ID: 901086123

View in Genome Browser
Species Human (GRCh38)
Location 1:6613472-6613494
Sequence TGCGGGGGCCCGCGCCGGCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 141}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901086123_901086138 30 Left 901086123 1:6613472-6613494 CCGAGCCGGCGCGGGCCCCCGCA 0: 1
1: 0
2: 1
3: 12
4: 141
Right 901086138 1:6613525-6613547 AAGACCCGCCTCCACACACCGGG 0: 1
1: 0
2: 0
3: 10
4: 113
901086123_901086137 29 Left 901086123 1:6613472-6613494 CCGAGCCGGCGCGGGCCCCCGCA 0: 1
1: 0
2: 1
3: 12
4: 141
Right 901086137 1:6613524-6613546 GAAGACCCGCCTCCACACACCGG 0: 1
1: 0
2: 0
3: 13
4: 108
901086123_901086129 -5 Left 901086123 1:6613472-6613494 CCGAGCCGGCGCGGGCCCCCGCA 0: 1
1: 0
2: 1
3: 12
4: 141
Right 901086129 1:6613490-6613512 CCGCACCTCCCCCGCTCGCGCGG 0: 1
1: 0
2: 0
3: 11
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901086123 Original CRISPR TGCGGGGGCCCGCGCCGGCT CGG (reversed) Intronic
900096013 1:940391-940413 TGCGGGCGGCCGCGCCGGCTGGG + Intronic
900103293 1:971872-971894 CGCGGGGGCCTTCGCCGGCTAGG - Intronic
900190838 1:1351539-1351561 TGCTGGGGGCTGCACCGGCTCGG + Intergenic
900514314 1:3073990-3074012 CGCGGGAGCGCGCGCCGCCTGGG + Intronic
901086123 1:6613472-6613494 TGCGGGGGCCCGCGCCGGCTCGG - Intronic
901641324 1:10694540-10694562 TGCCGGGGCCGGCGCGGGCCGGG - Intronic
903034584 1:20485796-20485818 TGCGGGCGGCGGCGCCGGTTCGG + Exonic
904171040 1:28592421-28592443 AGCGGGGGGCGGCGCCGGCGGGG + Intronic
904618878 1:31763905-31763927 AGCGGGGGCCGGCGCTGGCGGGG + Exonic
907430092 1:54406492-54406514 GGGGCGGGCCCGGGCCGGCTGGG + Intronic
912561609 1:110555479-110555501 CGCGGGGGCGGTCGCCGGCTGGG - Intergenic
914870971 1:151473485-151473507 CGCGGGGGCCCGCGGCGCGTGGG + Intergenic
915238298 1:154501918-154501940 TGAGGGGGCCCCGGCCGGCTCGG + Exonic
916233349 1:162561662-162561684 TCCGGGGGGCCGCGGCGGCGGGG - Exonic
919878726 1:201888815-201888837 TGCGCGGAGCCGCGCCGGCTGGG + Exonic
920002319 1:202808235-202808257 CTCGGGGGCCCGGGCCCGCTGGG - Exonic
1062814888 10:492119-492141 CACGGGGGCCCGCGGCGTCTGGG - Intronic
1062873865 10:930916-930938 TGCGGGTGCCGGCGCCCGCCCGG + Intronic
1064167882 10:13001830-13001852 GGCGGGTCCCGGCGCCGGCTGGG + Intronic
1070139903 10:73731611-73731633 GGCGGGGGCCCGCGCAGCCAAGG - Intergenic
1071997560 10:91162981-91163003 TGAGGGAGCCCGCGCCGGCGGGG - Intergenic
1073030241 10:100519886-100519908 TGCCGGGGTCCGCGCCGCTTTGG - Intronic
1073188172 10:101629966-101629988 TGCTGGGGCCTGGGCCAGCTGGG - Intronic
1074772261 10:116742045-116742067 TGCGGAGGCCGGCGCTGGCTGGG - Intronic
1075748268 10:124743364-124743386 TGGGGGCGTCCGCGCCGGCGTGG - Intronic
1077253825 11:1571983-1572005 GGCGGGGGCCCGCGCAGCCGGGG + Intergenic
1077916062 11:6612139-6612161 GGCGGAGGCCGGCGCCGCCTCGG + Exonic
1082816341 11:57512347-57512369 TGCGGGAGGCCGAGCCGGGTGGG + Intronic
1083902241 11:65649299-65649321 TCTGGGGCCCCCCGCCGGCTAGG - Exonic
1084284224 11:68121191-68121213 TGCGGCCGCCCGCGCCTCCTCGG - Exonic
1084437575 11:69153206-69153228 TTCGGCAGCCTGCGCCGGCTGGG + Intergenic
1087936168 11:104036800-104036822 GGCGGGGGCCCGGGCGGGCCGGG - Exonic
1089557231 11:119321171-119321193 TGCGCGGGCTCGCGCTGGGTCGG - Intronic
1091226070 11:133957007-133957029 TCCGGAGGCCCGGCCCGGCTAGG - Intergenic
1091866235 12:3839337-3839359 CGCGGGGCCCCGCGCCGCCCTGG - Intronic
1101592715 12:106138608-106138630 GGCGGGGGACCGCCCCGACTTGG - Exonic
1102937715 12:116911382-116911404 GGCGGGGGCCGGCGCAGGCATGG - Intronic
1104961571 12:132490589-132490611 TGCGCGCGCGAGCGCCGGCTCGG - Exonic
1105696773 13:22897377-22897399 TGCCAGGGCCTCCGCCGGCTTGG + Intergenic
1112271927 13:97976553-97976575 TGCGGGGGGCCGCGCGGGAAGGG - Intronic
1113909261 13:113834490-113834512 TCCGGGGGCCCTCGCCGGTGGGG - Intronic
1115398157 14:32933011-32933033 GGCGGCGTCCCGCGCCTGCTGGG - Intergenic
1118019344 14:61695394-61695416 TGCGGGAGCGCGCGCCGGCCTGG + Intergenic
1118388798 14:65279690-65279712 TGCCGGGTCCCGCGCCTGGTTGG - Intergenic
1119325863 14:73759384-73759406 CCCGGCGGCCCGCGGCGGCTCGG - Intronic
1122445039 14:101761840-101761862 TGCGGGGGCAGGCGGCGGCAGGG + Exonic
1122719896 14:103716091-103716113 AGCGGGGGCGGGGGCCGGCTGGG - Intronic
1129450459 15:75648356-75648378 AGCCGGAGCCCCCGCCGGCTCGG - Exonic
1130348116 15:83067286-83067308 TGCGGGGGCGCGCGCGGTCAGGG - Exonic
1132639407 16:970867-970889 TGCGGGGCCACGCCCCGGCGCGG + Exonic
1133784444 16:8963624-8963646 TGCGGGGCCGCGGGCCGGCCGGG + Intronic
1134116626 16:11553533-11553555 TGCGGGAGCCTGTGCCTGCTGGG - Exonic
1134457534 16:14405823-14405845 GGCGGGGCCCCGAGCCGCCTGGG - Intergenic
1135091542 16:19521964-19521986 TGCCGGCGCCCGCACCGGCACGG + Exonic
1137738494 16:50742341-50742363 TGCCCGGGCCCGAGCCGGCCGGG + Intronic
1138105621 16:54285942-54285964 CGCGGGGGCCCGGGGCGGCCTGG - Exonic
1142586872 17:979478-979500 TGCGGGGGGACGCGGCGGCCGGG - Exonic
1143321345 17:6070810-6070832 CCCGGGGGCCCGGGGCGGCTCGG + Intronic
1146943393 17:36859132-36859154 TGCGGGGGTCCCGGCCTGCTAGG + Intergenic
1146957303 17:36942985-36943007 TGCAGAGGCCCGGGCAGGCTGGG - Exonic
1148936189 17:51166277-51166299 GGCGAGGGCGCGCCCCGGCTGGG + Intronic
1152357403 17:79813726-79813748 TGCAGGGGCCCCCGCCGGCCCGG - Intergenic
1152584051 17:81181345-81181367 GGCGGGGGGCCGCGCCGGGCGGG - Intergenic
1157095170 18:44680444-44680466 TGCGGGGGCCCGCGGCGCGGAGG - Intronic
1157867124 18:51197016-51197038 TCCGGGGCCCCGGGCCGGCCGGG + Exonic
1160024178 18:75205024-75205046 GGCAGGAGCCCGCGGCGGCTCGG + Intronic
1160543571 18:79638466-79638488 CGCCGGGGTCCGCGCCGGGTGGG + Intergenic
1160613872 18:80109484-80109506 CGCGCGGGCCCGCGCCGGGCCGG - Intronic
1160856181 19:1219005-1219027 TGCATGGGCCCGAGCCTGCTTGG + Intronic
1160871699 19:1280754-1280776 AGCGGGGGGCGGCGGCGGCTGGG - Intergenic
1160904467 19:1445937-1445959 TGGGGGGGCCCGAGGCGGCGGGG - Intergenic
1160967551 19:1753312-1753334 TGCGCCCGCCCGCGCCCGCTGGG - Exonic
1162091112 19:8280654-8280676 TGCGGGGGCCCACGCCCACCCGG + Intronic
1162093346 19:8295492-8295514 TGCGGGGGCCCACGCCCACCCGG + Intronic
1162315670 19:9936634-9936656 TGGGGGAGCCAGCGCCGGCGAGG + Intergenic
1165924993 19:39321070-39321092 GGGGCGGGCCCGCGGCGGCTCGG - Intergenic
1166104410 19:40590302-40590324 TGCGAGGGCTCCCGGCGGCTCGG + Exonic
1167445393 19:49534217-49534239 CGCGGGGGACGGCGACGGCTGGG + Exonic
1168293789 19:55369409-55369431 CGCGGGAGCCCGAGCTGGCTGGG + Intronic
1168309368 19:55452769-55452791 TGGGCGTGCGCGCGCCGGCTGGG + Intergenic
929604322 2:43225123-43225145 AGCGGCGGCCCGCGCCGTCGGGG - Exonic
929760446 2:44802077-44802099 TGCGAGGGCCCGCGCCGCCCGGG + Intergenic
931355774 2:61537257-61537279 AGCGGGGCCCCGCGCGGGGTGGG - Intronic
932345828 2:70994650-70994672 GGCGGGAGCCCGCGCGGGCCGGG + Intronic
934717063 2:96550406-96550428 TGCGGGAGCCCAGGCTGGCTGGG + Intronic
937450868 2:122001178-122001200 TGCAGGGGCCCTCGCAGGCCAGG - Intergenic
938293250 2:130161469-130161491 TGCGCTGGCCCGCGGCTGCTGGG - Intronic
938463301 2:131511496-131511518 TGCGCTGGCCCGCGGCTGCTGGG + Intergenic
946403937 2:219483144-219483166 TGGGGGGGCCCGCAGCAGCTCGG - Exonic
948438085 2:237967266-237967288 TCCGGGTGCCCGCGCCCGCCAGG - Intronic
948789017 2:240367753-240367775 TGCGGAGCCCCACACCGGCTTGG + Intergenic
949014625 2:241702292-241702314 CGCGGGGGGTCCCGCCGGCTGGG + Intronic
1172320922 20:33994418-33994440 TGGGTGGGCCCGCGCCCGCTCGG + Intronic
1175950604 20:62581315-62581337 TGGGGGGGTGCGCGCAGGCTGGG - Intergenic
1175999593 20:62825949-62825971 CGAGGGGGCCAGCTCCGGCTGGG + Intronic
1176068879 20:63215916-63215938 GGCCGGGGCGCCCGCCGGCTCGG + Exonic
1178702549 21:34845669-34845691 GGCGGGGTCCCCCTCCGGCTGGG - Intronic
1180014762 21:45074802-45074824 GGCGCGGGGCCGCGGCGGCTCGG + Intronic
1180558972 22:16601146-16601168 GCCGGGCGCCCGCGCCGCCTCGG + Intergenic
1182424917 22:30266812-30266834 TGCTCCGGCCCGCGCCCGCTGGG + Exonic
1183479759 22:38057114-38057136 CTCAGGGGCCCGCGCCGGCCCGG - Intronic
950345322 3:12287843-12287865 GGCGGGCGCGGGCGCCGGCTGGG - Intronic
953255955 3:41290634-41290656 TGCGGGGGCACTCAGCGGCTAGG + Intronic
955325663 3:58008168-58008190 TGGGGGGACCCGCGGGGGCTGGG - Intergenic
961012911 3:123448128-123448150 TGCGGGCGGCGGCGGCGGCTCGG - Exonic
961202547 3:125056051-125056073 TGCCGGGGGCCGGGCTGGCTGGG + Intergenic
961663909 3:128484779-128484801 TGCTGGGGCCAGCGGGGGCTGGG + Intronic
962263207 3:133927784-133927806 CGCGGAGGCCCCCGCCGGGTGGG - Intergenic
963202129 3:142596579-142596601 TTTGGGGGCGCGCGGCGGCTCGG + Intronic
965571839 3:170181310-170181332 CGCAGGGGCCCGCGGAGGCTGGG - Intronic
966911287 3:184561831-184561853 TTCGGGGGCGCGCGCCGTCCGGG - Exonic
968093013 3:195909692-195909714 TGCGGGGGCCGGCGCGGGGCGGG - Intronic
968434237 4:576516-576538 CGCAGCGGCCCGCGCCGGATAGG - Intergenic
968820206 4:2844129-2844151 TGCGGCGGCCCGGGCAGCCTCGG + Intronic
968965332 4:3766519-3766541 TGCGGGCGCCGACCCCGGCTGGG + Exonic
973894291 4:55396368-55396390 TGCAGGGCCCCGAGCCGGCCCGG + Exonic
973954493 4:56049372-56049394 TGCGGGGGCCCGGCCCGGAGGGG - Intergenic
981475043 4:145179916-145179938 CGCGGGGCCCCGCGCCGCCCTGG + Intronic
987379998 5:17275842-17275864 TGCCGGGGCCTCCACCGGCTTGG - Exonic
992056531 5:72996675-72996697 TGCGGGGGCCCACATGGGCTGGG - Intronic
992530139 5:77645308-77645330 GGCGGCGGCGCGGGCCGGCTGGG - Intergenic
1002000550 5:176194336-176194358 TGCGGGAGCAGGCGCCGGCCTGG - Intergenic
1002402053 5:178996361-178996383 TCCGAGGGCCTGAGCCGGCTTGG + Intergenic
1002720933 5:181261219-181261241 TGCCGGGGGCCGCGCGGGCCGGG + Intergenic
1002754699 6:148158-148180 TGTGCGTGCCCGCGCCGGCGCGG - Intergenic
1005595470 6:27374903-27374925 TGCGGGAACCCGAGCCTGCTCGG - Intronic
1019198680 6:170296741-170296763 TGCAGGAGCCCGCGCGGGGTGGG + Intronic
1020022741 7:4878798-4878820 TGCTGGGGCCGGCTCCGGGTGGG - Intronic
1025615592 7:63113942-63113964 TGCGGGAGCCCCCGCCCACTGGG - Intergenic
1030348243 7:108456441-108456463 GGCGGGGGCGCGCGCCGGCGCGG - Intronic
1034429320 7:151033322-151033344 TGCGAGGGCCCTGGCTGGCTGGG + Intronic
1034470463 7:151251907-151251929 TGGGGGGGCTCGGGCCGGCCCGG + Intronic
1034994718 7:155570624-155570646 TGCTGGGGCCTGCGCTGGCCCGG - Intergenic
1035018557 7:155787386-155787408 TGCGGGGGTGCGCGGCGGCCCGG - Intergenic
1036503857 8:9337368-9337390 TGCTGGGGCCCGGCCCAGCTTGG - Intergenic
1036562070 8:9906323-9906345 TGCGGCGGCGCGCGTGGGCTCGG - Intergenic
1042367399 8:67952627-67952649 TGCGGGGACCCGGGACGGGTCGG + Intronic
1045277440 8:100721206-100721228 AGCGCGGGTCCCCGCCGGCTCGG + Intronic
1049781116 8:144429368-144429390 TGCGGGGGCCGGCGGCGTCCTGG + Intronic
1050351012 9:4741250-4741272 AGCGGGGTCCCGCGCTGTCTGGG - Exonic
1052740066 9:32384507-32384529 TGCGGGCGCCCCCGCGGGCCTGG - Intergenic
1053198270 9:36136461-36136483 TGGGGAAGCCCGCGCCTGCTGGG - Intergenic
1057463760 9:95292385-95292407 GGCGGGTGCCCGCGCCGTCCCGG + Intronic
1057716622 9:97501442-97501464 GGCAGGGGCCCGCGCTCGCTCGG + Intronic
1060506622 9:124202693-124202715 GGCGGGGGCCCACTCTGGCTGGG - Intergenic
1060856057 9:126915320-126915342 TGCGGGGGGCGGGGCCGGCGGGG + Intronic
1061256218 9:129455214-129455236 AGCAGGGACCCGCGCTGGCTGGG - Intergenic
1061289468 9:129642369-129642391 TGCCAGGGCCCGGCCCGGCTCGG + Intergenic
1062032394 9:134367605-134367627 TGCGGTGACCCTCGCCGGCTGGG + Intronic
1062718747 9:138023853-138023875 CGCTGGGGCCCGCGCCGCCCCGG - Intronic
1189021727 X:37348983-37349005 GGCGGGGACCCGCGGTGGCTAGG + Intergenic
1189325259 X:40107725-40107747 CCCCAGGGCCCGCGCCGGCTCGG - Intronic
1194133700 X:90112527-90112549 TGCGTGGGTCGGCGGCGGCTCGG + Intergenic
1200093866 X:153648203-153648225 GGCGGGGGCCGGCGCCGGCGCGG + Exonic
1200479483 Y:3682639-3682661 TGCGTGGGTCGGCGGCGGCTCGG + Intergenic