ID: 901084596

View in Genome Browser
Species Human (GRCh38)
Location 1:6602879-6602901
Sequence TAGGCACCGCTGCTATAAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 50
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 48}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901084591_901084596 11 Left 901084591 1:6602845-6602867 CCGCGGCCGGGGCCTGCGGAGAG 0: 1
1: 0
2: 2
3: 24
4: 274
Right 901084596 1:6602879-6602901 TAGGCACCGCTGCTATAAATAGG 0: 1
1: 0
2: 0
3: 1
4: 48
901084592_901084596 5 Left 901084592 1:6602851-6602873 CCGGGGCCTGCGGAGAGACGCGG 0: 1
1: 0
2: 2
3: 19
4: 181
Right 901084596 1:6602879-6602901 TAGGCACCGCTGCTATAAATAGG 0: 1
1: 0
2: 0
3: 1
4: 48
901084594_901084596 -1 Left 901084594 1:6602857-6602879 CCTGCGGAGAGACGCGGCGCGCT 0: 1
1: 0
2: 1
3: 2
4: 41
Right 901084596 1:6602879-6602901 TAGGCACCGCTGCTATAAATAGG 0: 1
1: 0
2: 0
3: 1
4: 48

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901084596 Original CRISPR TAGGCACCGCTGCTATAAAT AGG Intronic
901084596 1:6602879-6602901 TAGGCACCGCTGCTATAAATAGG + Intronic
903450241 1:23448831-23448853 TAGGCTCCTCTTCTATAAAATGG - Intronic
913413577 1:118579761-118579783 TGGGGACCCCTGCTATAACTAGG + Intergenic
919225797 1:194699203-194699225 TAGGCACTGCTGCTCTAGACAGG + Intergenic
1065598293 10:27339627-27339649 CAGGCACTCCTGCTCTAAATGGG + Intergenic
1067318360 10:45192629-45192651 CAGGCACACCTGCTCTAAATGGG + Intergenic
1073532055 10:104241283-104241305 TGGTCATCGCTGCTATAAAAGGG - Intronic
1089996004 11:122908169-122908191 TAGGAACCACTGCTCTAGATCGG - Intronic
1105224342 13:18415396-18415418 CAGGCACTCCTGCTCTAAATGGG - Intronic
1108436659 13:50407290-50407312 TAGCCACTGCTCCTATAACTTGG + Intronic
1110380998 13:74850636-74850658 TATGCAGCTCAGCTATAAATAGG - Intergenic
1114008435 14:18339903-18339925 CAGGCACTCCTGCTCTAAATGGG - Intergenic
1126560662 15:50040283-50040305 TAGCCACAGCTGCTACAAACAGG + Intronic
1141349428 16:83279511-83279533 TGGAAACCGCTGCTAAAAATGGG + Intronic
1145117042 17:20220420-20220442 TACTCACAGCTACTATAAATGGG + Intronic
1146003773 17:29148253-29148275 TAAGCACTGTTGCCATAAATGGG + Intronic
1154475653 18:14754175-14754197 CAGGCACTCCTGCTCTAAATGGG - Intronic
1164567707 19:29339680-29339702 CAGGCACTGCAGCTATAATTGGG - Intergenic
934632997 2:95950543-95950565 TAGGCAACTCTGCTTTAAAGAGG - Intronic
934633413 2:95956580-95956602 TAGGCAACTCTGCTTTAAAGAGG - Intronic
934800089 2:97146700-97146722 TAGGCAACTCTGCTTTAAAGAGG + Intronic
934800507 2:97152707-97152729 TAGGCAACTCTGCTTTAAAGAGG + Intronic
938528113 2:132155457-132155479 CAGGCACTCCTGCTCTAAATGGG + Intronic
940896075 2:159082648-159082670 TAGGGACCGTTGCTGTAAACAGG + Intronic
944957077 2:204824305-204824327 TCTGCACAGCTGCAATAAATAGG + Intronic
948498161 2:238368352-238368374 TATGCATCACTGCTATAAATAGG - Intronic
1173407151 20:42776325-42776347 AAGGCCCTGCTGCTAAAAATAGG - Intronic
1174393947 20:50234463-50234485 CAGGCAGCTCTGCTATAGATGGG - Intergenic
1176768383 21:13044452-13044474 CAGGCACTCCTGCTCTAAATGGG - Intergenic
1180021498 21:45131186-45131208 TAGGCACTGCTGCTTTCACTCGG + Intronic
1180432941 22:15270720-15270742 CAGGCACTCCTGCTCTAAATGGG - Intergenic
1180515518 22:16138639-16138661 CAGGCACTCCTGCTCTAAATGGG - Intergenic
977855519 4:101886028-101886050 TAGGCAGCTCTGTTATAATTTGG + Intronic
978556664 4:109988529-109988551 TAGGCAATCCTGATATAAATGGG - Intronic
985035819 4:185838967-185838989 CAGGCACCGCTGCTTTCCATGGG + Intronic
990256857 5:53979607-53979629 CTGGCACCTCTGCTAAAAATAGG - Intronic
998217238 5:140246465-140246487 TAGCCACTGCAGCTATAAAATGG + Intronic
1000132460 5:158313274-158313296 CAGGCACCGCTGCAATCAACAGG - Intergenic
1007279188 6:40697886-40697908 CAGGCTCCGCTTCTATAAAGTGG + Intergenic
1023285998 7:38620470-38620492 TAGGCAGTGCTGCCATAAGTTGG + Intronic
1047627736 8:126673783-126673805 TAGGAACAACTGCTATATATAGG + Intergenic
1053706732 9:40761789-40761811 CAGGCACTTCTGCTCTAAATGGG + Intergenic
1054416646 9:64882559-64882581 CAGGCACTTCTGCTCTAAATGGG + Intergenic
1055399280 9:75905910-75905932 TGGGGACCACTGCTTTAAATGGG + Intronic
1058847981 9:108981040-108981062 GAGGCAGAGCTGTTATAAATAGG - Intronic
1059027269 9:110648581-110648603 TAGGCAGAGCTGATATTAATTGG - Intergenic
1061705830 9:132452354-132452376 TGGGCACTGATGTTATAAATAGG + Intronic
1193970034 X:88039534-88039556 GAGGCAGGGCTGCTATAAGTAGG - Intergenic
1194487836 X:94507690-94507712 TAGGCAATGCTGCTGTTAATGGG - Intergenic
1202586965 Y:26440984-26441006 TAGGCAACTCTGCTTTAAAGAGG + Intergenic