ID: 901083215

View in Genome Browser
Species Human (GRCh38)
Location 1:6595371-6595393
Sequence GAGATGAGACCCACCCATCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 3, 3: 7, 4: 122}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901083214_901083215 -10 Left 901083214 1:6595358-6595380 CCTTCTATTAATTGAGATGAGAC 0: 1
1: 0
2: 0
3: 8
4: 125
Right 901083215 1:6595371-6595393 GAGATGAGACCCACCCATCATGG 0: 1
1: 0
2: 3
3: 7
4: 122
901083213_901083215 19 Left 901083213 1:6595329-6595351 CCTTAAGTGCAAAATAAGGGTAA 0: 1
1: 0
2: 3
3: 33
4: 325
Right 901083215 1:6595371-6595393 GAGATGAGACCCACCCATCATGG 0: 1
1: 0
2: 3
3: 7
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901083215 Original CRISPR GAGATGAGACCCACCCATCA TGG Intronic
900122728 1:1055749-1055771 AAGATGAGACCCACCACTCCAGG - Exonic
901083215 1:6595371-6595393 GAGATGAGACCCACCCATCATGG + Intronic
902510637 1:16965304-16965326 GAGACGAGGCCCAGCCCTCATGG + Intronic
902864387 1:19268807-19268829 GAGAGGACACCCGCCCCTCAGGG - Intergenic
902869622 1:19306253-19306275 GAGAGGACACCCGCCCCTCAGGG - Intronic
903007384 1:20307653-20307675 AAGATGAGACCCAGCCCACATGG - Intronic
903751046 1:25620985-25621007 GAGAGGAGACCCACAGAACATGG + Intronic
904798154 1:33072982-33073004 GAGCTGAGAAACACCCAACAGGG - Intronic
910379385 1:86609484-86609506 CAGCTGACACCCACCCATGAAGG - Intergenic
916079572 1:161224002-161224024 GAGATGAGATCTACCCATAATGG - Intergenic
918156270 1:181849680-181849702 GAGGTGAAACCCACTCATCTGGG - Intergenic
923341791 1:233013894-233013916 GGGTTGAGAACCACTCATCAAGG + Intronic
1064521671 10:16209507-16209529 GACCTGAGACTCACCCTTCAGGG + Intergenic
1065031307 10:21589008-21589030 GAGATGGGATCCACCCACCTTGG + Intronic
1067204287 10:44200138-44200160 GAGGTGAGACCCAACCCTGATGG - Intergenic
1069605043 10:69733560-69733582 GAGATGAGCCCCAGGCATGAGGG - Intergenic
1070785713 10:79161094-79161116 CAGCTGAGCCCCACCCAACAAGG + Intronic
1076681199 10:132172287-132172309 GTGATGAAACACACCCATCTCGG - Intronic
1076859788 10:133135405-133135427 GAGACCAGACCCCCCCAACAGGG - Intergenic
1076860934 10:133138535-133138557 GAGACCAGACCCCCCCAACAGGG - Intergenic
1077118128 11:894619-894641 GGGAGGAGACCCACCCCTTAGGG + Intronic
1084519816 11:69656317-69656339 GTGTACAGACCCACCCATCACGG - Intronic
1091828848 12:3535136-3535158 GAAATCCGACCCACCCTTCAAGG + Intronic
1092731380 12:11538425-11538447 CAGATCAGCCCCTCCCATCAGGG + Intergenic
1095539431 12:43291405-43291427 GCCATGAGACCCACCAAACATGG - Intergenic
1101764207 12:107683258-107683280 CAGCTGAGACCCAGCCATCATGG - Intergenic
1101824506 12:108209913-108209935 GACAGGAGACCCACCCATTGTGG - Intronic
1102036766 12:109775055-109775077 GAAATGAGACCCAGCCACCCAGG - Intergenic
1103578877 12:121899609-121899631 GGGATGAGAACCACACATCAGGG - Intronic
1104587777 12:130061393-130061415 GAGACGAGACTGCCCCATCATGG - Intergenic
1111626279 13:90792043-90792065 GAGATGAGGTCCATCCCTCAAGG - Intergenic
1120697827 14:87664270-87664292 GAGATGAAATCCAGCTATCAGGG + Intergenic
1121369914 14:93347397-93347419 GAGTTGAGGCCCAGCCATCATGG + Intronic
1122005679 14:98701600-98701622 CAGAGGATACCCATCCATCATGG + Intergenic
1124657642 15:31522231-31522253 CAGATGAGCCCCACCCATATTGG - Intronic
1124721710 15:32116382-32116404 GACTTGTTACCCACCCATCAAGG - Intronic
1129445261 15:75612540-75612562 TAGATGAGATCCACCCCTAATGG - Intronic
1142032777 16:87846749-87846771 AAGCTGAGACCCACCCACCCAGG + Intronic
1142497279 17:312943-312965 CAGATGAGTCCCTCCCATCTGGG + Intronic
1144434541 17:15228638-15228660 ATGATGGGACCCACCCATCATGG - Intergenic
1144627313 17:16850821-16850843 GAGATGACAACCCCCCAGCACGG + Intergenic
1144879125 17:18421891-18421913 GAGATGACAACCCCCCAGCACGG - Intergenic
1145153109 17:20522496-20522518 GAGATGACAACCCCCCAGCACGG + Intergenic
1147581448 17:41629497-41629519 GAGATGACAACCCCCCAGCACGG + Intergenic
1147792288 17:43021367-43021389 GAGACGAGACACGCCCATCACGG - Intronic
1148353480 17:46958081-46958103 GAGAGGAGACCCACTCTCCATGG - Intronic
1151998970 17:77632789-77632811 TAGATGAGGCCCACTCATGATGG - Intergenic
1152263569 17:79280437-79280459 AATGTGAGGCCCACCCATCAAGG + Intronic
1152584759 17:81183920-81183942 GGGAAGACACCCGCCCATCAGGG + Intergenic
1158840130 18:61377071-61377093 GACATGAGTCCCACCCAGCTTGG + Intronic
1160027354 18:75229331-75229353 GAGATGAGACGCATCAATCCTGG - Intronic
1164751415 19:30657862-30657884 GAGATGACACCCATTCCTCAGGG - Intronic
1166143468 19:40818666-40818688 GCGATGAGGCCCACCCATGTGGG - Intronic
1167735595 19:51292805-51292827 GATATGACACCCCCACATCAAGG - Intergenic
1168635898 19:57996636-57996658 GAGATGAGAGGGACCCTTCAAGG + Intronic
927511685 2:23647981-23648003 GAGCTGAGAATCACCCACCAGGG + Intronic
927602094 2:24452330-24452352 GAAAAGAAACCAACCCATCAAGG - Intergenic
928117079 2:28553275-28553297 GAGAACAAATCCACCCATCAAGG - Intronic
936911787 2:117601275-117601297 GAGGTGAGAGCCACACCTCAAGG + Intergenic
937022792 2:118673524-118673546 GAGGTGAGAACCACCTGTCAGGG + Intergenic
940061353 2:149573166-149573188 GAGATGAGACCAAACCACAATGG + Intronic
942750097 2:179277232-179277254 GACCTGAGACTCACCCTTCAGGG - Intergenic
945474955 2:210270834-210270856 GAGATGAGTTGCAACCATCATGG + Intergenic
946613267 2:221481943-221481965 GAGATGAATCCCATCCAGCATGG + Intronic
1170601044 20:17841888-17841910 GAGCTGAGACCCAGCCATCACGG - Intergenic
1172061821 20:32191599-32191621 GTGCTGAGATCCTCCCATCAGGG - Intergenic
1173300656 20:41799533-41799555 GAGATGGGACCCAGCAATCTGGG - Intergenic
1175139635 20:56850688-56850710 GACATGTGACACACCTATCACGG - Intergenic
1175530450 20:59671285-59671307 GAGAGGAGGCTCACCCAGCATGG - Intronic
1175731999 20:61360517-61360539 GAGATGAGACCCTCCCGCCTAGG + Intronic
1177893015 21:26828981-26829003 CAGATGAGACCCATCCATACTGG - Intergenic
1177893762 21:26837650-26837672 GAGATAACACCCCTCCATCATGG + Exonic
1178405165 21:32317540-32317562 GAGATGGGACACATCCATCTTGG - Intronic
1178730386 21:35096846-35096868 CAGATGTGAGCTACCCATCAGGG + Intronic
1181169001 22:20997882-20997904 CAGGTGAGACCCATACATCATGG - Exonic
1182115901 22:27756235-27756257 GAGATGCCACCCACCCATAGAGG + Intronic
1183042470 22:35192641-35192663 GAGATGGGAACCAGCCATGAGGG + Intergenic
1184160375 22:42694004-42694026 GAGATGAGCACCCGCCATCAGGG + Intronic
1184253710 22:43275405-43275427 GAGATGAGACCATCTCATGAGGG - Intronic
1184381753 22:44149123-44149145 GAGATGTTACCCACCTCTCAGGG + Intronic
1184870117 22:47232449-47232471 GAGATGAAACCCACCCCTCATGG - Intergenic
950312050 3:11967301-11967323 TAGATGACACCCACCCATATTGG - Intergenic
950426270 3:12926376-12926398 GAGAGGACACCCATCCTTCAGGG - Intronic
952113668 3:30154303-30154325 CAAATGAGACCTAACCATCATGG + Intergenic
954684803 3:52364722-52364744 GAGGTGAGCTCCACCCAGCAGGG + Exonic
960952452 3:123008497-123008519 CAGATCCCACCCACCCATCAGGG - Intronic
961749103 3:129085285-129085307 GGGATGAGCCCGACCCACCACGG + Intergenic
962007109 3:131360665-131360687 GAGATGATACCAACCTATTAGGG - Intergenic
962009474 3:131380381-131380403 GAGATGATACCAACCTATTAGGG - Intergenic
962193462 3:133335980-133336002 TAGCCGACACCCACCCATCAAGG + Intronic
962251417 3:133838319-133838341 GAGGAGGGACCCACCCAGCAGGG + Intronic
962308067 3:134306479-134306501 GAGCTGGGAACCACCCACCATGG - Intergenic
973573700 4:52265181-52265203 GAGATGAACCCCACCCAACCAGG - Intergenic
975109013 4:70602367-70602389 GAGATGAGGCACATCTATCATGG - Intronic
978668176 4:111211800-111211822 GAGAAGAGGCCCTCCCAGCAGGG - Intergenic
986463237 5:7994649-7994671 GAGATGGGCCCCACCCTTGAGGG + Intergenic
990538915 5:56752708-56752730 TGGATGAGACCCACTCATCCTGG - Intergenic
990740003 5:58902857-58902879 AAGATGAGAAGCACCCATAAGGG + Intergenic
994666245 5:102708925-102708947 AAGATGATCCCCATCCATCAAGG - Intergenic
995814618 5:116153427-116153449 TAGATCAGCCCCACCCATCCAGG - Intronic
997833482 5:137173087-137173109 GAGATGAGAGGCAAGCATCATGG - Intronic
1000429405 5:161133582-161133604 CAGATGAGACCCACCCACATTGG + Intergenic
1000768896 5:165326328-165326350 GAGAAGAGACTCACACAGCAAGG - Intergenic
1003150674 6:3546284-3546306 CAGATGAGACCCACCCATCTTGG + Intergenic
1004868032 6:19873480-19873502 AAGAAGACACCCACACATCAGGG - Intergenic
1006432841 6:34008272-34008294 GAGATGAGACCCACAGAAAAAGG - Intergenic
1006502870 6:34469331-34469353 CACATCAGACCCACCCACCATGG + Intronic
1008078361 6:47169439-47169461 GGGATGAGGTCCACCCATCCTGG + Intergenic
1008715504 6:54284470-54284492 GAGATGAGCCCCAGCAGTCAGGG - Intergenic
1013373806 6:109494612-109494634 CAGATGAGGCCCACCCATAGGGG - Intronic
1017960759 6:159218628-159218650 GACATAAGGCCCACCCCTCAAGG - Intronic
1020078883 7:5275883-5275905 AAAATGAGACCCAACCATCTGGG - Intronic
1021469286 7:20983016-20983038 GAGATGACACCTACCCCACAGGG + Intergenic
1035827414 8:2659741-2659763 GAGATCAGCCCCACCCACAATGG + Intergenic
1045152371 8:99423543-99423565 TAGATGTGAGCCACCCACCATGG + Intronic
1045508424 8:102794792-102794814 GGGATGAGAAACATCCATCAGGG + Intergenic
1048757000 8:137750627-137750649 GGGATGAGACCCACCCACATTGG + Intergenic
1050952779 9:11618471-11618493 GAGTTGAGGCCCGCCCCTCATGG - Intergenic
1052716848 9:32128286-32128308 TAGATGGGAACCTCCCATCACGG - Intergenic
1056455620 9:86756712-86756734 GAGATGAGAGGCACACATGAGGG - Intergenic
1056786747 9:89597990-89598012 GAAAAGAGACCCCACCATCAGGG - Intergenic
1058802331 9:108556825-108556847 GAGTTGAGAACCACCAATCTAGG + Intergenic
1060668860 9:125450866-125450888 GAGAGGAGACCCAACCAGGAGGG - Intronic
1062011583 9:134269944-134269966 GTGATGGGACGCACCCTTCATGG + Intergenic
1185603124 X:1353318-1353340 GTCATGGGACCCCCCCATCATGG + Intronic
1186476834 X:9864133-9864155 GAAATGTGACCCATCCAGCAAGG - Intronic
1186600941 X:11036515-11036537 GAAATGACACCCACCACTCAGGG - Intergenic
1190998873 X:55637922-55637944 GAGAGGAGACACACTCTTCAGGG + Intergenic
1194935342 X:99940872-99940894 GAGATGTGAGCCTCCAATCATGG + Intergenic
1197219811 X:123901072-123901094 AAGATGAGACCCCCCCATGATGG - Intronic
1197844870 X:130790816-130790838 GAGAGGGGAACTACCCATCAGGG + Intronic
1199227390 X:145394023-145394045 CGGTTCAGACCCACCCATCATGG - Intergenic
1201573868 Y:15441169-15441191 GAGATGAGACCCAGCCAGGGAGG + Intergenic