ID: 901088342

View in Genome Browser
Species Human (GRCh38)
Location 1:6625447-6625469
Sequence CGCGCCCGCCGCGGGGATGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 160}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901088335_901088342 -4 Left 901088335 1:6625428-6625450 CCAGAGGGGCTGGCGCCGCCGCG 0: 1
1: 0
2: 0
3: 22
4: 212
Right 901088342 1:6625447-6625469 CGCGCCCGCCGCGGGGATGCGGG 0: 1
1: 0
2: 1
3: 14
4: 160
901088333_901088342 3 Left 901088333 1:6625421-6625443 CCTGGGCCCAGAGGGGCTGGCGC 0: 1
1: 0
2: 4
3: 54
4: 426
Right 901088342 1:6625447-6625469 CGCGCCCGCCGCGGGGATGCGGG 0: 1
1: 0
2: 1
3: 14
4: 160
901088325_901088342 21 Left 901088325 1:6625403-6625425 CCGGGGACAGGCCGAGGTCCTGG 0: 1
1: 0
2: 0
3: 30
4: 344
Right 901088342 1:6625447-6625469 CGCGCCCGCCGCGGGGATGCGGG 0: 1
1: 0
2: 1
3: 14
4: 160
901088330_901088342 10 Left 901088330 1:6625414-6625436 CCGAGGTCCTGGGCCCAGAGGGG 0: 1
1: 1
2: 5
3: 42
4: 490
Right 901088342 1:6625447-6625469 CGCGCCCGCCGCGGGGATGCGGG 0: 1
1: 0
2: 1
3: 14
4: 160
901088324_901088342 22 Left 901088324 1:6625402-6625424 CCCGGGGACAGGCCGAGGTCCTG 0: 1
1: 0
2: 1
3: 25
4: 312
Right 901088342 1:6625447-6625469 CGCGCCCGCCGCGGGGATGCGGG 0: 1
1: 0
2: 1
3: 14
4: 160
901088322_901088342 30 Left 901088322 1:6625394-6625416 CCGCTGGGCCCGGGGACAGGCCG 0: 1
1: 0
2: 0
3: 21
4: 235
Right 901088342 1:6625447-6625469 CGCGCCCGCCGCGGGGATGCGGG 0: 1
1: 0
2: 1
3: 14
4: 160
901088334_901088342 -3 Left 901088334 1:6625427-6625449 CCCAGAGGGGCTGGCGCCGCCGC 0: 1
1: 0
2: 1
3: 17
4: 175
Right 901088342 1:6625447-6625469 CGCGCCCGCCGCGGGGATGCGGG 0: 1
1: 0
2: 1
3: 14
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901088342 Original CRISPR CGCGCCCGCCGCGGGGATGC GGG Intronic
900364791 1:2306712-2306734 CGGGCCCGCCCCGAGGCTGCGGG + Exonic
900532507 1:3161640-3161662 CCCGCCCGGCGCGGAGAGGCCGG + Intronic
900993038 1:6106688-6106710 GGCGGCCACCGGGGGGATGCGGG + Exonic
901088342 1:6625447-6625469 CGCGCCCGCCGCGGGGATGCGGG + Intronic
901279896 1:8026069-8026091 CGCGCCGGGCGCCGGGATCCAGG - Intronic
902520328 1:17011984-17012006 AGCGCCCGCGCCGGGGCTGCCGG + Intergenic
902623369 1:17663118-17663140 GGCGCGCGCCGCTTGGATGCCGG + Intronic
905803653 1:40861464-40861486 CGCGCCCTCCGCGAGGGTGGAGG - Exonic
905891525 1:41521396-41521418 TGCCCCCGCCACGGGGGTGCAGG + Intronic
908272945 1:62437626-62437648 GGCGCCCGGCGCGGGGGTGTGGG + Intronic
908401322 1:63774700-63774722 CCGGCCCGCCGCGGGGCTCCGGG - Intronic
908534637 1:65066703-65066725 CGCCGCCGCCGCGGGGACTCCGG + Intergenic
908751825 1:67430861-67430883 CGCGCCGGCCGCGGGTAGGCTGG + Intergenic
911027173 1:93448069-93448091 CCCGCCCAGCGCGGGGAGGCGGG + Intergenic
912411568 1:109483938-109483960 CGCGTCCGCGGCGGTGATGGCGG + Exonic
918078757 1:181190131-181190153 CCAGCCCGCAGCGGGGCTGCTGG + Intergenic
920704817 1:208243498-208243520 CTCGCCCGCCGCGGCCAAGCCGG + Intronic
921089486 1:211830173-211830195 CGCGCCCGCCGAGGTGAGCCCGG - Intronic
1067105222 10:43362039-43362061 CGGGCCCCCTGCGGGGTTGCAGG + Intergenic
1073327714 10:102651910-102651932 CGAGCCCGCCTCAGGTATGCTGG - Intronic
1075999855 10:126905754-126905776 AGCTCCAGCCCCGGGGATGCGGG + Intronic
1076869663 10:133187169-133187191 CGCTGCCTCCGCGGGGACGCTGG + Intronic
1076879063 10:133231108-133231130 CGCGCGGTCCTCGGGGATGCAGG - Exonic
1077107993 11:850143-850165 CGCGCGGGCGGCGGGGACGCCGG + Intronic
1078375866 11:10792622-10792644 AGCGCCCTCTGCCGGGATGCTGG - Intergenic
1083033509 11:59615546-59615568 GGCGGCGGCCGCGGAGATGCGGG - Exonic
1083965793 11:66042951-66042973 CGCCAGCGCCGCGGGGATGGCGG + Exonic
1084258056 11:67955875-67955897 CGCGCCCACCGCGGACACGCCGG + Intergenic
1084265624 11:68003881-68003903 CGCCCCCGCCGGGGGGACCCTGG + Intronic
1084304406 11:68272112-68272134 CGAGCCGGCCCCGGGGAGGCGGG - Intergenic
1089525555 11:119094622-119094644 CGAGCCTGCCGGGGGGAGGCCGG - Exonic
1091474017 12:753879-753901 CGGGACAGCCGCGGGGATGCTGG - Exonic
1092435942 12:8446968-8446990 GGCGCCCCCCGCGATGATGCGGG - Intergenic
1092751946 12:11727288-11727310 TGCGCCCGCCTGCGGGATGCCGG - Intronic
1092871954 12:12813260-12813282 CGCGCCCCCTGCGGGCTTGCCGG - Intronic
1096250067 12:50025299-50025321 CGTGGCCGCCGCGGGGGTCCGGG - Intronic
1097491013 12:60270117-60270139 GGCGCGCGCCGCGGGACTGCCGG + Intergenic
1097929635 12:65169845-65169867 GGCGGCGGCCGCGGGGATGGGGG + Exonic
1100611544 12:96194939-96194961 CGCGCCGGGCCCGGGGCTGCGGG + Intronic
1102527112 12:113520051-113520073 CGTGCCAGCCGCGGGGATCCTGG + Intergenic
1103392537 12:120584813-120584835 CGTGCCCGCCGCCGGAATGCCGG + Intergenic
1103779566 12:123389571-123389593 CGGGCGCGCCGCAGGGGTGCGGG - Intronic
1103899422 12:124295563-124295585 CGCGCGCGCGTCGAGGATGCCGG - Intronic
1112050682 13:95641952-95641974 GGCGCCCCCGACGGGGATGCCGG - Intronic
1115261303 14:31457158-31457180 CGGTCCGGCCGCGGGGATACCGG - Intronic
1115320878 14:32077561-32077583 CGCGGCCGCCGAGGGGAGCCTGG + Intronic
1115398584 14:32934899-32934921 CGGGGCGGCCGCGGGGGTGCCGG + Intergenic
1115474612 14:33800800-33800822 CGCGCCCGCCGAGGTGACCCTGG + Exonic
1116887134 14:50232016-50232038 CCAGCCCGGCGCGGGGGTGCGGG + Intergenic
1118206370 14:63727628-63727650 CCCGCGCGCCGCGGCGAGGCCGG + Exonic
1119046397 14:71321361-71321383 CGCGCCGGGCGCGGTGAAGCCGG - Intronic
1120521257 14:85530434-85530456 CGCGGCAGCAGCGGGGATCCCGG - Exonic
1121137207 14:91509895-91509917 CGCGGCCCCCTCGGGGCTGCCGG - Exonic
1121645753 14:95516429-95516451 CGCGCCCGGCGCGGGGGCGGGGG - Intronic
1128322543 15:66703442-66703464 CGGGGCCGCCGCGGGGCTACCGG - Exonic
1129780095 15:78264439-78264461 CGAACCCGCCGCGGGGCCGCCGG + Intronic
1130224557 15:82046987-82047009 CGCCGCCACCGCGGGGACGCAGG + Intergenic
1132687770 16:1169444-1169466 CGCGGGGGCCGCGGGCATGCTGG - Intronic
1132837093 16:1959609-1959631 CGCGCCCGCCGCCGCCATGCCGG + Exonic
1132946008 16:2531807-2531829 GGCGCACGCTGCCGGGATGCTGG + Intergenic
1134419305 16:14071269-14071291 CGCGCGCGCCGCGGGGAGGAGGG + Intergenic
1137988486 16:53130532-53130554 GGCGGCCGCGGCGGGGCTGCCGG + Intronic
1138434511 16:56989626-56989648 CGGGCGTGCCGCGGGGCTGCGGG + Intronic
1139705556 16:68738156-68738178 CCCGCCCGTCCCGGGGCTGCGGG + Intronic
1139750441 16:69106449-69106471 CGCGTCCGGCGCGGGGAGGCGGG + Intronic
1141531236 16:84648463-84648485 GGCGGCGGCCGCGGGGAGGCGGG - Intergenic
1141989684 16:87602773-87602795 CGCCCTCCCCGCGGGGCTGCCGG + Intronic
1142188482 16:88706143-88706165 CGCGCCCGCCCAGGGGCCGCGGG - Intronic
1142374978 16:89702004-89702026 CGACCCGGCCGCGGGGAAGCAGG + Intergenic
1142605486 17:1078865-1078887 CGCTCCCGCCGCGGGGACAGAGG - Intronic
1143473409 17:7190318-7190340 AGCACCCGCTGCAGGGATGCAGG - Exonic
1145210688 17:21011120-21011142 CGCCCCCGCCGTGTGGGTGCAGG + Intronic
1147742506 17:42676978-42677000 CGCGCCAGTCCCGGGGCTGCAGG - Intronic
1147931508 17:43984162-43984184 GGCGCCAGCCCCGGGGATGCGGG + Intronic
1148178019 17:45584693-45584715 CGCCCCGGCCGGGGGGAGGCGGG - Intergenic
1148445301 17:47733705-47733727 CTCGCCCGCGCCGGGGAAGCCGG - Exonic
1148818265 17:50346085-50346107 CGCGCTCGCGGCCGGGTTGCAGG + Exonic
1149614616 17:57987919-57987941 CCCGCCCGCCCCGGCGAAGCGGG - Intronic
1150239847 17:63622641-63622663 CGCGCCCCCCGCGCGGAGCCAGG + Exonic
1150407907 17:64918979-64919001 CGCCCCGGCCGGGGGGAGGCGGG - Intronic
1151370737 17:73644876-73644898 CGCGCCAGCCGCGGGGCGGCGGG + Intergenic
1152321327 17:79610139-79610161 CGCGCACACCGCGGTGCTGCGGG + Intergenic
1153382471 18:4454881-4454903 CTCGCCCGCGGAGGGGCTGCGGG - Intronic
1154377926 18:13824110-13824132 CGGGCCCGGCGCGGGCAGGCAGG + Intergenic
1155199349 18:23503587-23503609 CGCGCCCGCGGCGGGGGCCCCGG - Exonic
1157766121 18:50298698-50298720 CGCGCCGGCCGCCCGGACGCGGG - Intergenic
1158931218 18:62325981-62326003 CGCGCGCGCCCCGGGGATGCTGG + Intronic
1160927887 19:1555803-1555825 GGCGGCGGCCGCGGGGCTGCTGG + Exonic
1160967884 19:1754493-1754515 CGGGAGCGCCGCGGGGCTGCTGG + Exonic
1161264780 19:3359285-3359307 CGCGCGCGCCGCGGCGAAGGTGG + Intergenic
1161266357 19:3366518-3366540 CGCGCCGGCCGCGGGGCGGGGGG + Intronic
1161963058 19:7533519-7533541 CGCCTGCGCCGCCGGGATGCTGG - Exonic
1162485997 19:10960964-10960986 CGCGCGCGCAGCGGGGGCGCGGG + Intergenic
1163645844 19:18488541-18488563 AGCCCCCGCCCCGTGGATGCTGG - Intronic
1166393778 19:42424421-42424443 CTCGCCCGCCGCGGTGGTGTGGG + Intronic
1166869758 19:45864234-45864256 CGCGCCGCCCTCGGGGAGGCGGG + Intronic
1167272072 19:48511445-48511467 CGAGGCCGCCGCGGGGGTGGGGG + Intronic
1168643348 19:58044521-58044543 CGCGGCCGCCGCGGAGAAGGAGG + Intronic
930798712 2:55420085-55420107 CGCGCCCGCCGCCAGGATCTGGG - Intergenic
932398965 2:71466596-71466618 CCCGCCCGCCGCGGGCAGGGCGG + Intronic
934670395 2:96208731-96208753 GGCGCCCGGGGCCGGGATGCAGG + Exonic
938397854 2:130963965-130963987 TGCGGCGGCCGCGGGGCTGCCGG - Intronic
938397926 2:130964259-130964281 CGCGTGCGGCGCGGGGATGGCGG - Intronic
942046146 2:172100572-172100594 CGCCCCCGCCGCCGTGATGGTGG + Exonic
949014697 2:241702499-241702521 GGCGCCCGCTGCGGGGCTCCGGG + Intronic
1169042595 20:2508471-2508493 CACCCCAGCCGCGGGGATGTTGG + Intronic
1172919962 20:38473029-38473051 GGCGCCCGCCCCGGCGATGCGGG + Exonic
1173548062 20:43914604-43914626 CGCGCCCCCCTCAGGGATGCAGG + Intergenic
1174611659 20:51802279-51802301 GGCGCCCGCGGCGGGGGAGCTGG - Exonic
1175074021 20:56358877-56358899 CGCGCGCGCGGCGGCGAAGCCGG + Intergenic
1179810415 21:43865796-43865818 CGCGCCCGCCGCCTGGTTTCGGG + Intronic
1180018221 21:45101303-45101325 AGCGCCAGGCGCGGGGCTGCGGG - Intronic
1180260886 21:46667951-46667973 CGAGCGCGCGGCGGGGACGCTGG + Intergenic
1181162074 22:20965211-20965233 AGCGCCCGCCCCGGGGACCCTGG + Intronic
1183299516 22:37051994-37052016 CTCGCCCGACGCGGGGCTGTCGG + Intronic
950683894 3:14602976-14602998 CAGGGCGGCCGCGGGGATGCGGG - Intergenic
953404629 3:42654379-42654401 CGCGCCCCCCGCCGGCACGCAGG + Intronic
953561223 3:43995283-43995305 CTCGACCGCCGCGGCGCTGCAGG - Intergenic
954202100 3:49029499-49029521 CGCCCCCGCCGCAGCGAGGCGGG - Intergenic
954215255 3:49120975-49120997 CGGGCCCGCCCCGGAGCTGCGGG - Intergenic
960120856 3:113947836-113947858 CGCGGGCACCGCGGGGAGGCGGG + Intergenic
961450286 3:126999501-126999523 CGCCCCAGCCGCCGGGAGGCAGG - Intronic
966696330 3:182793705-182793727 CGCGGGGGCCGCGGGGCTGCAGG - Exonic
967981760 3:195070038-195070060 CCCGCCCCCCGAGGGGCTGCCGG - Exonic
968534273 4:1113525-1113547 CGGGCCCTGCGCGGGGAGGCTGG - Exonic
968618580 4:1593276-1593298 CGCGCCCGCAGGAGGGAAGCCGG + Intergenic
968671778 4:1855989-1856011 CGCGGCCGCCGCGGAGAAGGAGG - Exonic
969295844 4:6270274-6270296 CCCGCCCGCGGCGGGGCTCCAGG - Intronic
978384700 4:108167954-108167976 CGCGGCGGCCGCCGGGATTCGGG - Exonic
982224484 4:153153369-153153391 CGCGCGTGCGGCGGGGCTGCGGG + Intronic
982712211 4:158768951-158768973 CGCCGCCGCCGTGGGGCTGCGGG + Intergenic
984734932 4:183099626-183099648 GGCGCCGGCCGCGGGGGCGCGGG + Intronic
986402583 5:7395420-7395442 GGTGCCCACCGCGGGGAGGCGGG + Intergenic
990699653 5:58460726-58460748 CGGGCCCGCAGCCGGGATCCCGG + Intergenic
995106564 5:108382158-108382180 CGCGCTCGTGGCGGGGACGCCGG + Intergenic
996082262 5:119268954-119268976 CTCTCCCGCCGCTGGGCTGCGGG + Intronic
996329428 5:122312301-122312323 AGCGGACGCCGCGGGGAGGCGGG + Intronic
996765456 5:127030743-127030765 CGCGCCGGCGGCGGGGAAGTTGG + Exonic
1001576158 5:172765326-172765348 CGCGCCCGCCGGGTGGATCCAGG - Intergenic
1006860841 6:37170672-37170694 CGCCTCCGGCCCGGGGATGCGGG + Intronic
1007320893 6:41028206-41028228 CGCGCCTGCTGCTGGGAGGCTGG + Exonic
1014246904 6:119078827-119078849 CGCACTGGCCGCGGGGCTGCGGG - Intronic
1016400851 6:143678233-143678255 CGCTCCCGCCGCGCGGGCGCAGG + Intronic
1018023816 6:159789118-159789140 CGCGCCCTCCGCGGGAAAGCGGG - Intronic
1018836504 6:167488245-167488267 CGCACCTGCCGGGGGGATGTGGG - Intergenic
1018864655 6:167737266-167737288 CGGGCCCACCGTGGGGTTGCAGG + Intergenic
1019361113 7:604571-604593 CGTGCCCCCCACGGGGAGGCGGG + Intronic
1019421802 7:954275-954297 CGCGGACGCCGCGGGGGTGGCGG - Intronic
1022427950 7:30285542-30285564 CGCGGCCGCCGCGGCGCCGCCGG - Exonic
1022739763 7:33109558-33109580 GGGGCCCGACGCGGGGAGGCGGG - Intergenic
1026833393 7:73623401-73623423 CGCGCCCTCCTCTGGGACGCGGG + Intronic
1031213273 7:118858627-118858649 GGATCCCGCCGCGGGGACGCGGG + Intergenic
1034264130 7:149773126-149773148 CGCCCGCGCCGCGGGGACCCAGG + Exonic
1034278954 7:149838525-149838547 CGCGACCGCCCCGGGGACCCAGG - Exonic
1034446242 7:151115574-151115596 CGCGCCCGCCGCGCCGCTGTGGG + Intronic
1039936530 8:42051469-42051491 CCCGCCCGCCGCGCGCGTGCCGG - Intronic
1041244959 8:55880505-55880527 CGGGCGCGCGGCGGGGATACTGG + Intronic
1042556056 8:70034709-70034731 CGCGCGCGCCGCAGGAGTGCCGG + Intergenic
1044115339 8:88327974-88327996 GGTGCCTGCCTCGGGGATGCGGG - Intronic
1044599707 8:93991551-93991573 TGCCCCCGCCGCGGGGAGCCGGG - Intergenic
1045222507 8:100213005-100213027 CGCGGAGGCCGCGGGGGTGCAGG - Intronic
1049411419 8:142475549-142475571 CACGCCCGGCGCGGGCAGGCAGG - Exonic
1049569068 8:143359933-143359955 CGCGCAGGCCTCGGGGAAGCGGG - Intronic
1049585493 8:143430778-143430800 CGCGCCCCTCCCGGGGAGGCGGG - Intergenic
1049803512 8:144528837-144528859 CGGGCCTGCAGCGGGGATGGGGG - Exonic
1056710985 9:88991646-88991668 CGCGCCACCCGCTAGGATGCCGG + Exonic
1057259553 9:93576333-93576355 CGCTCCCGCCGCCGGGAAGGCGG - Intergenic
1057489151 9:95508376-95508398 CGCCGCCGCCGCGGGGACGGAGG + Exonic
1059234527 9:112750772-112750794 CGAGCCCGCCGCGGGTCCGCTGG - Intergenic
1061541069 9:131278014-131278036 CGCCGGCCCCGCGGGGATGCAGG + Intergenic
1061559707 9:131394428-131394450 CCCGCCGGGCGCGGGGCTGCGGG + Intronic
1061609864 9:131739513-131739535 CGCGCCCGGCCCCGGGTTGCAGG + Intronic
1062562617 9:137148420-137148442 CGCGCCTGCCTCGAGGGTGCAGG - Intronic
1190258498 X:48783069-48783091 CGCCCCCTCCACGGGGATGGGGG + Intergenic
1194890457 X:99372155-99372177 GGCGCCCACCGCGGGGAGGCGGG + Intergenic
1200229344 X:154436559-154436581 CGTGCTCGCCGGAGGGATGCGGG + Intergenic