ID: 901086690

View in Genome Browser
Species Human (GRCh38)
Location 1:6615072-6615094
Sequence GGCTGCCGCGGGAGGGCGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 774
Summary {0: 1, 1: 1, 2: 5, 3: 91, 4: 676}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901086683_901086690 -5 Left 901086683 1:6615054-6615076 CCGAGTGTCGCGGGGGGCGGCTG 0: 1
1: 0
2: 0
3: 12
4: 498
Right 901086690 1:6615072-6615094 GGCTGCCGCGGGAGGGCGGGTGG 0: 1
1: 1
2: 5
3: 91
4: 676
901086674_901086690 11 Left 901086674 1:6615038-6615060 CCCGCACCTTCGGGGGCCGAGTG 0: 1
1: 0
2: 4
3: 245
4: 6728
Right 901086690 1:6615072-6615094 GGCTGCCGCGGGAGGGCGGGTGG 0: 1
1: 1
2: 5
3: 91
4: 676
901086673_901086690 12 Left 901086673 1:6615037-6615059 CCCCGCACCTTCGGGGGCCGAGT 0: 1
1: 0
2: 1
3: 64
4: 4957
Right 901086690 1:6615072-6615094 GGCTGCCGCGGGAGGGCGGGTGG 0: 1
1: 1
2: 5
3: 91
4: 676
901086675_901086690 10 Left 901086675 1:6615039-6615061 CCGCACCTTCGGGGGCCGAGTGT 0: 1
1: 0
2: 0
3: 5
4: 62
Right 901086690 1:6615072-6615094 GGCTGCCGCGGGAGGGCGGGTGG 0: 1
1: 1
2: 5
3: 91
4: 676
901086676_901086690 5 Left 901086676 1:6615044-6615066 CCTTCGGGGGCCGAGTGTCGCGG 0: 1
1: 0
2: 1
3: 4
4: 44
Right 901086690 1:6615072-6615094 GGCTGCCGCGGGAGGGCGGGTGG 0: 1
1: 1
2: 5
3: 91
4: 676

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901086690 Original CRISPR GGCTGCCGCGGGAGGGCGGG TGG Intronic
900032556 1:381736-381758 GGCCGCCGCGGTGGGGTGGGCGG - Intergenic
900053313 1:610798-610820 GGCCGCCGCGGTGGGGTGGGCGG - Intergenic
900118775 1:1039886-1039908 GCCTGCCGCGGGTGGGGGGCTGG + Intronic
900183178 1:1321309-1321331 AGCTGGCGGGGGAGGGCGTGTGG - Intronic
900203131 1:1420153-1420175 GGCTGCCGCTGCGGGGCGCGGGG - Exonic
900203153 1:1420231-1420253 GGCGGCCGCGGGCGGGCGGCTGG - Exonic
900221684 1:1512491-1512513 GGGCGGCGCGGGCGGGCGGGCGG + Intronic
900400383 1:2470651-2470673 GCCAGGCGCGGGAGGGAGGGTGG - Intronic
900606318 1:3525213-3525235 GGCTGCTCTGGGATGGCGGGTGG - Intronic
900745813 1:4360145-4360167 GGGTGCCGCTGGAGGGCCTGGGG + Intergenic
901012041 1:6207511-6207533 GGCAGGGGCGGCAGGGCGGGTGG + Exonic
901086690 1:6615072-6615094 GGCTGCCGCGGGAGGGCGGGTGG + Intronic
901109852 1:6785677-6785699 GGGCGCGGCGGGCGGGCGGGCGG + Intronic
901660300 1:10794882-10794904 GCCGGGCGCGGGCGGGCGGGCGG - Intronic
901927791 1:12577999-12578021 GGCTTCCCCTGGAGGGCTGGGGG - Intronic
902553470 1:17232977-17232999 GGCTGGGGCGGGAGGTGGGGAGG + Intronic
903047924 1:20578272-20578294 GGCTGACGAGGCAGGGAGGGAGG - Intergenic
903263433 1:22143149-22143171 GGCGGAGGCGGGCGGGCGGGCGG + Intronic
903346187 1:22685698-22685720 GGCTGCTGTGGGAGGATGGGAGG - Intergenic
903353237 1:22730717-22730739 GGCTGGAGCGGGAGGGCCAGGGG + Intronic
903652967 1:24932320-24932342 GGCGGCGGGGGGAGGGGGGGCGG + Intronic
903750182 1:25616697-25616719 GGCGGCGGCGGGAGGGGGCGCGG + Intergenic
904461949 1:30685655-30685677 GGCTGGAGGCGGAGGGCGGGAGG + Intergenic
904720069 1:32500842-32500864 GGCGGCGGCGGGAAGGCGGCGGG + Intronic
904724951 1:32539849-32539871 GGCGGCGGCGGGAAGGCGGCGGG + Intronic
904724979 1:32539950-32539972 GGCCGCCGCGGGGGCGCGCGGGG + Intronic
904837725 1:33349812-33349834 GGCCGGGGCGGGAGCGCGGGCGG + Intronic
905104725 1:35557581-35557603 GACTGCCTCTGGAGAGCGGGCGG - Intronic
905174003 1:36125128-36125150 GGCGTCCGCGGCTGGGCGGGCGG + Exonic
905375012 1:37514400-37514422 GGCAGCCGCAGGAGGGGGCGTGG - Intronic
905449524 1:38047402-38047424 GGCAGCCGCGGGAGGCGAGGCGG - Intergenic
905598470 1:39229843-39229865 GGCTGAGGTGGGAGGGTGGGAGG - Intronic
905825214 1:41021637-41021659 GGCTCCCGCGGGAGCATGGGAGG + Exonic
906147590 1:43569221-43569243 GGCTGCAGGGGGTGGGGGGGGGG - Intronic
906354477 1:45092536-45092558 GGCTGGCGGGGGGGGGGGGGTGG - Intronic
906495545 1:46302221-46302243 GGCTGCCGTGGCAGGGGGCGCGG - Intronic
906524897 1:46488312-46488334 GGGTGCCTCGGGGGGGTGGGGGG - Intergenic
907069326 1:51519400-51519422 GGCTCCGGCGGGCGGGCAGGCGG - Intergenic
907178948 1:52553190-52553212 GGTTGCCGGGGGAGAGGGGGAGG + Intronic
909650664 1:77972504-77972526 GGAGGCCGAGGCAGGGCGGGGGG + Intronic
910251446 1:85201743-85201765 CTCTGCCGCGGGAAGGCGTGGGG + Intergenic
910694220 1:89995035-89995057 GGCTGACGCGGGCTGGTGGGCGG - Intergenic
910936160 1:92485619-92485641 AGCTGGCGCGGGAGGTGGGGCGG + Intronic
912401452 1:109397429-109397451 AACTGCGGCGGGCGGGCGGGCGG - Intronic
913027227 1:114855417-114855439 TACTGCCCCGGGGGGGCGGGAGG - Intronic
913075452 1:115337795-115337817 AGCTGGCGCGCCAGGGCGGGAGG - Intronic
913091421 1:115479101-115479123 GGCTGCCGGGACTGGGCGGGGGG + Intergenic
913422790 1:118691105-118691127 GGTTGCCAGGGGTGGGCGGGAGG - Intergenic
914703074 1:150150786-150150808 GGCTGCGGCCGGGGGGCGGGGGG - Intronic
914803150 1:150974731-150974753 GGCGGGCGCGGGCCGGCGGGCGG - Exonic
915310235 1:155002742-155002764 GGCGGCCGAGGGGGGGCGGGCGG + Exonic
915528492 1:156490276-156490298 GGCTGCTGTGGGAGGGGGCGGGG - Intronic
915722167 1:157993550-157993572 GGCGGGCGCGGGCGGGCGGGGGG + Intronic
915912756 1:159924690-159924712 GGTGGCCGCGGGCGGACGGGCGG - Intronic
915916873 1:159945676-159945698 GGCCGCCGCGGGAGGGGGATTGG - Intergenic
916144751 1:161728213-161728235 GGCTGAGGCGGGGGGGGGGGGGG + Intergenic
918240375 1:182615333-182615355 GGCTGCGGAGAAAGGGCGGGAGG + Intergenic
918620756 1:186602073-186602095 GGATGTGGGGGGAGGGCGGGGGG - Intergenic
919981106 1:202643386-202643408 GGCCGCAGCGGCAGGGCCGGCGG - Exonic
920184356 1:204151202-204151224 GGCTGGGTCGGGGGGGCGGGGGG + Intronic
920192704 1:204203666-204203688 GCCTGCTGCAGGAGGGAGGGAGG - Intronic
920245730 1:204585945-204585967 GGGTTCAGAGGGAGGGCGGGGGG + Intergenic
921089810 1:211831425-211831447 GGCGGGCGGGGGAGGGCGGGCGG - Intergenic
921193126 1:212727034-212727056 GACTGCCGAGAGAGGGAGGGCGG + Intronic
921472666 1:215567558-215567580 GGCGGCGGCCGGAGGGCGGGGGG - Exonic
922243968 1:223776995-223777017 GGTGGCGGCGGGGGGGCGGGGGG - Intergenic
922244222 1:223778937-223778959 GGCTGAGGCAGGAGGGTGGGCGG - Intergenic
922558258 1:226549142-226549164 CCCCGCCGCGGGAGGGCGTGGGG + Intronic
922581768 1:226703535-226703557 GGCTTCCGCGCGTGGGCGGCGGG - Intronic
922773961 1:228206690-228206712 GGCTGTGGCAGGAGGGAGGGTGG - Intronic
922933436 1:229407499-229407521 GGCTGTCCCGGGAGGGAGCGAGG + Intergenic
922958535 1:229625757-229625779 GGCTCCCGCCGGCGGGCGGTGGG - Intronic
923008203 1:230068077-230068099 GGCTCGCGCGGGAGGGCCGGGGG - Intronic
923119585 1:230978359-230978381 GGCGGCTGCAGGAGGGCGCGCGG + Intronic
923141061 1:231162091-231162113 GGCAGCGGCGGGAGGGAGGCGGG + Intronic
924763124 1:247007643-247007665 GGCTGCCCCGGGAGGGCTCTGGG + Intronic
1065122077 10:22540131-22540153 TGCTGCTGAGGGAGGGAGGGAGG + Intronic
1065188922 10:23193221-23193243 GGCGGCTGCGGGGGGCCGGGCGG + Exonic
1065343018 10:24723776-24723798 GGCCGCCGCAGGAGGGCGTGGGG + Intergenic
1066464201 10:35639451-35639473 GGCGGCGGCGGGGGGCCGGGCGG - Exonic
1066477868 10:35765221-35765243 GACAGCGGCGGGAGGGCAGGCGG - Intergenic
1067227323 10:44384639-44384661 GACTGGCGCGGGAAGGCGCGAGG - Intronic
1067300230 10:45001119-45001141 GGCCGCCGGGCGGGGGCGGGAGG + Intronic
1067544201 10:47181177-47181199 GGCTGCCGTCCGAGGGCTGGAGG + Intergenic
1067803350 10:49375840-49375862 GGCTGCTGCTGGAAGGAGGGAGG - Intronic
1069019161 10:63466044-63466066 AGCAGCCGCGGGAGGGTCGGCGG + Intergenic
1069710721 10:70486852-70486874 GGCTGCCTCGGGAGGAAGGGAGG - Intronic
1070257425 10:74824876-74824898 GGCTGAGGCGGGAGGGGGGCGGG - Intergenic
1071597975 10:86941991-86942013 GGCTGCCCTGGCAGGGCAGGAGG + Intronic
1071847500 10:89535631-89535653 GGGTGTGGCAGGAGGGCGGGCGG - Intronic
1072208102 10:93222105-93222127 GGCTGCTGTGGGAGGACGAGAGG - Intergenic
1072633729 10:97164350-97164372 GGCTCCCGCTGGAGGCCTGGGGG + Intronic
1072662393 10:97370885-97370907 GGCTCCCTCGGCAGAGCGGGTGG + Intronic
1073147815 10:101292063-101292085 CGCTGCCCCGCGGGGGCGGGAGG - Intergenic
1073207203 10:101775626-101775648 GGCCGGCGCGGGAGGGCTGAGGG - Intronic
1073217253 10:101843458-101843480 GGGGGTCGCGGGAGGGAGGGTGG - Intronic
1073249868 10:102114814-102114836 GGTGGCCTGGGGAGGGCGGGCGG - Intronic
1073292861 10:102421821-102421843 GGCTGCTGCGGGATGCCGAGGGG + Exonic
1073465634 10:103693233-103693255 GGGGCCCGCGGGCGGGCGGGCGG - Intronic
1074772361 10:116742377-116742399 GGCTGGCGGGGCAGGGAGGGAGG - Intronic
1075430400 10:122375126-122375148 GCCCGGCGGGGGAGGGCGGGAGG + Intronic
1075656228 10:124162974-124162996 TGCTGCGGAGGGAGGGAGGGAGG + Intergenic
1076183860 10:128431467-128431489 ACCTGCCGAGGGAGGTCGGGAGG - Intergenic
1076374284 10:129973004-129973026 GGCTCTCCCGGGAGGGCGGGAGG - Intergenic
1076793452 10:132788087-132788109 GGCTGCCGAGGGAACGCGTGGGG + Intergenic
1076845899 10:133069440-133069462 GGCAGGCGTGGGAGGGCAGGGGG + Intergenic
1077009222 11:372797-372819 GGCTGGGGCGGGGGGGCGGCGGG + Intronic
1077064872 11:636696-636718 GGCTGCGGGGGGGGGGCGGCGGG + Intergenic
1077151133 11:1073613-1073635 GGGCACCGCAGGAGGGCGGGAGG + Intergenic
1077253958 11:1572421-1572443 GGCTGCCGCGGGGGGGGGGCGGG + Intergenic
1077360676 11:2139047-2139069 GGCTGGAGGGGGAGCGCGGGGGG + Intronic
1077476335 11:2792150-2792172 GGAGGCCGCGGGAGTGCGGGAGG - Intronic
1078210367 11:9265228-9265250 GGCTGCCGTGACGGGGCGGGGGG + Exonic
1078986698 11:16605157-16605179 GGCTGCAGAGGAACGGCGGGTGG + Intronic
1079135756 11:17775283-17775305 GGCTGGCCTGGGGGGGCGGGAGG - Intronic
1080496954 11:32829918-32829940 GGCGGCCGACGGAGGACGGGAGG - Intergenic
1081488222 11:43547785-43547807 GGCTTCCCCGGGGGGGGGGGGGG + Intergenic
1081492610 11:43579729-43579751 GGATGCCGTGGGAGGGTGAGTGG + Intronic
1081593600 11:44444213-44444235 GGCAGCCGTGGGAGGCGGGGAGG + Intergenic
1081774081 11:45665774-45665796 GGCTGCCCCCGGCGGGTGGGTGG - Intergenic
1081812113 11:45920027-45920049 AGCTGCAGAGGGAGGGCTGGAGG - Intergenic
1082064725 11:47890755-47890777 GGCTGGGGCGGGGTGGCGGGGGG + Intergenic
1083265762 11:61546206-61546228 GGCCGCCGCGGCGGGGCTGGCGG - Exonic
1083572864 11:63769280-63769302 GGCTCCCGCGGGAGGGGGCGCGG - Intergenic
1083609863 11:63999610-63999632 GGCCCGCGGGGGAGGGCGGGAGG - Intronic
1083636162 11:64122209-64122231 GGCTGTGGCGGGAGGCCGTGGGG - Intronic
1083744260 11:64726486-64726508 GGCTGTCGGGGAAGGGAGGGAGG - Intergenic
1084001000 11:66295437-66295459 GGCTGCGGCTGAAGGGCAGGCGG - Exonic
1084097230 11:66919539-66919561 GGCTGGCGAGGAAGGGCAGGGGG + Intronic
1084151353 11:67289313-67289335 GGCGGCGGCGGCAGCGCGGGCGG - Exonic
1084171207 11:67401827-67401849 GGAGGCTGCCGGAGGGCGGGAGG - Intronic
1084192241 11:67504489-67504511 GGCTCCGGCCGGCGGGCGGGAGG + Intronic
1084701334 11:70788106-70788128 GGCTCCCGAGGGAGAGCAGGTGG + Intronic
1085640192 11:78188572-78188594 GGCTGCAGAGCGAGGGCAGGAGG - Exonic
1088462063 11:110092908-110092930 GGTGGCTGCGGGCGGGCGGGCGG + Intergenic
1089560416 11:119340622-119340644 GGCTGGCGCGGGCCGGCGGTGGG - Intronic
1090296369 11:125592078-125592100 GGCTTCCTCGGGAGACCGGGAGG - Intronic
1090408553 11:126492210-126492232 GGCTGCAGCGTGAGGGAGTGAGG + Intronic
1090635798 11:128689859-128689881 CGCGGCGGCGGGAGGGCCGGGGG - Intronic
1090788740 11:130070926-130070948 GGAGGCCGCGGGAGGGGGCGGGG + Intronic
1091286814 11:134412430-134412452 CGGTGCCGGGGGAGGGTGGGGGG - Intergenic
1091286891 11:134412648-134412670 GGCTGCTGCAGGAGGGCGGGGGG + Intergenic
1091545696 12:1500197-1500219 GGCTGCTGCGGGAGGCGTGGTGG - Intergenic
1091546483 12:1504612-1504634 GGGTGCCGAGGGAGGGCAGGCGG - Intergenic
1091781899 12:3219103-3219125 GGCGGCCGGGGGAGGCCGGACGG + Intronic
1091888067 12:4031250-4031272 GGGCGCGGCGGGCGGGCGGGAGG - Intergenic
1092246557 12:6867403-6867425 GGCGGCGGCAGGAGGGCGGGCGG + Exonic
1092271923 12:7030485-7030507 GGTTGCTGCGGCAGGGCAGGTGG + Intronic
1092743165 12:11649551-11649573 GGCGGCCGCGGGGGCGCGGGCGG - Intergenic
1092743209 12:11649781-11649803 GAGAGCCGCGGGAGGGCGGGGGG + Intergenic
1093547718 12:20368514-20368536 GGCAGCCGCAGAAGGGAGGGAGG - Intergenic
1095954168 12:47797034-47797056 GGCCGCCGCCGGAGGCTGGGGGG + Exonic
1096178653 12:49539006-49539028 GGCGGGCGCGGGAGGGAGGGAGG + Intergenic
1096241327 12:49961797-49961819 GGCCGGCGCGGGGGGGCAGGGGG - Intergenic
1096495461 12:52037169-52037191 GGCGGCCGCGGGCGCGGGGGCGG + Intronic
1096710482 12:53452171-53452193 GGCGGCGGAGGGCGGGCGGGCGG - Exonic
1096774337 12:53955121-53955143 GGCTGCCGAGGTAGGGCTGCGGG - Exonic
1096870299 12:54588515-54588537 CGCTGCGGCGGGAGGGAAGGCGG + Exonic
1097990263 12:65825598-65825620 GGCGGCCCGGGGAAGGCGGGAGG + Intronic
1100553751 12:95672200-95672222 GGTTGCGGGGGGCGGGCGGGGGG + Intronic
1101371876 12:104137997-104138019 GGCCCGCGCGGGAGGGCGGGAGG + Intronic
1101371947 12:104138308-104138330 GGCCGCGGCGGGCGGGCGCGCGG - Intergenic
1101493868 12:105235846-105235868 GGCAGCCGCGGGAGTGCGCCCGG - Intronic
1102183928 12:110933324-110933346 GGATGGCGGGGCAGGGCGGGGGG - Intergenic
1102457131 12:113077843-113077865 GGCGGCAGCGGGGGCGCGGGGGG - Exonic
1102853871 12:116277246-116277268 CGCCGCCGGGGGAGGGCGCGAGG + Exonic
1102880943 12:116484312-116484334 GGAAGCCGGGGGAGGGGGGGCGG + Intergenic
1102997447 12:117361204-117361226 GGCGGCCGCGGGCGCCCGGGAGG - Intronic
1103720096 12:122969175-122969197 GGCAGCCGGGGGGGGGGGGGGGG - Intronic
1103779338 12:123388943-123388965 GGCGGCTGCGAGCGGGCGGGAGG + Intronic
1103893762 12:124259736-124259758 GGCGGCCGGGGAGGGGCGGGGGG - Intronic
1103960547 12:124606595-124606617 GGCTGCTGCGAGAGGCTGGGAGG + Intergenic
1103977986 12:124716155-124716177 GGCTGCCGAGGGGTGGCTGGAGG + Intergenic
1104010040 12:124923898-124923920 GGCTGGGGCGGGCGGGAGGGGGG - Intergenic
1104692729 12:130839008-130839030 GGCGGCGTCTGGAGGGCGGGCGG - Intronic
1104837281 12:131799870-131799892 GGCTGCTGTCGGAGGGCTGGGGG - Intergenic
1104865287 12:131949991-131950013 GGCCGCGTCAGGAGGGCGGGAGG - Intronic
1104931222 12:132340487-132340509 CACTGCCAAGGGAGGGCGGGAGG - Intergenic
1105474850 13:20720877-20720899 GTCTGCCGGGGGAGGGGGGGGGG - Intronic
1105900979 13:24752926-24752948 GGCTAACGAGGGAGGGTGGGAGG - Intergenic
1106109054 13:26760853-26760875 GGATCCCGCGGGCGGGCGGGCGG - Intergenic
1106284163 13:28304689-28304711 GGCTGGGGCTGGAGGGCGTGAGG - Intronic
1106400831 13:29428604-29428626 TGCTGCTGCGGGAGGGAGGGCGG - Intronic
1110143989 13:72167343-72167365 TGCAGCAGCGGGAGGGAGGGAGG + Intergenic
1110219583 13:73059219-73059241 GGCTGCCGGCGGAGGAGGGGAGG - Exonic
1110597018 13:77329907-77329929 GGCTGCAGCCGGGGGGCGTGGGG + Intergenic
1110610865 13:77486016-77486038 GGCTGGGGCGGGGGGGTGGGGGG + Intergenic
1111672506 13:91348173-91348195 GGCCGGGGCGGGAGGGTGGGAGG + Intergenic
1112091796 13:96090805-96090827 GGCGGCGGCGGCAGGGCGGACGG - Intergenic
1112506800 13:99980680-99980702 CGCGGCGCCGGGAGGGCGGGCGG + Intergenic
1113378573 13:109784598-109784620 CGCTGCCGCTGGAGGGCCGCTGG + Exonic
1113479986 13:110613818-110613840 GGCTGGCGGGGGTGGGGGGGTGG - Intergenic
1113804088 13:113103591-113103613 GGCTGCCACAGGAGAGAGGGAGG + Intergenic
1113985731 13:114314426-114314448 GGCCCGCGCGGGAGGGCGCGCGG + Intergenic
1114491647 14:23106176-23106198 GGAGGCGGGGGGAGGGCGGGGGG - Intergenic
1117252672 14:53952390-53952412 GGCTGCAGCTGGTGGGTGGGCGG - Intronic
1118312534 14:64704444-64704466 AGCTGCAGCGGGAGGGCAGGAGG - Exonic
1118768193 14:68924096-68924118 GGTTGCCAGGGGAGGGCCGGGGG + Intronic
1119666095 14:76486233-76486255 GGCTGCCGAGGGAGGCAGGATGG - Intronic
1120881536 14:89417832-89417854 GTCTCCCGAGGGAGGGCCGGTGG + Intronic
1121373174 14:93379698-93379720 GACTGCAGGGGGAGGGTGGGAGG + Intronic
1121449968 14:94000951-94000973 GGAGGGGGCGGGAGGGCGGGGGG + Intergenic
1122156443 14:99753190-99753212 GGGGGCGGCGGGGGGGCGGGGGG - Intronic
1122399144 14:101457395-101457417 AGCTGCCGCCGTGGGGCGGGGGG + Intergenic
1122410159 14:101521659-101521681 GCCTGCCGTGGGAGGGCTGGCGG - Intergenic
1122486839 14:102087383-102087405 ACCTGCCGCGGGCGGGCGGAGGG + Intronic
1122658491 14:103279052-103279074 GGGGGGCGGGGGAGGGCGGGAGG - Intergenic
1122687748 14:103518116-103518138 GGCTGCCGCTGTTGAGCGGGAGG + Intergenic
1122775187 14:104113859-104113881 GGCTGCAGGTGGAGGGAGGGTGG + Exonic
1122862024 14:104587005-104587027 GGCTGCCCCGCGAGGGCGTGAGG - Intronic
1122884920 14:104706660-104706682 GGCTGCCACGGCTGGGCAGGGGG + Intronic
1122993183 14:105248566-105248588 GGCTCGGGCGGGCGGGCGGGCGG + Exonic
1123949944 15:25261593-25261615 GGCTGCCGTGGGGTGGGGGGAGG + Intergenic
1124012574 15:25850632-25850654 GGCTGGGGGGGGAGGGAGGGAGG - Intronic
1124496799 15:30192116-30192138 GGCCGCAGCGGCAGGGCCGGCGG - Intergenic
1124713057 15:32030798-32030820 GGCTGCACCGGGTGGGCGGCGGG + Intronic
1124746777 15:32346531-32346553 GGCCGCAGCGGCAGGGCCGGCGG + Intergenic
1125960648 15:43826974-43826996 GATTGCGGCGGGAGGCCGGGAGG - Exonic
1126113290 15:45187764-45187786 GGCTTCCGCGGGGGGGGCGGCGG - Intronic
1128582398 15:68818952-68818974 GGCGGCCGCGGGAGAGGAGGGGG - Intronic
1129082278 15:73052053-73052075 GGCTGCGGCGAGCGGGCGGGAGG + Intronic
1129322364 15:74782287-74782309 GGCTGGGGCGGGAGGGACGGCGG - Exonic
1129424571 15:75454514-75454536 GGCGGCCGCGGGCGGGTAGGCGG - Intronic
1129684544 15:77677661-77677683 GGCTGAGGCGGGAGAGCTGGGGG - Intronic
1129823757 15:78621005-78621027 GCCAGGCGCGGGCGGGCGGGCGG + Exonic
1129894233 15:79091654-79091676 TGCTGCACCGGGAGGGCGCGCGG + Intergenic
1130908754 15:88256989-88257011 GGCTGCCGCGAGGCTGCGGGTGG - Intergenic
1131197095 15:90364331-90364353 GGCTGGCGGGGGAGTGGGGGGGG - Intronic
1131475391 15:92734232-92734254 GTCGGCAGCGGGAGGGCGCGCGG - Intronic
1131626073 15:94122189-94122211 GGCTGTCAGGGGAGGGCAGGGGG - Intergenic
1132464820 16:72559-72581 GGCTGCCGCCGCTGGCCGGGAGG + Exonic
1132500875 16:284164-284186 GGCTGTGGGGGGAGGGGGGGTGG + Intronic
1132549112 16:547106-547128 GGCTCCCCCAGGATGGCGGGTGG - Exonic
1132588274 16:715504-715526 GGCGGCCTCGGGAGGGAGCGGGG + Intronic
1132810391 16:1794169-1794191 GGAACCCCCGGGAGGGCGGGTGG - Intronic
1132828896 16:1918141-1918163 GGCCGGCGCGGGGGCGCGGGCGG + Exonic
1132943556 16:2520247-2520269 GGCGGGGGCGGGCGGGCGGGCGG + Intronic
1133038009 16:3045724-3045746 GGCTTCCTGGGGAGGGCGGGTGG - Intergenic
1133040925 16:3059398-3059420 GGCTGCCGCCAGGGGGCGGTCGG + Exonic
1133277920 16:4649147-4649169 GACTCCCGCGTGAGGGCGGGAGG - Intronic
1134121465 16:11587223-11587245 GGCTGTCGGGGGCGGACGGGTGG - Intronic
1134301321 16:12993955-12993977 GGCTGCAGCAGGAGGGAGAGGGG + Intronic
1134443104 16:14310993-14311015 GGCTGCAGGGGGTGGGTGGGGGG - Intergenic
1135424243 16:22324444-22324466 GGCTGCTGCTGGAGGGGAGGGGG + Intronic
1135429896 16:22374339-22374361 GGCTGAGGCGGGACGGCGGCGGG - Exonic
1135984517 16:27174299-27174321 GCCAGGCGCGGGAGGGCAGGTGG - Intergenic
1136220066 16:28823131-28823153 GCCCGCCGTGGGCGGGCGGGGGG - Exonic
1136234703 16:28906225-28906247 GGCTGGGGCAGGAGGGCAGGAGG + Intronic
1136247709 16:28985058-28985080 TCCTGCCGCAGGCGGGCGGGAGG + Intronic
1136396702 16:29996397-29996419 TGCTGCCGCGGGAAGGCTGTGGG + Exonic
1136414750 16:30096235-30096257 CGCTGCGGCGGGAGGGGGAGGGG + Intronic
1136609415 16:31357125-31357147 GGCTTCTGAGGGAGGGAGGGAGG + Intronic
1137926575 16:52546916-52546938 GCGAGCCGCGGGAGAGCGGGAGG + Exonic
1139528075 16:67528739-67528761 GGGAGCCGCGGGAGCGCAGGGGG + Intronic
1140225085 16:73070742-73070764 GGCGGCCTGGGGAGGGAGGGAGG - Intergenic
1141608506 16:85169034-85169056 GGCGGCGGCGGGCGGGAGGGAGG + Intergenic
1141665279 16:85462653-85462675 GGCTGCCCGGGGAGCGCGGGCGG + Intergenic
1141697448 16:85626765-85626787 GGGATCCGCGGGAGGCCGGGAGG + Intronic
1141830042 16:86505508-86505530 GGCTGCCGGAGGAGCGCGGGAGG - Intergenic
1141959156 16:87392720-87392742 GGCAGCCGGCGGAGGGCGGGCGG + Intronic
1142062296 16:88038287-88038309 GGCTCTCGCGGGAGGGAGCGAGG + Intronic
1142184065 16:88686170-88686192 GGCTGCGGCTGCAGGGAGGGAGG - Intronic
1142284303 16:89165507-89165529 GGCTGCCCAGGGAGGGCGGGCGG - Intergenic
1142494533 17:299351-299373 GCCTTCCGTGGGAGGGAGGGAGG - Intronic
1142741152 17:1932668-1932690 GGCTGGGGGGGGTGGGCGGGAGG + Intergenic
1142805111 17:2367442-2367464 GGCGGGCCCGGGAGGGAGGGTGG - Intronic
1142812627 17:2402219-2402241 GGAAGACGCGGGCGGGCGGGCGG - Intergenic
1143089381 17:4439924-4439946 GGGTGCCGCGGGAGAGCAGGGGG + Intronic
1143164185 17:4889790-4889812 AGCAGGAGCGGGAGGGCGGGAGG - Intronic
1143432265 17:6895658-6895680 GGCTGGCGGGGGGGGGGGGGGGG + Intronic
1143443957 17:6996319-6996341 GCTCGCGGCGGGAGGGCGGGAGG + Intronic
1143477665 17:7211813-7211835 GGCTGCGGCGGGGGGGGGGGGGG + Intronic
1143485386 17:7251344-7251366 GGCTGCCCCCGGGGGGCTGGCGG - Exonic
1143562676 17:7705030-7705052 GGCTGAGGCGGGGCGGCGGGCGG + Intergenic
1143628082 17:8122303-8122325 GGCAGCGGAGGGAGGGAGGGGGG - Intronic
1143736734 17:8916477-8916499 GGCGGGGGCGGGGGGGCGGGGGG - Intronic
1144692903 17:17280700-17280722 GGCCGCCGGGAGCGGGCGGGAGG - Intronic
1144719292 17:17456619-17456641 GGCTGAGGCGGGAGGCTGGGAGG + Intergenic
1144726765 17:17506195-17506217 GGCTGCGGCGGGTGGGGGCGTGG - Intronic
1144762022 17:17712427-17712449 GGCTGCAGCGGGAGTGGGTGGGG + Intronic
1145765579 17:27456467-27456489 TGCTGCCGCGGCTGGGAGGGTGG + Intergenic
1145980065 17:29005900-29005922 GACCGCGGCGGGAGGGCGGGGGG + Exonic
1146888264 17:36486826-36486848 GGCCATGGCGGGAGGGCGGGAGG + Intronic
1147161852 17:38573038-38573060 GGTTGCAGCAGGAGGGAGGGAGG + Intronic
1147179415 17:38674825-38674847 GGCGGCCGCGGGAGGCGGGAAGG + Exonic
1147184248 17:38705185-38705207 GGCTGCCGCGGCCGGGCAGGGGG + Intergenic
1147246236 17:39122979-39123001 GGCTGCTGTGGGAGTGAGGGTGG - Intronic
1147315391 17:39617888-39617910 GGCCGCCCCGGGAGGGCGCGCGG - Intergenic
1147427126 17:40351251-40351273 TGCTGACGCGGGAGGAAGGGAGG - Intronic
1147592014 17:41689552-41689574 GGCTTCCCAGGGAGGGCGGGAGG + Intronic
1147595254 17:41712583-41712605 GGCTGCGGCAGAAGGGCAGGTGG - Intronic
1147653000 17:42072641-42072663 GGCTGTCCCGGGAGAGCGCGGGG - Intergenic
1147756813 17:42773940-42773962 GGCTGGCGCGGGGGGGCGTCTGG - Intronic
1147965709 17:44193319-44193341 GGCTGCCCCGGTAGGGCAGTGGG + Exonic
1148108163 17:45130468-45130490 GGGTGCCGCGGAAGGGCTGAGGG - Intronic
1148177292 17:45578007-45578029 GGCTGCCAGGGGAGAGCAGGAGG + Intergenic
1148551914 17:48555663-48555685 GGCGGGGGCGGGGGGGCGGGGGG - Intronic
1150060580 17:62065362-62065384 GGCGGCGGCGGGGGGGTGGGTGG - Intergenic
1150251052 17:63704608-63704630 GGCTGTAGCGGGTGGGGGGGGGG + Intronic
1150692349 17:67377426-67377448 GGCTGCCAGGGGCGGGCGGGAGG - Intronic
1150737665 17:67754187-67754209 GGCTGCAGCGGGCAGGCGGTGGG + Intergenic
1151662470 17:75525915-75525937 GGCTGTCGGGCCAGGGCGGGAGG + Intronic
1151674129 17:75589220-75589242 GGCGGCCGCCAGAGGGCGAGGGG + Intergenic
1151756116 17:76076237-76076259 CGGTGCCGCGGGAGGGAGGGCGG - Intronic
1151782206 17:76254688-76254710 GGCTGAGGCGAGTGGGCGGGTGG - Intergenic
1152357350 17:79813547-79813569 GGCGGCCGGAGGGGGGCGGGCGG + Intergenic
1152363166 17:79841666-79841688 GGCTGCCGGGGGAGGCCGAGCGG + Intergenic
1152557743 17:81062914-81062936 GGGGGCGGCGGGGGGGCGGGGGG - Intronic
1152634018 17:81423140-81423162 CTCTGCGGCGGGTGGGCGGGTGG - Intronic
1152744882 17:82034029-82034051 GGCCCCCGCCGGAGGCCGGGAGG + Exonic
1152800376 17:82328038-82328060 TGCTGCCCCGGGAGGGGGGCTGG - Intronic
1152830966 17:82496893-82496915 AGCTGCCTCCGGAGGGCGAGCGG - Intergenic
1152946242 17:83199070-83199092 GGCTGCAGCAGGGGGTCGGGGGG - Intergenic
1152947384 17:83205446-83205468 GGCCGCCGCGGTGGGGTGGGCGG + Intergenic
1152948383 17:83211104-83211126 GCCTGCCGCTGGAGAGCGTGGGG - Intergenic
1153030996 18:712645-712667 GCGCGCGGCGGGAGGGCGGGAGG + Intronic
1153060584 18:990861-990883 TGCTGCTGCTGGGGGGCGGGTGG + Intergenic
1153999712 18:10472969-10472991 GCCTGCTGCGGGTGGGCGGTGGG + Intronic
1155388616 18:25308652-25308674 GGCTGTGGCGGGTGGGGGGGGGG - Intronic
1157285469 18:46374423-46374445 GGCTGCCAGGGGCTGGCGGGAGG - Intronic
1157579444 18:48764881-48764903 AGCTGCCATGGGAAGGCGGGTGG + Intronic
1158123559 18:54077674-54077696 GGCGGCTGGGGGAGGGTGGGGGG - Intergenic
1159102339 18:63970595-63970617 GGGAGCCCCGGGAGGGCGAGTGG + Intronic
1159770790 18:72543627-72543649 GGCTGGCGCGGGAAAGCGGCAGG - Intronic
1159904616 18:74078333-74078355 GGCTGCTGGGGCAGGTCGGGGGG - Intronic
1160381637 18:78461571-78461593 GGAGGCAGCGGGAGGGCTGGAGG - Intergenic
1160394489 18:78561869-78561891 GGCTCCTGCGGGAAAGCGGGTGG - Intergenic
1160569558 18:79807618-79807640 TGCTGCGGCGGGAGGGAGGAAGG - Intergenic
1160726793 19:620975-620997 GGGCGCCGGGGGAGGGCGCGGGG + Intronic
1160726804 19:620996-621018 GGGCGCCGGGGGAGGGCGCGGGG + Intronic
1160844900 19:1161898-1161920 GGGAGCCGCGGGGGGGGGGGGGG + Intronic
1161075363 19:2282575-2282597 TGCTGCCGCAGGAGGGGAGGTGG - Intronic
1161118815 19:2513775-2513797 GGGAGCCGCGGCAGGGCGGGTGG - Exonic
1161165572 19:2785504-2785526 GCATGCCCCGGGAGCGCGGGCGG + Exonic
1161212349 19:3074012-3074034 GGCAGCCAAGGGGGGGCGGGTGG - Intergenic
1161401404 19:4067407-4067429 GGCTGCCGGGGGTGGGTTGGGGG + Intergenic
1161494914 19:4581474-4581496 GGCCGCCGCGAGTGCGCGGGCGG + Intergenic
1161964405 19:7540328-7540350 GGCTGCTGCAGGAGGATGGGTGG + Intronic
1161978615 19:7619426-7619448 GGCTGCTGTGGGAGGTGGGGCGG - Intergenic
1162373610 19:10292722-10292744 GGCTGCCCCGGGACCGCGGCTGG - Exonic
1162481407 19:10928948-10928970 GGCCGCCGCGACAGGGTGGGTGG + Intronic
1162495035 19:11018798-11018820 GGCAGCTGAGGGAGGGAGGGAGG - Intronic
1163117589 19:15197735-15197757 GGCTGGGGCGGGGGGGGGGGGGG - Intronic
1163138634 19:15331942-15331964 GGCGGTCGGGGGCGGGCGGGGGG - Intronic
1163390467 19:17027162-17027184 GGCTGGCTGGGGAGGGAGGGAGG - Intergenic
1163485075 19:17580647-17580669 AGCTCCCTCCGGAGGGCGGGAGG + Intronic
1163636872 19:18441091-18441113 GGCTGGCGTTGGAGGGCCGGGGG + Intergenic
1163666707 19:18606906-18606928 GGTGCCCGCGGGCGGGCGGGCGG - Intronic
1163847597 19:19646346-19646368 GGCTGCAGCAGCAAGGCGGGTGG + Exonic
1165040491 19:33064758-33064780 GGCGGCTTCGGGCGGGCGGGCGG - Intronic
1165213853 19:34255068-34255090 GGCAGCCCCGGGATGGCGTGAGG - Intronic
1165433316 19:35784367-35784389 GGCTGCAGGGGGAGGGCAGGTGG + Intronic
1165924928 19:39320904-39320926 GGCTCGGGAGGGAGGGCGGGAGG - Intergenic
1165959039 19:39519190-39519212 GGCTGCGGTGGGAGGGGTGGAGG + Intronic
1166106682 19:40601233-40601255 GGCGGCCGCGCGGGGGCGCGTGG - Intronic
1166297996 19:41897994-41898016 GGCTGCCCCGGGAAGGCCGGCGG - Intronic
1166352678 19:42207492-42207514 GGCTGCTGAGGGAGGGGAGGAGG - Intronic
1166547185 19:43640407-43640429 GGCTGCAGCTGGAGGTCCGGAGG + Intergenic
1167080807 19:47275089-47275111 GGGTGCCGCGGGAGACCGCGTGG - Exonic
1167313960 19:48753149-48753171 GGCTGCCGCCGGAGCGCGCGAGG + Intronic
1167494304 19:49808867-49808889 GGCCGGCGGGGGAGGTCGGGGGG + Intronic
1167751099 19:51380638-51380660 GGCTGGGGAGAGAGGGCGGGAGG + Exonic
1168294161 19:55370498-55370520 GGCTGGGGCGGGCGGGCGGGGGG + Intergenic
1168307422 19:55442985-55443007 GGCTGGGGAGGGCGGGCGGGGGG + Intergenic
1168721786 19:58558431-58558453 GGCGGCGGCGGGGGGCCGGGTGG - Exonic
1202683494 1_KI270712v1_random:30079-30101 GGCGGCGGCGGGTGGGGGGGGGG - Intergenic
925609794 2:5693154-5693176 GGCGGCGGCGGGAGCGCGGGCGG + Exonic
927181101 2:20447289-20447311 GGCTGCCGCGGCGGGGGCGGTGG - Exonic
929511465 2:42568721-42568743 GGGCTCCGCGGGCGGGCGGGCGG + Intronic
930136046 2:47905412-47905434 GGCCGGGGCGGGCGGGCGGGCGG - Intronic
930807592 2:55506800-55506822 GGCTGAGGCAGGAGGGCAGGAGG - Intergenic
931216219 2:60247469-60247491 GGCTGTCCCAGGAGGGCGGCTGG - Intergenic
931681133 2:64750840-64750862 GGCGGCCGCGGCGGGGCGAGCGG + Intronic
931696345 2:64873569-64873591 GGCTGCGGCGGGAGAGAGGCAGG - Intergenic
932231483 2:70087522-70087544 GGGAGCGGCGGGCGGGCGGGTGG - Exonic
932496693 2:72149073-72149095 GGCGGCCGGGGCGGGGCGGGAGG - Intergenic
932790209 2:74648347-74648369 GGCCGGCGCGGCTGGGCGGGAGG + Intergenic
933747904 2:85584368-85584390 GGCCGCCGAGCGAGGGCGGGGGG - Intergenic
934539046 2:95159589-95159611 GGCTGGCGCGGGGTGGCGGGCGG - Exonic
934539057 2:95159613-95159635 GGCTGGCGCGGGGTGGCGGGCGG - Intronic
934539068 2:95159637-95159659 GGCTGGCGCGGGGTGGCGGGCGG - Intronic
934539079 2:95159661-95159683 GGCTGGCGCGGGGTGGCGGGCGG - Intronic
934568260 2:95352556-95352578 GGCTGGAGAGGGAGGGCTGGGGG - Intronic
934761118 2:96857749-96857771 GCCTGGTGCGGGAAGGCGGGCGG - Intronic
935971598 2:108534671-108534693 GCCTGGCGCGGGCGGGCGGCCGG + Intronic
936105100 2:109615964-109615986 AGCAGCCGCTGGAGGGCAGGGGG + Exonic
936278560 2:111120171-111120193 GCCTCCCGGGTGAGGGCGGGAGG - Intronic
936390775 2:112071300-112071322 GGCGGCGGCGGGGGGGCGGGGGG - Intronic
937882371 2:126878063-126878085 CGGTGCCTAGGGAGGGCGGGAGG - Intergenic
938034875 2:128027639-128027661 AGCGGCCGGGGGAGCGCGGGCGG - Intronic
938477990 2:131633720-131633742 GGCTGCCGCCTGAGGGCTGAGGG + Intergenic
939969663 2:148644967-148644989 GGCGGCGGCGGCGGGGCGGGCGG - Exonic
942241107 2:173964673-173964695 CGCCGCCGCCGGGGGGCGGGTGG - Intronic
942450904 2:176107590-176107612 GGCGGCGGCGGCAGCGCGGGGGG + Exonic
942454801 2:176130329-176130351 GGCGGCCCCGGGCGGGCGGGCGG - Exonic
943646087 2:190408702-190408724 GGAAGCCGGGGGAGGGAGGGAGG - Intronic
944547553 2:200812385-200812407 TGCTTTCGCTGGAGGGCGGGCGG + Exonic
944831206 2:203535304-203535326 GGCGGCGGCGGGAGCGGGGGCGG + Exonic
945088885 2:206160135-206160157 GGCTGCCGCGGGAGGGAGGGAGG + Intronic
946183191 2:217961102-217961124 GGCTGCTGGGGGAGGATGGGAGG - Intronic
946250152 2:218406607-218406629 GGCTGGCTGGGGACGGCGGGAGG - Intergenic
947602754 2:231464643-231464665 GGCGGCCACGGGAGGGGGAGGGG + Intronic
947702655 2:232247608-232247630 AACTGCCGCGGGGGGGGGGGGGG + Intronic
948645143 2:239400195-239400217 GGGGGTCGCGGGAGGGCGGGGGG - Intronic
948747526 2:240107268-240107290 GGCTGCCTTGGGAGGGAGTGAGG - Intergenic
948805996 2:240453613-240453635 GGCTGCGGCGGGCAGGCGAGGGG - Intronic
948874630 2:240820086-240820108 CGCGGGCGCGGGAGGCCGGGCGG + Intronic
948958691 2:241315457-241315479 GGCGGTCGCGGGAGGGCAGGTGG - Intronic
948963310 2:241356600-241356622 GCCTGCCGCGTGGGGGCAGGCGG + Intronic
948995470 2:241576137-241576159 GGCTGCAGCGGGAGGAGGAGAGG - Intergenic
948995490 2:241576219-241576241 GGCTGCCAGGGGAGGGGTGGAGG - Intergenic
949032861 2:241805242-241805264 GGCTGAGGGGGGAGGGAGGGTGG - Intergenic
949032941 2:241805437-241805459 GGCTGAGGGGGGAGGGAGGGTGG - Intergenic
949032958 2:241805476-241805498 GGCTGAGGGGGGAGGGAGGGTGG - Intergenic
949032975 2:241805515-241805537 GGCTGAGGGGGGAGGGAGGGTGG - Intergenic
949033006 2:241805589-241805611 GGCTGAGGGGGGAGGGAGGGTGG - Intergenic
949033022 2:241805628-241805650 GGCTGAGGGGGGAGGGAGGGTGG - Intergenic
949033053 2:241805702-241805724 GGCTGAGGGGGGAGGGAGGGTGG - Intergenic
949033099 2:241805815-241805837 GGCTGAGGGGGGAGGGAGGGTGG - Intergenic
949033115 2:241805854-241805876 GGCTGAGGGGGGAGGGAGGGTGG - Intergenic
949033131 2:241805893-241805915 GGCTGAGGGGGGAGGGAGGGTGG - Intergenic
949033221 2:241806113-241806135 GGCTGAGGGGGGAGGGAGGGTGG - Intergenic
949033329 2:241806375-241806397 GGCTGAGGGGGGAGGGAGGGTGG - Intergenic
949033361 2:241806452-241806474 GGCTGAGGGGGGAGGGAGGGTGG - Intergenic
949033377 2:241806491-241806513 GGCTGAGGGGGGAGGGAGGGTGG - Intergenic
949033454 2:241806678-241806700 GGCTGAGGGGGGAGGGAGGGTGG - Intergenic
949033500 2:241806791-241806813 GGCTGAGGGGGGAGGGAGGGTGG - Intergenic
949033608 2:241807056-241807078 GGCTGAGGGGGGAGGGAGGGTGG - Intergenic
949033624 2:241807095-241807117 GGCTGAGGGGGGAGGGAGGGTGG - Intergenic
949033671 2:241807212-241807234 GGCTGAGGGGGGAGGGAGGGTGG - Intergenic
949033702 2:241807290-241807312 GGCTGAGGCGGGAGGGAAGGTGG - Intergenic
949033761 2:241807446-241807468 GGCTGAGGGGGGAGGGAGGGTGG - Intergenic
949033793 2:241807523-241807545 GGCTGAGGGGGGAGGGAGGGTGG - Intergenic
949033844 2:241807648-241807670 GGCTGAGGGGGGAGGGAGGGAGG - Intergenic
949033861 2:241807687-241807709 GGCTGAGGGGGGAGGGAGGGTGG - Intergenic
949033908 2:241807804-241807826 GGCTGAGGGGGGAGGGAGGGTGG - Intergenic
949033925 2:241807843-241807865 GGCTGAGGGGGGAGGGAGGGTGG - Intergenic
949033960 2:241807929-241807951 GGCTGAGGGGGGAGGGAGGGAGG - Intergenic
949033977 2:241807968-241807990 GGCTGAGGGGGGAGGGAGGGTGG - Intergenic
949034025 2:241808093-241808115 GGCTGAGGGGGGAGGGAGGGAGG - Intergenic
1169022423 20:2340007-2340029 GGCCGGTGCAGGAGGGCGGGAGG + Intronic
1169065685 20:2693167-2693189 TGGCGCCGCGGGCGGGCGGGCGG + Intronic
1169077055 20:2767779-2767801 GGCAGCCTCAGGAGGGTGGGAGG + Intergenic
1169262540 20:4149047-4149069 GGCCGCCGCGAGAGGGTGAGGGG + Intronic
1169291769 20:4359068-4359090 GGGTGGGGCGGGAGGGCCGGAGG + Intergenic
1170200908 20:13742881-13742903 GGTTGCCACAGGAGGGAGGGCGG - Intronic
1171290920 20:23982416-23982438 GACTGCAGCGGGTGGGTGGGTGG - Intergenic
1172358889 20:34298597-34298619 GGCGGCGGCGGGAGGGGGGGGGG + Intronic
1172404390 20:34676900-34676922 AGAGGCCGCGGGAGGGCAGGTGG + Intronic
1172428619 20:34872857-34872879 GGCTGCGGCGGGGGAGTGGGAGG + Exonic
1172644484 20:36461399-36461421 GGCTGACGCGGGGGGCGGGGAGG + Intronic
1172773254 20:37393523-37393545 AGCTGCCTTGGGAGGGAGGGAGG - Intronic
1173294051 20:41739917-41739939 GGATGCCTGGGGAGGACGGGGGG + Intergenic
1173617314 20:44411512-44411534 GGCTGCCGTGGGAGGGGTGTGGG + Intronic
1174494708 20:50931244-50931266 GGCGGCCGGGGGGGGGGGGGCGG + Intergenic
1174656385 20:52175844-52175866 GGCGGCAGCGGGGGTGCGGGGGG - Intronic
1175210485 20:57350926-57350948 GGGCGGCGCGGGGGGGCGGGGGG + Intergenic
1175267142 20:57709782-57709804 GGCTGCCGAGGGGAGGCCGGGGG - Exonic
1175447367 20:59032419-59032441 GGCTTCCGCGGCAGGGCAGCAGG - Intergenic
1175537904 20:59728172-59728194 GGCTGCCGCGGGATGTGGGAGGG - Intronic
1175715780 20:61253277-61253299 GGGCGCCCCGGGAGGGCGAGCGG + Intronic
1175730584 20:61351072-61351094 GGCTGCCCGGGGATGGAGGGAGG - Intronic
1175889863 20:62311292-62311314 GGCTGCGGCGGGAGGCCTGGGGG + Exonic
1175889974 20:62311707-62311729 GGCTGCGGCTGGAGCTCGGGGGG + Exonic
1175926773 20:62475193-62475215 GGCAGCGGCGGCAGCGCGGGGGG - Exonic
1175944095 20:62550789-62550811 CGCTGCTGCAGGAGGGCTGGGGG + Exonic
1176141941 20:63548684-63548706 GGCTGCTGGGGGAGGCCGGCAGG - Intronic
1176207139 20:63895285-63895307 GGAGCCGGCGGGAGGGCGGGCGG + Exonic
1176230682 20:64031199-64031221 GGTTGCTGCTGGAGGCCGGGTGG + Intronic
1178485947 21:33020253-33020275 GGCTCAGGCGGGAGGGCAGGCGG + Intergenic
1178535603 21:33407850-33407872 GGCTGGCGGGGGTTGGCGGGGGG - Intronic
1178843733 21:36157294-36157316 GCCGGCCCCGGGAGGGCGCGCGG - Intronic
1178948457 21:36966803-36966825 GGCTGCGGCGGGAGGGGCGGGGG + Intronic
1178992224 21:37366264-37366286 GGCTGCCCCGGGCGGGGGAGGGG - Intronic
1179833400 21:44012380-44012402 GCCTGGCGCGGCCGGGCGGGCGG + Exonic
1179913890 21:44464142-44464164 GGTTCCTGCGGGACGGCGGGAGG + Intergenic
1179961796 21:44771775-44771797 GGCTGCTGTGGGAGGCCGTGTGG - Intronic
1179997181 21:44979413-44979435 GGATGCCGCGGAAGGGAGGAGGG + Intergenic
1179997188 21:44979433-44979455 GGGTGCCGCGGAAGGGCGGAGGG + Intergenic
1180184504 21:46132753-46132775 GGCTGCAGGGGGAGGGAGGCCGG - Exonic
1180696503 22:17754412-17754434 GGGTGCCCAGGGAGGGCAGGGGG + Intronic
1180779820 22:18513728-18513750 GACTGCAGCGGGTGGGTGGGTGG - Intergenic
1180908362 22:19431568-19431590 GGCGGCGGCCGGAGGGCGGGTGG - Exonic
1181198692 22:21205296-21205318 GACTGCAGCGGGTGGGTGGGTGG - Intergenic
1181457968 22:23070374-23070396 GGGCGGCGCGGGAGGGCGGGCGG + Exonic
1181467580 22:23118475-23118497 GGCAGCCGCGGGGGGTGGGGCGG - Intronic
1181478233 22:23181349-23181371 GGCTGCCCCGGGCCTGCGGGCGG - Exonic
1181648475 22:24246379-24246401 GACTGCAGCGGGTGGGTGGGTGG - Intergenic
1181666477 22:24401981-24402003 GGCGGCCGAGGTAGGGCAGGCGG - Intronic
1181690220 22:24555052-24555074 GGCTGGGGCGGGAGGGCGGTCGG + Intronic
1181703017 22:24631583-24631605 GACTGCAGCGGGTGGGTGGGTGG + Intergenic
1182143450 22:27982305-27982327 GGCTGTGGCGGGAGGGCCGGCGG + Exonic
1182298920 22:29327320-29327342 GGCAGCCGTGGGAGAGGGGGTGG - Intergenic
1182435509 22:30327052-30327074 GCCCGCCGGGGGAGGGTGGGCGG - Intergenic
1182715073 22:32351732-32351754 GGCGGTGGGGGGAGGGCGGGGGG + Intergenic
1183306678 22:37086489-37086511 GGCTGCTGGGGGAGGGTGGACGG + Intronic
1183332795 22:37230275-37230297 GGCTGGGGCGGTGGGGCGGGAGG + Intronic
1183427093 22:37745990-37746012 GGTGGCGGCCGGAGGGCGGGCGG - Intronic
1183582594 22:38734842-38734864 GGCTGCCTCGGGATGGAGCGGGG + Exonic
1183613515 22:38927307-38927329 GGCTGCCGGGGGCGGGGGGGGGG + Intergenic
1183702184 22:39457132-39457154 GGCTGGCGGGGGAGGGGAGGGGG + Intergenic
1184086900 22:42270695-42270717 GGCCGCGGCGCGCGGGCGGGCGG + Intronic
1184096066 22:42317170-42317192 GTGTGCCGAGTGAGGGCGGGCGG - Intronic
1184101576 22:42343941-42343963 GGCGGGGGCGGGCGGGCGGGAGG + Intergenic
1184109068 22:42384603-42384625 GGCTGGCGTGGGAGGTCTGGGGG - Exonic
1184393427 22:44218745-44218767 AGCTGCCGTGTGAGGGAGGGAGG - Intronic
1184664320 22:45979153-45979175 GGTTTCCCCGGGAGAGCGGGAGG + Intergenic
1184676264 22:46045020-46045042 CGCCGCCGGGCGAGGGCGGGAGG - Intergenic
1185044534 22:48522537-48522559 GGCTGCCTGGGGTGGGCGCGGGG + Intronic
1185072947 22:48667219-48667241 GGCTGGCTGGGGAGGGCGGGCGG - Intronic
1185381075 22:50507804-50507826 GACTGCCGCGGGCGGGCGGGCGG - Intergenic
1185381112 22:50507894-50507916 GGCAGCCGCGGGCGGGCGGACGG - Intergenic
1185409716 22:50675152-50675174 CGCGGCCCCGGGAGGGCGGCTGG - Intergenic
1185413386 22:50697410-50697432 GGCGGCGAGGGGAGGGCGGGAGG + Intergenic
1203228113 22_KI270731v1_random:89541-89563 GACTGCAGCGGGTGGGTGGGTGG + Intergenic
949090897 3:27806-27828 GGGTGCCGGGGGTGGGAGGGTGG - Intergenic
949510261 3:4761098-4761120 GGTTGCCTCTGGAGGGTGGGGGG - Intronic
950404523 3:12796559-12796581 GGCGGCCGCGGGAGGCGGGCGGG - Intronic
950487646 3:13282601-13282623 GGCGGGTGCGGGAGGGCGCGTGG - Intergenic
950520311 3:13494232-13494254 GGCTTCCCAGGGAGGGAGGGAGG + Intronic
950521116 3:13498615-13498637 GGGGGCTGGGGGAGGGCGGGAGG + Intronic
950575836 3:13831675-13831697 GGCTGCCCAGGGAGGGGGAGTGG - Intronic
951078534 3:18425252-18425274 GGCGGCGGCGGGCGGCCGGGAGG - Intronic
952287333 3:31981383-31981405 GGCCGCGGCGGGAGGAGGGGCGG - Intronic
952968569 3:38636628-38636650 GGCTGCTCCTGGTGGGCGGGTGG + Intronic
953657030 3:44862142-44862164 TGCTGCTGCGGGCGGGCGGGCGG + Intronic
953680686 3:45035963-45035985 AGGGGCCGCGGGAGGCCGGGAGG + Exonic
953904769 3:46863075-46863097 GGCTGCAGCAGGAGGGATGGTGG - Intronic
953988840 3:47467874-47467896 GCCTGCCGGGGGATGGGGGGAGG - Intronic
954238746 3:49277101-49277123 GGGAGCCGCGGTGGGGCGGGAGG - Exonic
954337781 3:49929776-49929798 GGCGGCCGGGTGAGGGCGGTGGG - Exonic
954812359 3:53256013-53256035 GGCTGCCGAGGCCGGGCGCGGGG + Exonic
954912678 3:54122366-54122388 GGCCGCGGCGGGAGGGCGGCGGG - Intergenic
955972038 3:64445584-64445606 GGCGAACCCGGGAGGGCGGGGGG - Intergenic
957072911 3:75580072-75580094 GGCTGTTGCTGGAGGGAGGGGGG - Intergenic
957452765 3:80401304-80401326 AGCTGCTGCGGGGGGGTGGGGGG + Intergenic
959539458 3:107523393-107523415 GGCTGGGGCCGGGGGGCGGGGGG + Intronic
960740799 3:120831259-120831281 GGCTCCCTGGGGAGGGCGTGCGG + Intergenic
961202538 3:125056034-125056056 GGGAGCCGCGGGAGGGCTGCCGG + Intergenic
961551664 3:127673225-127673247 GGCTGCGGCGGGGGTCCGGGTGG - Intronic
961612567 3:128152898-128152920 GGGGGGCGGGGGAGGGCGGGGGG - Intronic
962520744 3:136195850-136195872 GGCCGCCGCCGGCGGGCGGGAGG + Intronic
964569212 3:158094500-158094522 GGCCGCGGCGGGAGCGCGGTAGG - Intergenic
965774997 3:172219622-172219644 GGCTGAGGCAGGAGGGTGGGTGG - Intronic
966711907 3:182980395-182980417 GGTCGCCGCGGGACGGAGGGCGG + Intronic
966912815 3:184568952-184568974 GGCGGCGGCGGGAAGGAGGGAGG - Intronic
967859687 3:194141554-194141576 GGCGGCGGCGGGAGGCCGGGAGG + Intergenic
968230582 3:197002873-197002895 GGCGGCGGCGGGAGGGAGGCCGG - Exonic
968550033 4:1217349-1217371 GGCTGCTGCAGGAGGGAGGAGGG + Intronic
968562213 4:1290052-1290074 GGCCGCCCCGGGAGGGCCAGCGG + Intronic
968571991 4:1346886-1346908 GGCTGCCGGGGGTGGGGAGGGGG - Intergenic
968887272 4:3341465-3341487 GGGTGCGGGGGGAGGGAGGGTGG + Intronic
968965274 4:3766327-3766349 GGCTGCGGGGGGAGGGGGGCAGG - Intronic
969053417 4:4387583-4387605 GCCTGCGGCGGGAGGGCCGGGGG - Exonic
969477074 4:7427845-7427867 GCCTGGTGCGGGGGGGCGGGGGG - Intronic
969520875 4:7677209-7677231 GGCTCACGCGGGAGGCCGAGGGG - Intronic
969720856 4:8892558-8892580 GGCAGCCGGGGAAGGGCGTGGGG - Intergenic
970897144 4:21117294-21117316 GGTTGCCGGGGGGGGGGGGGGGG + Intronic
972418752 4:38867742-38867764 GGACGCGGCCGGAGGGCGGGCGG - Intronic
972543173 4:40056787-40056809 GCCCGCCGCGAGAGGGCGGGTGG - Intergenic
973292392 4:48483496-48483518 GGCGACCGCGGGACGGCGAGAGG + Exonic
976765405 4:88592882-88592904 GGCGGCCGAGCGCGGGCGGGAGG - Intronic
978978922 4:114917532-114917554 GGCTGAGGTGGGAGGGCTGGAGG + Intronic
980990491 4:139735059-139735081 GGGGGCCGCGGAGGGGCGGGCGG - Intronic
981315422 4:143336288-143336310 GGCGGCCGGGAGAGGGAGGGAGG + Intergenic
982033533 4:151324765-151324787 GGCGGCTGGGGGAGGGAGGGAGG + Intronic
983323891 4:166228250-166228272 GGCTGCTGCGGCAGGTTGGGTGG - Intergenic
983398521 4:167234074-167234096 GGCTGCAGCCGGGGGGCGGTCGG - Exonic
983649581 4:170025736-170025758 TGATGCCGCAGGAGTGCGGGCGG - Intronic
983656467 4:170089943-170089965 GGCGGCCGCAGGAGCGCGTGCGG - Exonic
984778542 4:183504736-183504758 GGCGGCCGCGGGCGGAGGGGCGG + Intergenic
984781369 4:183529132-183529154 GGCTGAGGTGGGAGGGTGGGAGG + Intergenic
984830547 4:183968745-183968767 GGTTGCGGCAGGGGGGCGGGGGG + Intronic
984884721 4:184440238-184440260 GGCTGCCGCGGGAGCATGGAAGG - Intronic
984888956 4:184474586-184474608 CGCGGCCGGAGGAGGGCGGGGGG - Intergenic
985081202 4:186265794-186265816 GGCTGCTGGGGGAGAGCGGACGG - Intergenic
985100157 4:186450810-186450832 GGCTGCTGCGGGGGTGCAGGGGG + Intronic
985558080 5:567953-567975 GGCGGCAGCTGGAGGGCAGGTGG - Intergenic
985616560 5:926565-926587 GGCGGCCCCCGCAGGGCGGGAGG - Intergenic
985660863 5:1155926-1155948 GGCGGGCGCGGGAGGCCGGGAGG + Intergenic
985724876 5:1510868-1510890 GGCCGCTGCTGGAGGGCAGGCGG + Intronic
985893861 5:2737935-2737957 GGCTGCAGGGGGTGGGCAGGGGG - Intergenic
985995652 5:3595732-3595754 GGCCGGCGAGGGCGGGCGGGAGG + Intergenic
986165938 5:5271465-5271487 GGCAGCCGCGGGAGGGCCGTAGG - Intronic
987050470 5:14143766-14143788 GGCCGCCGCGGCGGGGCCGGAGG - Exonic
988863443 5:35308558-35308580 GGCTGCTGCAGGAGGGAGGGAGG - Intergenic
989146910 5:38258465-38258487 GCTGGCCGCGGGAGGGAGGGAGG - Exonic
990545259 5:56815687-56815709 GGCTGCCGCGGGACTGCTGCGGG + Exonic
990909230 5:60837291-60837313 GGCAGGCGTGGTAGGGCGGGGGG + Intronic
993501940 5:88674964-88674986 GGCTGCCGCGGGCGGAAGGAGGG + Intergenic
995141004 5:108735034-108735056 GCCGGCCGGGGGAGGGTGGGTGG + Intergenic
995354607 5:111224034-111224056 GGTCCCCGCGGGAGGGCGCGTGG + Intronic
996329429 5:122312304-122312326 GGACGCCGCGGGGAGGCGGGAGG + Intronic
996423765 5:123290788-123290810 GGCTGCCCCAGGAGGAGGGGTGG - Intergenic
996932830 5:128911231-128911253 GCCTGCTGGGGGAGGGCAGGGGG - Intronic
997521280 5:134525891-134525913 GGCCGGCGCGGGAGGGCGGGGGG - Intronic
997653008 5:135536026-135536048 GGCTGCCGCGGGGGCGGAGGTGG - Intergenic
998957641 5:147453734-147453756 AGCCGCCGCGGGAGCCCGGGAGG - Intronic
999871390 5:155754997-155755019 GGCAGCCTGGGGAGGGCAGGTGG - Intergenic
1002061928 5:176630314-176630336 GGCTGCGGCGGGCGGACGCGGGG + Exonic
1002086039 5:176776239-176776261 GGCTGCGCTGGGAGGGCGGTTGG + Intergenic
1002093516 5:176817936-176817958 GGCGGCCGCGGGCGGGCTGGCGG - Intronic
1002184182 5:177446681-177446703 GGCTGCCCCCGGAGGGAAGGAGG - Intronic
1002211976 5:177604621-177604643 GGCAGGGGCAGGAGGGCGGGAGG + Intronic
1002261028 5:177994234-177994256 GGCGGCGCCGGGAGTGCGGGCGG + Exonic
1002305115 5:178278637-178278659 GGCTGGCCCAGGAGGGTGGGAGG - Intronic
1002670348 5:180861361-180861383 GGCGCCGGCGGGAGGGAGGGAGG + Intergenic
1002707629 5:181173479-181173501 GGCTGAGGCGGGAGGACGGCTGG - Intergenic
1002741264 5:181437132-181437154 GGCCGCCGCGGTGGGGTGGGCGG + Intergenic
1003046505 6:2737965-2737987 GGGTGCCGGGGGCGGGTGGGGGG + Intronic
1003175771 6:3751570-3751592 GCCTCCTGCGGGCGGGCGGGCGG - Exonic
1003234274 6:4281942-4281964 GACTGCCGCGGGGGAGCAGGTGG - Intergenic
1004216936 6:13711766-13711788 GGGCGACGCGGGAGCGCGGGAGG + Intergenic
1004248479 6:14002665-14002687 GCCCACCGCGGGCGGGCGGGAGG - Intergenic
1004658371 6:17686875-17686897 GGCAGCCGGGGGCGGGCGGCGGG + Intronic
1005512152 6:26520915-26520937 GGCTGCGGCGGGTGGGGCGGCGG - Intergenic
1006366870 6:33621248-33621270 AGCTGCGGGGGGAGGGGGGGCGG + Exonic
1006503566 6:34473582-34473604 GGCAGCCGAGGCAGGGCTGGAGG + Intronic
1006606213 6:35259598-35259620 GGCTGCCGCGGCGAAGCGGGGGG + Intronic
1007455140 6:41971364-41971386 GGCTGAGGCGGGAGGATGGGAGG - Intronic
1007473857 6:42106688-42106710 GGGTGCTGGGGGAGGGAGGGGGG + Exonic
1007576638 6:42929419-42929441 GGCTGCGAGAGGAGGGCGGGCGG + Exonic
1007781551 6:44257469-44257491 GGCGGCGGCGGGAGCGCAGGGGG - Exonic
1008629404 6:53348864-53348886 GGCGGCGGAGGGAGCGCGGGTGG + Exonic
1013155729 6:107490040-107490062 GGCCGGCGCGGGAGGAGGGGAGG - Exonic
1013273288 6:108561181-108561203 CCCAGCCGCGGGCGGGCGGGCGG + Exonic
1013619422 6:111873333-111873355 GGCTGCCGCGGGCGAGGAGGAGG - Exonic
1016010834 6:139135790-139135812 GGCAGCCGCGGCGGGGCGGAGGG - Intronic
1016433035 6:144008047-144008069 GGCTGCGGCGGGCGGGCTGGGGG - Intronic
1016755250 6:147677677-147677699 GGGTGCCCAGGGATGGCGGGCGG + Intronic
1016990718 6:149925965-149925987 GGCTGCTGCGGGAGGGCGCCCGG + Intergenic
1017007445 6:150038102-150038124 GGATGCTGCGGGAGGGCGCCCGG + Intergenic
1017021384 6:150143030-150143052 GGCTGCTCTGGGAGGGCGGGAGG - Intergenic
1017027885 6:150197559-150197581 GGCTGCCGTGGGAAGGCTGGTGG + Intronic
1017561842 6:155636501-155636523 GGCTGCAGATGGAGGGCTGGGGG + Intergenic
1018091511 6:160349566-160349588 GGCTGCTGCCGGCGGGTGGGCGG + Intronic
1018312793 6:162528052-162528074 GGAGGTCGGGGGAGGGCGGGGGG + Intronic
1018389140 6:163329627-163329649 GGCTGCAGGGGGAGTGGGGGAGG - Intergenic
1018652899 6:166006138-166006160 AGCAGCCGCGGGCGGGCGGGGGG - Intergenic
1018686280 6:166307293-166307315 GGCTGCCGCGCGGGGCCGGGCGG - Exonic
1019279202 7:191964-191986 GCGTCCCGCGGGTGGGCGGGGGG + Intergenic
1019349650 7:548584-548606 GGCTGCCCCGGGAGGGGTTGGGG - Intergenic
1019578302 7:1748190-1748212 GGTGGCGGCGGGAGGACGGGCGG + Intergenic
1019643358 7:2116244-2116266 GGGTGCAGCTGGAGGGCAGGCGG + Intronic
1019714397 7:2531715-2531737 GGCGGCTGCGGGAGGGCGTGCGG - Intergenic
1019741924 7:2679333-2679355 GGCGGCTGCGGGAGGGCGTGCGG + Intergenic
1019989554 7:4682252-4682274 GGCTGCAGCGGCGGCGCGGGGGG - Intergenic
1021719252 7:23490445-23490467 GGCGGGCGCGGGCGGGCGGGCGG + Intergenic
1022088143 7:27088435-27088457 GGCTGCGGGGAGCGGGCGGGGGG - Intergenic
1022105448 7:27193183-27193205 GGCTGCGGCAGGACGGCTGGCGG - Intergenic
1022207751 7:28180227-28180249 AGGTGCCGCGGGCGGGCGGGCGG - Intronic
1022207895 7:28180623-28180645 GGCGGGCGAGGGAGGGAGGGAGG + Exonic
1022389943 7:29934809-29934831 GGGTGCCACGGGAGGGTGGTGGG + Intronic
1022419842 7:30210107-30210129 AGCTGCCGGAGGAGGCCGGGAGG + Intergenic
1022517806 7:30987028-30987050 GGCTCCTCTGGGAGGGCGGGGGG + Intronic
1022525896 7:31037068-31037090 GGCAGCCCTGGGAGGGAGGGAGG + Intergenic
1022532268 7:31074459-31074481 GGCTGCAGAGGTCGGGCGGGTGG - Intronic
1023198066 7:37663838-37663860 GGCGGCGGGGGGAGGGAGGGAGG - Intergenic
1023818266 7:43966223-43966245 GCCTGCCGGGGGAGGAGGGGGGG + Intergenic
1023937274 7:44748890-44748912 GGCGGCCCCGGGGCGGCGGGCGG + Intronic
1023951271 7:44848002-44848024 GTCGGCAGCGGGAGGGCGCGCGG - Exonic
1026018937 7:66693522-66693544 GGCAGCCGAGGGAGGGGAGGAGG - Intronic
1027173829 7:75890754-75890776 GGCTGTGGAGGGAGGGTGGGAGG + Intergenic
1027539949 7:79453912-79453934 AGCTGCGGAGGGAGGGAGGGAGG - Intergenic
1029068045 7:97872180-97872202 GGCTCCTGCGGTAGGGAGGGCGG - Intronic
1029110530 7:98211312-98211334 GGCACCTGCGGGCGGGCGGGCGG - Intergenic
1029361920 7:100094074-100094096 GGCTGGAGCGGGAGGTGGGGAGG + Intronic
1029647774 7:101869058-101869080 GGCTTCCGAGGGCGGGCGAGGGG + Intronic
1029742896 7:102501055-102501077 GCCTGCCGGGGGAGGAGGGGGGG + Intronic
1029760886 7:102600216-102600238 GCCTGCCGGGGGAGGAGGGGGGG + Intronic
1029862515 7:103588384-103588406 GGCTACCAAGGGAGGGAGGGAGG + Intronic
1029896662 7:103990245-103990267 CGCTGCCGCGAGGGGCCGGGCGG - Intergenic
1031052060 7:116954148-116954170 GGCCTCCGCGGCCGGGCGGGAGG - Intronic
1031361929 7:120857757-120857779 GGCAGCCGCCGGCGGGCTGGCGG + Intronic
1031483198 7:122302079-122302101 GGCTGCTGCGGTAGCGGGGGCGG + Exonic
1031629887 7:124033142-124033164 CGCTGCCGCGGGACCGCGGCCGG - Intergenic
1031914799 7:127552935-127552957 GCCTGCTGTGGGATGGCGGGAGG + Intergenic
1031966465 7:128031321-128031343 GGCCGCCGCCGGAGGGAGTGCGG + Intronic
1032194417 7:129780931-129780953 GGCTCCCTCGGGAGGGGGCGGGG + Intergenic
1032254747 7:130288170-130288192 GGCTGAGGCGGGAGGGCTGCTGG - Intronic
1034128925 7:148698602-148698624 GGCAGCGGCGAGCGGGCGGGAGG + Intronic
1034880347 7:154757969-154757991 GGCGGCGGGGAGAGGGCGGGGGG - Intronic
1035160935 7:156949657-156949679 GGCTGCGCGGGGCGGGCGGGCGG - Intergenic
1035501693 8:94860-94882 GGCCGCCGCGGTGGGGTGGGCGG - Intergenic
1036561614 8:9904032-9904054 GGCAGCCGGGGCAGGGCGCGCGG + Intergenic
1037337050 8:17801561-17801583 GGCTGGCGCCGGGGGGCGTGGGG - Intergenic
1037815907 8:22111756-22111778 GGCAGCTGAGGGAGGACGGGAGG + Intergenic
1037833151 8:22200979-22201001 GGGTGGGGCGGGAGGGCAGGCGG - Intronic
1038012115 8:23483554-23483576 GGAGCCGGCGGGAGGGCGGGCGG - Intergenic
1038828655 8:31033470-31033492 GGGTGCAGCGGGAGTGCGAGGGG + Exonic
1039779076 8:40766065-40766087 GGAGGCCGCAGGAGGGAGGGAGG - Intronic
1040471539 8:47738576-47738598 TCCTGTCGCCGGAGGGCGGGGGG + Exonic
1041712957 8:60910118-60910140 GGGCGCCGGGGGCGGGCGGGCGG - Intergenic
1042294401 8:67203872-67203894 GGCGGCAGGGGGAGGGCTGGGGG - Intronic
1042696024 8:71556387-71556409 GGCTGCCGCGGGCGCGCGGGCGG - Intronic
1042859185 8:73295626-73295648 GCCTGCCGTGGTAGGGCGCGGGG - Intronic
1044591407 8:93917173-93917195 GGCGGCCGCGGGCGTGCGGAGGG + Exonic
1045231185 8:100309437-100309459 GGTTGCCGCGGGGAGGCGGCGGG - Intronic
1045718317 8:105074901-105074923 AGCAGCAGCGGGAGGGAGGGAGG - Intronic
1046654061 8:116874249-116874271 GGCTGCGGAGGGAGGGGAGGAGG - Intronic
1048944170 8:139429057-139429079 GGCTGATGGGGGAGGGAGGGAGG - Intergenic
1048981254 8:139704223-139704245 GGAGGCTGCGGGAGGGAGGGAGG - Intergenic
1049585124 8:143429424-143429446 GGCGGCCCCGGGAGCGCGGGCGG - Exonic
1049600503 8:143505281-143505303 GCCTGCCGAGGGAGGGCTGAGGG + Intronic
1049746884 8:144266764-144266786 GGCGCCCGGCGGAGGGCGGGGGG + Exonic
1049775288 8:144401149-144401171 AGCTGCAGGGGGAGGGAGGGTGG + Intronic
1049861572 8:144902280-144902302 GACAGCCGCGGCAGGGAGGGTGG + Intergenic
1051809239 9:21031464-21031486 CTCTGCGGCGGGCGGGCGGGCGG - Intronic
1053129076 9:35605301-35605323 GGCGGAGGCGGGCGGGCGGGCGG - Exonic
1054496152 9:65824994-65825016 GCCTGCCGGGGGCGGGGGGGGGG - Intergenic
1057097447 9:92325199-92325221 GGCTGCCGTGGGTAGGCTGGGGG - Exonic
1057132340 9:92662858-92662880 GGCTGCAGCGGAAGGGTAGGTGG + Intronic
1057145666 9:92757580-92757602 AGCTACTGCGGGGGGGCGGGGGG + Intronic
1057294651 9:93828063-93828085 GGCGGCCCAGGGCGGGCGGGCGG + Intergenic
1057619154 9:96619576-96619598 GGCGGCCGCGGGAGGCAGCGGGG - Exonic
1057783400 9:98068710-98068732 GGCTGAGGCAGGAAGGCGGGAGG + Intronic
1059191861 9:112333935-112333957 CGGGGCCGCGGGAGGGCGGGCGG - Intergenic
1059414756 9:114155861-114155883 GCCTGGCGCGGCGGGGCGGGGGG + Exonic
1059613215 9:115921610-115921632 TGATGCCTCGGGAGGGCGAGGGG - Intergenic
1060109246 9:120894718-120894740 GGGAGCCGCGGGCGGCCGGGTGG - Intronic
1060700677 9:125747149-125747171 GGCGGCCGCGTGAGGGCAGCGGG + Intergenic
1060825078 9:126683174-126683196 GGAGGCCGGGGGAGGCCGGGAGG + Intronic
1061129779 9:128702523-128702545 GGCTCCCGCGGGCGCGCGGCGGG + Exonic
1061149073 9:128818755-128818777 GGCGGCGGCGGGAGGACGCGCGG + Exonic
1061181690 9:129028286-129028308 GGCTGCGGCGGGCGGGCAGGCGG - Intronic
1061237747 9:129352219-129352241 GGCTCCCGGGGGATGGGGGGAGG + Intergenic
1061306396 9:129735602-129735624 CTCTGCCGTGGGAGGGCAGGGGG - Intergenic
1061408078 9:130403547-130403569 GGCTGAGGTGGGAGGTCGGGAGG + Intronic
1061472227 9:130835559-130835581 AGCAGCAGCGGGAGGGCGCGCGG - Intronic
1061718621 9:132537519-132537541 GGCTCCCGGGGGCGGGCGGTGGG + Intronic
1061727821 9:132590790-132590812 GCCTGGTGCGGGAGGCCGGGAGG - Intergenic
1061931601 9:133835758-133835780 TGCTCCTGCGGGAGGGCAGGGGG + Intronic
1062028109 9:134349811-134349833 GGCTAGCTCGGGTGGGCGGGCGG + Intronic
1062043302 9:134414009-134414031 CGCTGGCGCCGGAGGCCGGGCGG - Intronic
1062105762 9:134753940-134753962 CGCTGCCGCCGGAGAACGGGAGG - Intronic
1062167380 9:135114678-135114700 GGCAGCCTGGGGAGGGAGGGAGG + Intronic
1062230736 9:135480122-135480144 GGCCGCGGCGGGCGGGCGGCGGG + Intronic
1062252265 9:135604322-135604344 GGCTGCAGAGTGAGGGTGGGTGG - Intergenic
1062306068 9:135907665-135907687 GGCGGGCGCGGGCTGGCGGGCGG - Intergenic
1062353607 9:136151583-136151605 TGCTGCAGCGGGAGGGCGGTGGG + Intergenic
1062462012 9:136666060-136666082 GCCGGCGGCGGGCGGGCGGGCGG + Intronic
1062498150 9:136841238-136841260 GGCTGCCGTGGGTTGGCAGGAGG + Intronic
1062516852 9:136941195-136941217 GGCAGCAGCGGGCGGGCGGCCGG - Intronic
1062579022 9:137221529-137221551 GGCTGGCGAGGGGGCGCGGGGGG + Exonic
1062696233 9:137877687-137877709 GGCCGGCGCGGCAGGGTGGGCGG + Intergenic
1203512593 Un_KI270741v1:134965-134987 GGTGGGCGCGGGAGTGCGGGGGG - Intergenic
1203607143 Un_KI270748v1:68212-68234 GGCCGCCGCGGTGGGGTGGGCGG + Intergenic
1203608456 Un_KI270748v1:75478-75500 GCCTGCCGCTGGAGAGCGTGGGG - Intergenic
1185747457 X:2584164-2584186 GGGGCGCGCGGGAGGGCGGGGGG + Intergenic
1186413279 X:9362039-9362061 GGCTGAGGCGGGGGGGCGGGGGG + Intergenic
1186455606 X:9707801-9707823 GGCTGCTGCGAGAGCCCGGGAGG - Intronic
1186512253 X:10138911-10138933 GCCTGCTGCGGGAGGCCGAGCGG + Exonic
1188004081 X:25005484-25005506 GGCGGCCGCGGCGGCGCGGGTGG - Intronic
1188168597 X:26892901-26892923 GGCAGCAGCGGGGGGGGGGGGGG - Intergenic
1188242666 X:27809513-27809535 GGCGGCGGGGGGGGGGCGGGCGG - Intronic
1189446760 X:41086630-41086652 GGTTATCGCGGGAGGGTGGGGGG - Intronic
1190712585 X:53081331-53081353 GGCAGAAGCGGGGGGGCGGGGGG + Intergenic
1190937335 X:55008624-55008646 GGATGCCGTGGGAGGGAGAGAGG + Exonic
1192657280 X:73004313-73004335 GGTTGGCGGGGGAGGGCTGGGGG - Exonic
1192664840 X:73078694-73078716 GGTTGGCGGGGGAGGGCTGGGGG + Exonic
1192962511 X:76145366-76145388 GGGTGCTGGGGGAGGGCTGGCGG + Intergenic
1192963022 X:76149721-76149743 GGGTGCTGGGGGAGGGCTGGCGG - Intergenic
1193658290 X:84224906-84224928 GGCTGCCTGGGGTGGGCGGATGG + Intergenic
1196031114 X:111096442-111096464 GGCTACCGCGGGGGAGGGGGTGG + Intronic
1196394457 X:115244310-115244332 GCCTGTCGAGGGAGGGTGGGTGG + Intergenic
1196467705 X:115990363-115990385 TGCTGCTGCGGGTGGGGGGGTGG - Intergenic
1196645850 X:118116816-118116838 GGCTGCTGAGGGAGGGGGGCGGG + Intronic
1197789727 X:130241994-130242016 GGAAGCCGGGGGGGGGCGGGTGG + Intronic
1198657673 X:138932500-138932522 ACCCGGCGCGGGAGGGCGGGGGG + Intronic
1199772593 X:150984032-150984054 GGCGGCGCCGGGCGGGCGGGAGG - Intronic
1200045922 X:153401012-153401034 GGCCCCCTCGGGAGGGCGGTTGG - Intergenic
1200089705 X:153628753-153628775 GCCTGCTGGGGGAGGGAGGGAGG - Intergenic
1200128737 X:153830143-153830165 GGCGGGCGTGGGAGAGCGGGAGG - Intronic
1200226168 X:154419075-154419097 GGCTGGGGAGGGAGGGCAGGTGG + Intronic