ID: 901088373

View in Genome Browser
Species Human (GRCh38)
Location 1:6625551-6625573
Sequence CAGACTAGCGGGCCGCGGCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 93
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 86}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901088362_901088373 30 Left 901088362 1:6625498-6625520 CCTGGCGGGGCCAGGGCCGGGAC 0: 1
1: 1
2: 7
3: 67
4: 470
Right 901088373 1:6625551-6625573 CAGACTAGCGGGCCGCGGCCGGG 0: 1
1: 0
2: 0
3: 6
4: 86
901088367_901088373 14 Left 901088367 1:6625514-6625536 CCGGGACGTGCAGGGAGCGGAGC 0: 1
1: 0
2: 0
3: 14
4: 211
Right 901088373 1:6625551-6625573 CAGACTAGCGGGCCGCGGCCGGG 0: 1
1: 0
2: 0
3: 6
4: 86
901088365_901088373 20 Left 901088365 1:6625508-6625530 CCAGGGCCGGGACGTGCAGGGAG 0: 1
1: 0
2: 0
3: 29
4: 303
Right 901088373 1:6625551-6625573 CAGACTAGCGGGCCGCGGCCGGG 0: 1
1: 0
2: 0
3: 6
4: 86

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901088373 Original CRISPR CAGACTAGCGGGCCGCGGCC GGG Intronic
900238126 1:1601990-1602012 CAGTCTGGCTGGCCGCGCCCAGG - Intergenic
900307815 1:2019586-2019608 CAGACTTGGGGTCCGGGGCCCGG - Intronic
900607634 1:3530970-3530992 CAGCCTAGCAGGCAGCGCCCTGG + Intronic
901088373 1:6625551-6625573 CAGACTAGCGGGCCGCGGCCGGG + Intronic
903628187 1:24745877-24745899 CAGACCAGCGTCCCGCGCCCGGG + Intronic
910277463 1:85464713-85464735 CCGACTCGAGGGGCGCGGCCGGG - Intronic
915359433 1:155277410-155277432 TAGACTGGCGGGCGGCGGGCGGG - Intronic
920912635 1:210232904-210232926 CACACTCGCGGGTCCCGGCCCGG - Exonic
1067097956 10:43314808-43314830 CAGACTGGCGGCCGGCGGCCTGG + Intergenic
1075119084 10:119651390-119651412 CAGAGAAGTTGGCCGCGGCCCGG - Exonic
1082807625 11:57460715-57460737 CAGGGTAGAGCGCCGCGGCCCGG + Exonic
1083329666 11:61891621-61891643 CAGCCTTGGGGGCCGGGGCCTGG - Intronic
1083665413 11:64271553-64271575 CAGACCGGCGGGGGGCGGCCTGG + Intronic
1088482112 11:110304137-110304159 CAGACTGGCGGGCGGGGGGCGGG - Intergenic
1096674632 12:53219954-53219976 CAGGCTGGCGGGTTGCGGCCAGG + Intronic
1103930070 12:124445334-124445356 CAGACCACCGGGGCGGGGCCGGG - Intronic
1104960148 12:132484644-132484666 CAGACTCGGGGGCCAGGGCCTGG + Intergenic
1108200401 13:48037762-48037784 CAGCCGCGCGGGCGGCGGCCAGG + Exonic
1124319425 15:28702277-28702299 CAGAGTTGTGGGCAGCGGCCAGG + Exonic
1124483091 15:30093154-30093176 CAGAGTTGTGGGCAGCGGCCAGG - Exonic
1124520492 15:30404064-30404086 CAGAGTTGTGGGCAGCGGCCAGG + Exonic
1124538165 15:30562155-30562177 CAGAGTTGTGGGCAGCGGCCAGG - Exonic
1124544631 15:30614216-30614238 CAGAGTTGTGGGCAGCGGCCAGG - Exonic
1124760488 15:32445430-32445452 CAGAGTTGTGGGCAGCGGCCAGG + Exonic
1124778148 15:32603632-32603654 CAGAGTTGTGGGCAGCGGCCAGG - Exonic
1126849846 15:52790256-52790278 CAGGCGCGCGGGCCGCGGCAGGG - Intronic
1127966041 15:63923614-63923636 CAGACAAGCAGGCTGCAGCCAGG + Intronic
1129460367 15:75697333-75697355 CAGTCTGGAGGGCCCCGGCCTGG + Intronic
1131053453 15:89362515-89362537 CAGAGAAGCGGCGCGCGGCCAGG + Intergenic
1133138489 16:3728589-3728611 CAGGCTGGCGTGCCGCGGCCCGG - Exonic
1133197079 16:4178674-4178696 CAGATTAGCAGGGCGTGGCCGGG - Intergenic
1133784253 16:8963051-8963073 CAGCCTCGCAGGCCGGGGCCGGG + Intronic
1137563974 16:49521925-49521947 CAGACAGGCGGGCCCAGGCCTGG + Intronic
1137716685 16:50602381-50602403 GAGACGAGGGGGCCGAGGCCTGG + Intronic
1138583513 16:57956523-57956545 CAGACTAGCGGGGCTGGGGCTGG + Intronic
1140400465 16:74666788-74666810 GAAACCAGCAGGCCGCGGCCGGG + Exonic
1143018737 17:3905251-3905273 CAGACCTGGGGGCCGAGGCCAGG + Exonic
1146957128 17:36942377-36942399 CCGAATGGCGGGGCGCGGCCAGG + Intronic
1149171973 17:53822892-53822914 GAGCCTAGCGCGCCGGGGCCCGG - Exonic
1149486268 17:57045497-57045519 CAGAGTAGGGGGCGGTGGCCAGG + Intergenic
1149997831 17:61414110-61414132 CAGACTAGTGGGTTGCGGGCGGG + Intergenic
1150228735 17:63538370-63538392 AAGTCCAGCGGGACGCGGCCGGG - Intronic
1150719636 17:67603277-67603299 TAGACTAGCAGGCCCCGGCTAGG + Intronic
1152853775 17:82652092-82652114 CAGACTGGAGGGACGCAGCCGGG + Intergenic
1154018031 18:10637671-10637693 TAGACTAGGGGGCCGCGGATGGG - Intergenic
1154186838 18:12191911-12191933 TAGACTAGGGGGCCGCGGATGGG + Intergenic
1155540389 18:26863408-26863430 CAGGCTCCCGGGCGGCGGCCAGG + Intronic
1160100440 18:75915961-75915983 CAGAGGAGCGGGCCTGGGCCGGG - Intergenic
1160766829 19:812555-812577 CCGACTAGCGCGGCGGGGCCGGG - Exonic
1160767095 19:813463-813485 GAGCCTGGAGGGCCGCGGCCTGG - Exonic
1160892072 19:1384236-1384258 CAGCCTCGCGGGCCGTGCCCTGG - Intronic
1163651693 19:18521663-18521685 CAGACTCGCGCGCCGGGCCCGGG - Intronic
1165762510 19:38329894-38329916 CAGACTGGAGGGACGCGGCTAGG + Intergenic
1167749688 19:51372184-51372206 GAGACAAGCGGGCCGTGGCCTGG + Exonic
927694348 2:25230232-25230254 CAGACTGGGGGGCCGCAGGCGGG - Exonic
929574403 2:43042922-43042944 CAGGCCAGAGGGCCGGGGCCGGG + Intergenic
938634628 2:133210118-133210140 CAGACTAGAGTGCAGTGGCCCGG - Intronic
938727281 2:134120118-134120140 CCGCCGAGCGGGCCGCGGCAGGG - Intronic
944070005 2:195657617-195657639 GAGCCTCGCGGGCCGCGCCCGGG + Intronic
948942016 2:241201451-241201473 GAGACCAGAGGGCCGAGGCCTGG + Intronic
1168813240 20:719946-719968 CAGACTGGCTGGCTGAGGCCGGG + Intergenic
1169758634 20:9068458-9068480 CAGAGGAGCGCGCCGCGGGCCGG + Intergenic
1175856296 20:62122602-62122624 CGGCGGAGCGGGCCGCGGCCCGG + Exonic
1176378902 21:6101973-6101995 CAGACCTGCTGGCCTCGGCCTGG + Intergenic
1177225253 21:18245150-18245172 CAGAGTCGCGGGCTGCGCCCTGG + Exonic
1179526097 21:41976821-41976843 CAGACTCCTGGGCCCCGGCCAGG + Intergenic
1179744572 21:43436264-43436286 CAGACCTGCTGGCCTCGGCCTGG - Intergenic
1181256870 22:21568226-21568248 CAGACTCCCGAGCTGCGGCCGGG - Intronic
1183370233 22:37427827-37427849 CAGCGCAGGGGGCCGCGGCCGGG - Intergenic
1183439932 22:37817450-37817472 CAGAGTAGCGGGCAGTGGCAGGG - Intergenic
1184308927 22:43628568-43628590 CAGGCTTGTGGGCCACGGCCAGG - Intronic
1184620368 22:45672074-45672096 CAGCCTGGCAGGCGGCGGCCTGG - Exonic
949552438 3:5122383-5122405 CACACGAGCGGGCCTCCGCCCGG - Exonic
952436573 3:33277627-33277649 CAGCCTCGCAGGCCGCGGCCCGG - Intronic
954713267 3:52515232-52515254 CAGACTTGCGGCCCGAGGCTTGG + Intronic
960380922 3:116960633-116960655 CAGACTAGCTGGCGGTGGCCTGG - Intronic
969405230 4:6987210-6987232 CAGACTCGCGGGGCGGGGCGGGG - Intronic
969436582 4:7192584-7192606 CGGACGAGGGGACCGCGGCCGGG - Exonic
976175688 4:82349366-82349388 CAGACTAGAGGGCAGTGGCACGG - Intergenic
979547128 4:121951431-121951453 CCGAGGCGCGGGCCGCGGCCGGG + Intronic
990414815 5:55575859-55575881 CAGACTGGAGGGCAGCGGCGTGG + Intergenic
993467647 5:88268504-88268526 GAGACTAGCGGGCCGGAGGCAGG - Intronic
997522187 5:134530048-134530070 CAGAGTAGAGGGCTGCTGCCTGG - Intronic
1001382094 5:171311739-171311761 CAGACTGGCGGGCCGCGGAAGGG + Exonic
1002541261 5:179907838-179907860 CCGTCTCGCGGGCCTCGGCCCGG - Exonic
1006404265 6:33834994-33835016 CAGACTCGGGGGCTGAGGCCTGG - Intergenic
1019496969 7:1345323-1345345 CAGCCTGGCGGGCCAGGGCCGGG + Intergenic
1020204597 7:6105078-6105100 CAGGCGAGCGGGCCGCTGCGCGG - Intronic
1022088138 7:27088404-27088426 CAGCCTAGCCGGCCGGGGGCAGG + Intergenic
1022923147 7:35036796-35036818 CAGACCTGCTGCCCGCGGCCAGG + Intronic
1030176378 7:106660006-106660028 AAGACGACCGCGCCGCGGCCCGG + Exonic
1040585287 8:48735162-48735184 CAGAGAATCGGGCCGCGGCGGGG + Exonic
1062375942 9:136261964-136261986 CAGGCTCTCGGGCAGCGGCCAGG + Intergenic