ID: 901083627

View in Genome Browser
Species Human (GRCh38)
Location 1:6597602-6597624
Sequence AGTGAGCACCAAGAAGAACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 270
Summary {0: 1, 1: 0, 2: 3, 3: 30, 4: 236}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901083627_901083641 20 Left 901083627 1:6597602-6597624 CCCTGTTCTTCTTGGTGCTCACT 0: 1
1: 0
2: 3
3: 30
4: 236
Right 901083641 1:6597645-6597667 CTCCTGTCTGGGGGGATGGTGGG 0: 1
1: 0
2: 2
3: 13
4: 269
901083627_901083642 21 Left 901083627 1:6597602-6597624 CCCTGTTCTTCTTGGTGCTCACT 0: 1
1: 0
2: 3
3: 30
4: 236
Right 901083642 1:6597646-6597668 TCCTGTCTGGGGGGATGGTGGGG 0: 1
1: 0
2: 2
3: 39
4: 401
901083627_901083636 11 Left 901083627 1:6597602-6597624 CCCTGTTCTTCTTGGTGCTCACT 0: 1
1: 0
2: 3
3: 30
4: 236
Right 901083636 1:6597636-6597658 GTAAGGAGCCTCCTGTCTGGGGG 0: 1
1: 0
2: 2
3: 13
4: 160
901083627_901083634 9 Left 901083627 1:6597602-6597624 CCCTGTTCTTCTTGGTGCTCACT 0: 1
1: 0
2: 3
3: 30
4: 236
Right 901083634 1:6597634-6597656 TGGTAAGGAGCCTCCTGTCTGGG 0: 1
1: 0
2: 1
3: 7
4: 148
901083627_901083637 12 Left 901083627 1:6597602-6597624 CCCTGTTCTTCTTGGTGCTCACT 0: 1
1: 0
2: 3
3: 30
4: 236
Right 901083637 1:6597637-6597659 TAAGGAGCCTCCTGTCTGGGGGG 0: 1
1: 0
2: 0
3: 16
4: 167
901083627_901083633 8 Left 901083627 1:6597602-6597624 CCCTGTTCTTCTTGGTGCTCACT 0: 1
1: 0
2: 3
3: 30
4: 236
Right 901083633 1:6597633-6597655 CTGGTAAGGAGCCTCCTGTCTGG 0: 1
1: 0
2: 2
3: 16
4: 116
901083627_901083638 16 Left 901083627 1:6597602-6597624 CCCTGTTCTTCTTGGTGCTCACT 0: 1
1: 0
2: 3
3: 30
4: 236
Right 901083638 1:6597641-6597663 GAGCCTCCTGTCTGGGGGGATGG 0: 1
1: 0
2: 1
3: 26
4: 250
901083627_901083635 10 Left 901083627 1:6597602-6597624 CCCTGTTCTTCTTGGTGCTCACT 0: 1
1: 0
2: 3
3: 30
4: 236
Right 901083635 1:6597635-6597657 GGTAAGGAGCCTCCTGTCTGGGG 0: 1
1: 0
2: 1
3: 14
4: 201
901083627_901083640 19 Left 901083627 1:6597602-6597624 CCCTGTTCTTCTTGGTGCTCACT 0: 1
1: 0
2: 3
3: 30
4: 236
Right 901083640 1:6597644-6597666 CCTCCTGTCTGGGGGGATGGTGG 0: 1
1: 0
2: 3
3: 42
4: 358
901083627_901083630 -6 Left 901083627 1:6597602-6597624 CCCTGTTCTTCTTGGTGCTCACT 0: 1
1: 0
2: 3
3: 30
4: 236
Right 901083630 1:6597619-6597641 CTCACTCCAAAAGCCTGGTAAGG 0: 1
1: 0
2: 0
3: 7
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901083627 Original CRISPR AGTGAGCACCAAGAAGAACA GGG (reversed) Intronic