ID: 901086147

View in Genome Browser
Species Human (GRCh38)
Location 1:6613549-6613571
Sequence CCCATGAGGCTCCGCGGCGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 113}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901086147_901086155 -6 Left 901086147 1:6613549-6613571 CCGCCGCCGCGGAGCCTCATGGG 0: 1
1: 0
2: 1
3: 11
4: 113
Right 901086155 1:6613566-6613588 CATGGGGGTTGGAGTCCCCAAGG 0: 1
1: 0
2: 1
3: 17
4: 187
901086147_901086160 19 Left 901086147 1:6613549-6613571 CCGCCGCCGCGGAGCCTCATGGG 0: 1
1: 0
2: 1
3: 11
4: 113
Right 901086160 1:6613591-6613613 TCCTTTGTGCGCAGTATTGGCGG 0: 1
1: 0
2: 0
3: 5
4: 68
901086147_901086162 20 Left 901086147 1:6613549-6613571 CCGCCGCCGCGGAGCCTCATGGG 0: 1
1: 0
2: 1
3: 11
4: 113
Right 901086162 1:6613592-6613614 CCTTTGTGCGCAGTATTGGCGGG 0: 1
1: 0
2: 0
3: 2
4: 50
901086147_901086159 16 Left 901086147 1:6613549-6613571 CCGCCGCCGCGGAGCCTCATGGG 0: 1
1: 0
2: 1
3: 11
4: 113
Right 901086159 1:6613588-6613610 GTTTCCTTTGTGCGCAGTATTGG 0: 1
1: 0
2: 0
3: 4
4: 82
901086147_901086164 27 Left 901086147 1:6613549-6613571 CCGCCGCCGCGGAGCCTCATGGG 0: 1
1: 0
2: 1
3: 11
4: 113
Right 901086164 1:6613599-6613621 GCGCAGTATTGGCGGGGCCTTGG 0: 1
1: 0
2: 0
3: 3
4: 71
901086147_901086163 21 Left 901086147 1:6613549-6613571 CCGCCGCCGCGGAGCCTCATGGG 0: 1
1: 0
2: 1
3: 11
4: 113
Right 901086163 1:6613593-6613615 CTTTGTGCGCAGTATTGGCGGGG 0: 1
1: 0
2: 0
3: 2
4: 47

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901086147 Original CRISPR CCCATGAGGCTCCGCGGCGG CGG (reversed) Intronic