGTTGGAGTGCTTTTGTTGG + Intergenic
1048460343 8:134616092-134616114 CATGAAACACCTGCTTTTGTAGG - Intronic
1048944990 8:139437324-139437346 AAGTATTCAACTGCTTTTGTTGG - Intergenic
1051435343 9:17024781-17024803 CAGGATAGGACTTTTTTTCTGGG + Intergenic
1059730171 9:117049236-117049258 CAAGATACATCTGGTTTTGTGGG - Intronic
1059941080 9:119360618-119360640 CAGGATATGATTGCTTTTTGGGG - Intronic
1060389372 9:123266658-123266680 CAGGAAATGACTGCTTAAGTTGG - Intronic
1060613755 9:124992213-124992235 CAGCCTACAAATGCTTTTGTGGG + Intronic
1185616638 X:1425993-1426015 CAGGATGTGACTGTATTTGTAGG + Intronic
1194074784 X:89376497-89376519 CAGAAAAAGACTGGTTTTGTGGG - Intergenic
1200730384 Y:6730648-6730670 CAGAAAAAGACTGGTTTTGTGGG - Intergenic