ID: 901089539

View in Genome Browser
Species Human (GRCh38)
Location 1:6632250-6632272
Sequence AGGGAGAAGCTGGCTGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 653
Summary {0: 1, 1: 0, 2: 6, 3: 97, 4: 549}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901089535_901089539 -9 Left 901089535 1:6632236-6632258 CCAGGGTGTGTGCTAGGGAGAAG 0: 1
1: 0
2: 3
3: 20
4: 282
Right 901089539 1:6632250-6632272 AGGGAGAAGCTGGCTGTGGAGGG 0: 1
1: 0
2: 6
3: 97
4: 549

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901089539 Original CRISPR AGGGAGAAGCTGGCTGTGGA GGG Intronic
900140784 1:1138816-1138838 AGGGAGAAGCTCTCTGAAGACGG + Intergenic
900625691 1:3607573-3607595 ATGGAGAAGGTGGCAGGGGAAGG + Intronic
900693533 1:3995947-3995969 TGGGGGAAGCAGGCTGTGGAGGG + Intergenic
900859434 1:5217632-5217654 AGGGAGAAGCAGACTTTGGAGGG - Intergenic
901089539 1:6632250-6632272 AGGGAGAAGCTGGCTGTGGAGGG + Intronic
901670878 1:10855944-10855966 AGTGGGAAGCTAACTGTGGAGGG + Intergenic
902255851 1:15188190-15188212 GGGGAGAGGCTGCCTGAGGAGGG - Intronic
902444255 1:16451958-16451980 GGGGAGCAGTTGGCTGTGGGGGG + Exonic
902629052 1:17694011-17694033 AGGGAGAGGCTGGGAGTGCAGGG - Intronic
902783928 1:18721072-18721094 GGAGAGAAGCTGGCTCTGGCAGG - Intronic
902969648 1:20038027-20038049 AGGGGGAAGCTGGCAGTGACAGG + Intronic
902987911 1:20166591-20166613 AGAAAGAAGGTGGCTGAGGAAGG - Intronic
903014623 1:20353943-20353965 AGGGAGAAGCTGTCACAGGACGG - Exonic
903186849 1:21633898-21633920 AGTGAGAAGAGGGCTGTGGAGGG + Intronic
903194296 1:21673345-21673367 AGGGAGTAGGTGGGTGTGGGAGG + Intergenic
903638541 1:24838676-24838698 AGGGGGAAGGTGGCTTTGGAAGG + Intronic
903747370 1:25596867-25596889 AGGGAGACTCTGGCTGCTGAGGG + Intergenic
903885346 1:26537685-26537707 CAGGAGATGCTGGCTATGGAGGG + Intronic
903905536 1:26683353-26683375 AGGAAGAAGCAGGCTGGGCATGG - Intergenic
904424127 1:30412771-30412793 AGGCAGAAGCTGGCAGGGGCTGG + Intergenic
904600964 1:31672467-31672489 AGGGAGATCCTGGCTGTGTTGGG - Exonic
904609460 1:31717113-31717135 AGGCAGAAGCTAGCTGCAGAGGG + Intergenic
904612257 1:31732225-31732247 TGGGCAAAGCTGGCTGGGGAGGG - Intronic
905365608 1:37449666-37449688 AGTGGGAAGCTGGGAGTGGAAGG + Intergenic
906383496 1:45347664-45347686 AGTGAGAAGCTGGCCGTGGTGGG - Exonic
906417001 1:45627954-45627976 AGGTAGGAGCTGGCAGTGCAGGG - Exonic
906557446 1:46724790-46724812 AGGCTGCAGCTGGCTATGGAGGG + Intergenic
906684501 1:47754939-47754961 AATGAGCAGCTAGCTGTGGAAGG + Intergenic
907278245 1:53328523-53328545 AGGGAGAAGCTGGGGGCGCAGGG + Intergenic
907288086 1:53395020-53395042 AGGGAGAAGCGGGCAGGGGCTGG - Intergenic
907439887 1:54472632-54472654 CAGCAGAAGCTGGCTGTGGCTGG + Intergenic
907517813 1:55004382-55004404 AGTGAGAATCTGGCAGAGGAGGG + Intronic
907827518 1:58033059-58033081 AGGGTGAAGGTGGTTCTGGAGGG - Intronic
908255068 1:62296344-62296366 AGAGAGAGGCTGGCAGTGGAGGG - Intronic
908366513 1:63429395-63429417 AGGCAGAAACTGGCTGTCCAAGG - Intronic
911235271 1:95405165-95405187 AAGGGGAAGCTGGCACTGGATGG - Intergenic
911502723 1:98708640-98708662 TGGGAGGAGCTGGCTGCTGAGGG - Intronic
911701345 1:100956401-100956423 AGGGAGTAGCAGACTTTGGAAGG + Intronic
912802644 1:112730137-112730159 AGGCAGAGGCTGGCAGTGGTTGG - Intergenic
913075290 1:115336848-115336870 AGAGTGCAGCTGGCTGTGCATGG + Intronic
914919207 1:151836338-151836360 AGGCAGCAGCTGGCAGTGGGGGG + Intergenic
914991748 1:152504917-152504939 AGGGAGAGGCTGGCTGCAAAGGG - Intergenic
915065777 1:153222861-153222883 ATGGAGAATGTGGCTATGGAGGG - Intergenic
915605581 1:156948113-156948135 GAGGAGCAGCTGGGTGTGGATGG + Intronic
918290127 1:183099401-183099423 AGGGACAAGATGGCAGTGGTTGG - Intronic
918925689 1:190782611-190782633 GGGGAGAAGATGGATGAGGAAGG - Intergenic
919738451 1:200968258-200968280 AGGGTGAAGCTTCCTGGGGAAGG - Intergenic
920266311 1:204726048-204726070 TGGGAGAAGAGGGCTGTGGAGGG + Intergenic
921110762 1:212034789-212034811 AGGGAGCAGCTTGGTGTAGAGGG - Intronic
921115688 1:212088794-212088816 AGAAAGAAGCTGGCTGGGCACGG + Intronic
921532903 1:216307344-216307366 AGGGGAAAGCTGGCAGTGAAAGG + Intronic
922702916 1:227772129-227772151 ATGGAGGCCCTGGCTGTGGAAGG + Intronic
922902619 1:229148404-229148426 AGGGAGCAGCTGGAGGTGGGAGG - Intergenic
923093189 1:230754872-230754894 ATGGAGAAGCTGGGTGGGTAGGG + Intronic
923211927 1:231811263-231811285 AGGGAGAAGGGGGTTGGGGAGGG + Intronic
923519256 1:234723259-234723281 AAGGCCATGCTGGCTGTGGACGG - Intergenic
923971662 1:239209608-239209630 AGTGAGAAAATGGCTGTTGAAGG - Intergenic
924090215 1:240493491-240493513 AGAGAGGGGCTGGCTGTGAAGGG + Intronic
924453813 1:244201931-244201953 AGCGACAAGTGGGCTGTGGACGG - Intergenic
924711709 1:246534944-246534966 AGGAAGGAGCTGCCTGTTGAGGG - Intergenic
1062941707 10:1426803-1426825 AGGGAGAAGCAGGGTATAGAAGG - Intronic
1063602405 10:7494159-7494181 GGAGAGAAGCTGGCTCAGGAAGG + Intergenic
1064227420 10:13499794-13499816 AGGGTGGGGCTGGCTTTGGAAGG + Exonic
1065359090 10:24872267-24872289 AGGGAGAGGCTGGGTGTGCAGGG + Intronic
1066228898 10:33412640-33412662 AGGGAGAAACTGGCTGATGGAGG + Intergenic
1066229392 10:33417597-33417619 ATGCCGAGGCTGGCTGTGGACGG - Intergenic
1067448266 10:46366437-46366459 AGGGAGAATCTGGCTTTGACAGG - Intergenic
1067589111 10:47494329-47494351 AGGGAGAATCTGGCTTTGACAGG + Intergenic
1067636236 10:48002420-48002442 AGGGAGAATCTGGCTTTGACAGG + Intergenic
1067877251 10:50017903-50017925 AGGGAGAATCTGGCTTTGATAGG - Intergenic
1067983357 10:51113428-51113450 AGGGAGAAGATGGCTCTGGTTGG - Intronic
1069663075 10:70136735-70136757 AGAGAGAAGATGGCTGAGGCAGG - Intergenic
1070132796 10:73666425-73666447 AGGGAGAATCTGGCTTTGACAGG + Intergenic
1070629195 10:78072430-78072452 AAGGAGAAGCTGGCAGTGTTGGG + Intergenic
1071515726 10:86295475-86295497 AGAGAGAAGGTGGCAGTGGATGG - Intronic
1071608882 10:87017649-87017671 AGGGAGAATCTGGCTTTGACAGG - Intergenic
1071672756 10:87624878-87624900 AGGCAGAAACTGGCAGTAGATGG + Intergenic
1072145651 10:92634271-92634293 AAGGAGAGGCTGGCTGGGCACGG - Intronic
1074907611 10:117878885-117878907 AGGGAGGAGCTGACAGAGGAAGG - Intergenic
1075265430 10:120996812-120996834 AGGCAGACGCTGGGTGTGCAAGG - Intergenic
1075345591 10:121679740-121679762 AGGGAGAGGCAGACTGAGGAGGG - Intergenic
1075734528 10:124655696-124655718 TGGGAGGAGCTGGCTGTGGCTGG - Intronic
1076223210 10:128751485-128751507 AGGGCGAGGCTGTCAGTGGAGGG + Intergenic
1076569049 10:131420377-131420399 AGGAAGAAGCTGGCTGGCGGGGG + Intergenic
1076842929 10:133055454-133055476 AGGGAGACCCTGGCCGTGCACGG - Intergenic
1077119591 11:900699-900721 AAGGAGGTGCTGGCTTTGGAGGG + Intronic
1077203215 11:1324502-1324524 AAGGAGAAGGAGGCAGTGGAAGG + Intergenic
1077606214 11:3614637-3614659 AGGGAGAAGCTGGGTGAGGTGGG - Intergenic
1078069313 11:8097873-8097895 AGGGGCAAGCTGTCTGTAGAGGG + Intronic
1078153461 11:8778408-8778430 AGGGGGAGGGTGGATGTGGACGG - Intronic
1078687878 11:13549811-13549833 AGGGAATAGCTGGCAGTGGAAGG + Intergenic
1079102025 11:17547743-17547765 AGGGAGATCCTGGCTGGAGAAGG + Intronic
1080317903 11:30970813-30970835 ATGCAGATGCTGGCTGTGGTAGG - Intronic
1081693777 11:45095297-45095319 AAGGAGGAGGTGGGTGTGGAGGG - Intergenic
1081760354 11:45572554-45572576 GGGGTGATGATGGCTGTGGAGGG - Intergenic
1082003449 11:47407333-47407355 AGGGAGAAGTTGGCGGTCTAAGG + Intronic
1082125154 11:48423784-48423806 AGGAATGAGCTGGATGTGGAAGG - Intergenic
1082250881 11:49978858-49978880 AGGAATGAGCTGGATGTGGAAGG + Intergenic
1082558821 11:54595052-54595074 AGGAATGAGCTGGATGTGGAAGG - Intergenic
1083386999 11:62318469-62318491 AGAGAGAAGGTTGCTGTGGGTGG - Intergenic
1083737043 11:64687358-64687380 AGAGAGAAGCAGGCTGTGTGTGG - Intronic
1083821919 11:65176895-65176917 AGCCAGAAGCTGGCTGGGCACGG - Intergenic
1083902870 11:65652186-65652208 AAGGAGAGGCAGGCTGGGGATGG + Intergenic
1083969726 11:66067500-66067522 GTGGTGAAACTGGCTGTGGATGG + Exonic
1084160933 11:67349721-67349743 AAGGAGAAGCTTCCTGAGGAAGG - Intronic
1084489955 11:69472819-69472841 AAGGAGCAGCAGGCTGTGAAAGG + Intergenic
1084751675 11:71208260-71208282 AGGGAGAAGCTGTCCTGGGAAGG + Intronic
1084876733 11:72138906-72138928 ATGGAGGAGATGGCTGTGGTGGG + Intronic
1084881177 11:72172678-72172700 AGGGTGAAGTCAGCTGTGGAAGG + Intergenic
1084941306 11:72614824-72614846 GGGGAGAGGCTGGGGGTGGAAGG + Intronic
1085646291 11:78225194-78225216 AGGAAGAAGCTGACAGAGGAAGG + Exonic
1086920946 11:92585958-92585980 AGGGAGAAGGTGGCTGGGTAGGG + Intronic
1087416231 11:97859379-97859401 AGGAAGAAGCAGGCCATGGAAGG + Intergenic
1087424004 11:97967064-97967086 TGGGAGAAGCTGTCTGTTGAGGG + Intergenic
1088668204 11:112115801-112115823 AGGGAGAAAGGGGCTGGGGATGG + Intronic
1088993218 11:114972659-114972681 AGGGAGCAGCTTGCTGAGAAGGG - Intergenic
1089086716 11:115825682-115825704 AAGGAAAAGCTGGCTGGGCATGG - Intergenic
1089170243 11:116506602-116506624 AGGGAGAGGGTGGGGGTGGATGG + Intergenic
1089315017 11:117585708-117585730 AGGATGTAGCTGGCTGAGGAGGG + Intronic
1089496663 11:118911495-118911517 ATGGAGAAGCTGGGGGTGGCGGG - Intronic
1089748491 11:120633719-120633741 AGGGAGAGGCTGGGAGGGGAAGG + Intronic
1090234831 11:125139604-125139626 AGGGAGATGGTAGCTGTGGTGGG - Intergenic
1090956670 11:131519206-131519228 TGGGAGAAGAGGGCAGTGGAAGG - Intronic
1091591408 12:1845070-1845092 AGGGAGAAGCAGGGTGGGGGTGG + Intronic
1091647980 12:2288242-2288264 AGAGAGAAGCTGGCTGGAGAGGG - Intronic
1091656735 12:2351590-2351612 AGGGCGTGGCTGGCAGTGGAGGG + Intronic
1092021702 12:5208205-5208227 AGGGAAGAGCTGGTGGTGGAGGG - Intergenic
1092100990 12:5883614-5883636 ATGGAGAAGCAGGGTGTGGAGGG + Intronic
1092657997 12:10707510-10707532 TTAGAGAAGCTGGCAGTGGAAGG - Intronic
1092672610 12:10881179-10881201 AAGGAGAAGGGGGCTGTAGAAGG - Intronic
1093201617 12:16193838-16193860 AGAGAGAGGCTGGCAATGGATGG + Intronic
1095491264 12:42736318-42736340 AGGGAAAAGCTGTCAGTGAATGG - Intergenic
1095910780 12:47424499-47424521 ATGCAGATGCTGGCTGTGGTAGG - Intergenic
1095957993 12:47817579-47817601 AGGGAGAGCCAAGCTGTGGAGGG + Intronic
1095984279 12:47989128-47989150 AGGGAGCAGGTGGTTGTTGAGGG + Intronic
1097189479 12:57212623-57212645 AGGGAAGGGCTGGCTGGGGAGGG - Exonic
1097809833 12:64006458-64006480 CTGGAGAGGCAGGCTGTGGAGGG + Intronic
1098038367 12:66329537-66329559 AGGGCCAAGCTGGCTCTTGAAGG + Intronic
1098450208 12:70610406-70610428 GGGGAGACGCTGGGTGTGGAGGG - Intronic
1099717365 12:86312516-86312538 AGAGCGAAGCTGGCTAAGGAAGG - Intronic
1099925001 12:89006547-89006569 AGTGAGAAGATGGCTCTGGTGGG - Intergenic
1100467771 12:94862657-94862679 AGGGACTAGCTGGATGTGTACGG + Intergenic
1101251305 12:102938874-102938896 AGTGAGAAGGTGGCTGTGGTGGG - Intronic
1101551469 12:105766462-105766484 AGGGAGAAGCTTCCTGTGGGAGG - Intergenic
1101641815 12:106591157-106591179 AGGGAGAGGGTGGCAGTGGGAGG + Intronic
1101789279 12:107912770-107912792 AGGGGGCAGCTGCCGGTGGAGGG + Intergenic
1102265325 12:111479260-111479282 AGGAATAAGCTGGCTGGGCACGG + Intronic
1102730639 12:115105929-115105951 AAGGTGAAGAGGGCTGTGGATGG - Intergenic
1102963854 12:117111645-117111667 AGGGAGGAGATGGCTGGGGCTGG - Intergenic
1103316739 12:120062367-120062389 TGTGAGAACCTGGTTGTGGAAGG + Intronic
1103590578 12:121989563-121989585 AGGGAGTAGTGGGCTGAGGAGGG - Intronic
1104038416 12:125114327-125114349 TGGGAGAAGCAGACTTTGGAGGG - Intronic
1104246930 12:127052336-127052358 ATTGGGAAGCTGGCTCTGGATGG + Intergenic
1105014364 12:132777155-132777177 TGGGAAATGCTGCCTGTGGAAGG + Intronic
1105542885 13:21329909-21329931 AGGGAGAGTCTGGCTGGTGAGGG + Intergenic
1106174803 13:27321034-27321056 TGGGAGAGGGCGGCTGTGGATGG + Intergenic
1107713799 13:43178543-43178565 AGGGTAAATCTGGCTGTAGATGG + Intergenic
1107725297 13:43293026-43293048 ATGGTGAAGGTGGCTGTGGTGGG - Intronic
1107866837 13:44711201-44711223 AGGTGGGAGCTGGCTGTGGTTGG + Intergenic
1109115073 13:58371715-58371737 AGTGAGAAGCTGGAGGTGGCTGG + Intergenic
1110559760 13:76898327-76898349 AGGCAGAAGTTTGCTATGGAGGG - Intergenic
1110614664 13:77528220-77528242 AGGGGGAAGCTAGCTGTGATTGG + Intergenic
1112156719 13:96825155-96825177 AGGGTTAAGCTGGTGGTGGAAGG + Intronic
1113142908 13:107174754-107174776 AGGGAGAAGCAGGATGTGGCTGG + Intronic
1113858042 13:113460194-113460216 AGGGCGGAGCTGTCTGTGGAAGG - Intronic
1114184649 14:20391249-20391271 CAGGAGGAGCTGACTGTGGAGGG + Intronic
1114671647 14:24414917-24414939 AGGGAGAAGCTGCCCCTGGCAGG - Exonic
1115973292 14:38969683-38969705 CGGCAGATGCTGCCTGTGGAGGG - Intergenic
1116790826 14:49338210-49338232 AGGGAGAAGCTGTTCATGGAAGG - Intergenic
1117237771 14:53796881-53796903 GAGGAGGAGCTGGCTGTGAAAGG - Intergenic
1118594182 14:67423359-67423381 ATGAAGAAGCTGGCTGTGGAGGG - Intergenic
1118896377 14:69949205-69949227 TGGGAGAACATGGCTGAGGACGG + Intronic
1119220285 14:72900960-72900982 AGGGAGAAGGGGGCTGGGGCTGG - Intergenic
1119961094 14:78857750-78857772 AGGGAAAATCTGGGTGTGTATGG + Intronic
1120022801 14:79549653-79549675 ATGGTGAATGTGGCTGTGGATGG - Intronic
1120930739 14:89845761-89845783 AGGGAGAAGCAGGCTGAAGATGG + Intronic
1121010557 14:90517750-90517772 AGGGAGTGGCTGGGTGTGAAGGG - Intergenic
1121307828 14:92917986-92918008 TGGGAGAAGATGGGTGGGGAGGG - Intergenic
1121742431 14:96263720-96263742 AGGGAAGAGCTGGCTCTGGTTGG - Exonic
1121885402 14:97538463-97538485 TGGCAGAGGCGGGCTGTGGAGGG - Intergenic
1122688731 14:103521817-103521839 ATCGAGAAGCTCGCGGTGGAAGG - Exonic
1122858698 14:104572434-104572456 AGGGACAGGCTGGCTGGGGGAGG - Intronic
1202854484 14_GL000225v1_random:42354-42376 AGGGAGAAACTGGCCTGGGAAGG - Intergenic
1202862462 14_GL000225v1_random:90944-90966 AGGGAGAAGCCGGCCTGGGAGGG + Intergenic
1123415044 15:20089173-20089195 AGGGAGAAGTGGGGTTTGGATGG + Intergenic
1123524386 15:21096287-21096309 AGGGAGAAGTGGGGTTTGGATGG + Intergenic
1124368821 15:29091788-29091810 AGGGATCAGCTGGCTGAGGGAGG + Intronic
1124999534 15:34755384-34755406 ATGGAGATGCTGGCTGAGGGAGG + Intergenic
1126326255 15:47480647-47480669 TGGCAGAAGCAGGGTGTGGAGGG - Intronic
1127285212 15:57526817-57526839 AGGGACCTGCTGGGTGTGGAAGG + Intronic
1128334686 15:66778414-66778436 AGGGAGAGTCTAGCTGGGGAAGG - Intronic
1128592677 15:68915438-68915460 AAGCAGAAGCTGTCTGTGAATGG + Intronic
1128709147 15:69858749-69858771 AGTGAAAAGCTGGCTGTGTTGGG - Intergenic
1128889432 15:71317692-71317714 AGGAAGAGGCTGCCTGTGTAGGG + Intronic
1129323445 15:74787289-74787311 AGGGAGAGGCTGGCTTTGGGTGG + Intronic
1129562740 15:76589244-76589266 AGGGAGGATCTGGCGGTGGGTGG + Intronic
1129888435 15:79055052-79055074 AGGGAGGAGAAGGCTGTGGTGGG + Intronic
1129953774 15:79614824-79614846 AGAGAGAAGGCGGCTGAGGATGG + Intergenic
1130821775 15:87503381-87503403 AGGAACAAGGTGGATGTGGAGGG + Intergenic
1131640061 15:94283058-94283080 AGGCAGAAGAAGGCTGTGGGTGG + Intronic
1131852367 15:96556730-96556752 AGGCAGAGGCTGCCTGTGGGTGG - Intergenic
1132311552 15:100861439-100861461 GAGCAGAAGCTGTCTGTGGAGGG - Intergenic
1132765207 16:1531029-1531051 AGCAGGAGGCTGGCTGTGGAAGG - Intronic
1132934390 16:2473559-2473581 AAGGGGAAGCTGGCGGAGGAGGG - Intronic
1132986991 16:2772391-2772413 AGGGTGATGCTGGCTGCAGATGG - Intronic
1132994730 16:2817155-2817177 AGGGTGAAGCTGGGAGTAGAGGG + Intergenic
1133162380 16:3920584-3920606 ATGGAGAAGCAGGCAGAGGACGG - Intergenic
1133255777 16:4514763-4514785 AGGGAGAAGCCGGATGTGGAAGG - Exonic
1135363785 16:21835939-21835961 AGGGTGGAGCTGAGTGTGGAAGG + Intronic
1135552620 16:23409704-23409726 AGGGAAAAACTGTCTGAGGAAGG + Intronic
1136096467 16:27960621-27960643 ATGGAGAAGCTGAGTGTGGTGGG + Intronic
1136297284 16:29310913-29310935 TGGGAGAGGCTGCCTGTGGAGGG + Intergenic
1137257114 16:46785124-46785146 AGGGAGAAGCTGGGAGTTGGGGG - Intronic
1137450318 16:48567819-48567841 AGGAATTAGCTGGCTCTGGAAGG - Intronic
1137728161 16:50670732-50670754 CAGGAGGAGCTGGCTGTGGCAGG + Intronic
1137968848 16:52963599-52963621 AGGGAACAGCTGGCTTTGGGAGG - Intergenic
1138691908 16:58776401-58776423 GGGGAGAAGGTGGCTGTTGCTGG - Intergenic
1139604070 16:68005447-68005469 AGGCAGCAGCTGGAAGTGGAGGG - Intronic
1139911490 16:70400075-70400097 GGGGAGAACCTGGCTGTGTCAGG + Exonic
1139913149 16:70410977-70410999 AGGGACAGGCTTGCTGTGGTTGG - Intronic
1140663400 16:77208921-77208943 GGGGAGAAGCTGGATCAGGATGG + Intronic
1141457909 16:84156454-84156476 TGTGAGGAGCTGGCAGTGGAAGG - Intronic
1141617032 16:85215783-85215805 TGGGTTAAGCTGGCTTTGGAGGG + Intergenic
1142011638 16:87718362-87718384 AGGGAGAGGGAGACTGTGGAGGG - Intronic
1142058845 16:88017015-88017037 TGGGAGAGGCTGCTTGTGGAGGG + Intronic
1142128325 16:88421049-88421071 GGGGAGAACCTGGCTCTCGAGGG + Intergenic
1142200690 16:88759877-88759899 AGGGGGAAGCTGTGTGGGGAGGG + Intronic
1142672452 17:1493382-1493404 AGGGAGAGGCTGGCATAGGAAGG + Intergenic
1142808779 17:2385670-2385692 CGGGAGAAGCAGGGTGTTGAGGG + Exonic
1142978009 17:3656641-3656663 TGGGAGAAGCTGGGTGGTGAGGG - Intronic
1143165035 17:4893385-4893407 AGGGAGAAGCTGGGCCTGGGTGG - Intronic
1143786393 17:9258926-9258948 CAGGACAAGCTGGCTGTGTACGG - Intronic
1144630441 17:16869424-16869446 AGGTGGGAGCTGGCTGTGCACGG - Intergenic
1144686879 17:17231968-17231990 AGGGAGACCCTGGGTGTGGCTGG + Intronic
1145798411 17:27668782-27668804 AGGGAGAGGCTGGCTGCATAGGG - Intergenic
1146260031 17:31415060-31415082 TGGGAGAGGCTGTCTCTGGAGGG - Intronic
1146265507 17:31450215-31450237 AGGGAGAGGTTGGCTGTGCCAGG - Intronic
1146315356 17:31802678-31802700 AGGGAGAAACAGGCTGTGGCTGG - Intergenic
1146643712 17:34562388-34562410 AAGGAGAAGATTGCTCTGGAGGG + Intergenic
1146717387 17:35098053-35098075 AGGATGAAGCTGGCTGTGAGGGG + Intronic
1147363470 17:39945485-39945507 AGGAAGAAGCTGGTGGTGGACGG - Intergenic
1147363901 17:39947895-39947917 AGGAAGAAGCTGGTGGCGGAAGG - Intergenic
1147400287 17:40176932-40176954 AGGGAGCAGCAGGTTGTGGCAGG - Intergenic
1147836748 17:43338306-43338328 ATGGATAACCAGGCTGTGGAGGG + Intergenic
1147983293 17:44288521-44288543 AGGGAGAAGATAGCTCAGGAGGG - Intergenic
1147985335 17:44303772-44303794 AGAGAGAAACGGGCTGGGGACGG - Intergenic
1148153908 17:45411929-45411951 AGGGAGGAGCTGGGTGGAGAGGG + Intronic
1148198644 17:45733130-45733152 TGGGAGAGCCTGGCTGTGGGGGG + Intergenic
1148566656 17:48636897-48636919 AAGGAGATTCGGGCTGTGGAAGG - Intergenic
1148905870 17:50911798-50911820 AGGCAGAAGCTCGGTGGGGAGGG + Intergenic
1149518884 17:57303264-57303286 GGAGAGAAGCTGCCTATGGAAGG + Intronic
1149639031 17:58191398-58191420 TGGGAGGAGGAGGCTGTGGAAGG + Intergenic
1149680686 17:58505036-58505058 TGGGTGGGGCTGGCTGTGGATGG - Intronic
1150145338 17:62764420-62764442 AGGGCACAGCTTGCTGTGGATGG + Intronic
1150808943 17:68341387-68341409 AGGGAGAAACAGTATGTGGAGGG - Intronic
1151347310 17:73510024-73510046 AGGTGGTAGCTGGCTGTGGCTGG + Intronic
1151548453 17:74807534-74807556 AAGGAGGGGCTGGCTGTGCATGG - Intronic
1152123038 17:78430361-78430383 AGGAAGAAGCTGACTGTGAGCGG - Intronic
1152719340 17:81915218-81915240 AGGCTGAGGCTGGCTGCGGATGG + Intronic
1152879863 17:82808627-82808649 AGAGAGAACCCTGCTGTGGAGGG + Intronic
1153618441 18:6954589-6954611 CGGAAGAGGCTGGCTGAGGAGGG + Intronic
1153914499 18:9733737-9733759 ACGGAGAGGCTGGCTGCAGAAGG - Intronic
1154496474 18:14964954-14964976 AGAGAGAAGCTTGCCATGGAGGG - Intergenic
1155513490 18:26600476-26600498 AGAGTGAAGCTGGCTGGGGGGGG + Intronic
1156539952 18:37899762-37899784 AGGAATGAGCTGGCTTTGGAAGG + Intergenic
1157212323 18:45754232-45754254 AGTGAGAAGATTGCTGTGGCTGG + Intergenic
1157442045 18:47718940-47718962 AGGGAGGAGATGGCTGAGGCTGG - Intergenic
1157616404 18:48990180-48990202 AGGGAGGAGGTGGCTGGCGAGGG + Intergenic
1157884271 18:51351327-51351349 ATGAAGAAGCTGGCTGGGCATGG - Intergenic
1158009008 18:52706993-52707015 AGGTAGAAGCTGGGGTTGGAGGG + Intronic
1158186747 18:54780049-54780071 AGGGAGAAGCTGTCAGGAGAGGG - Intronic
1160011389 18:75109284-75109306 TGGGAGGAGCTGGCTGGGGTCGG - Intergenic
1160034342 18:75286917-75286939 AAGGAGAAGCCGCCTGTGGCTGG + Exonic
1160221571 18:76981733-76981755 AGGGAGAGGCTGGCCCTCGAGGG - Intronic
1160409598 18:78666894-78666916 AGGGACAGTGTGGCTGTGGATGG - Intergenic
1160486805 18:79300486-79300508 AGGGAGGTGCAGGCTGTTGAGGG + Intronic
1160520987 18:79507838-79507860 TCGGAGGAGCTGGCTGTGGAGGG + Intronic
1160533878 18:79580964-79580986 AGGGAGAAGCTGTCTGCTGGTGG - Intergenic
1160741143 19:686584-686606 AGGGAGACACTGGCCCTGGAGGG - Intronic
1161204593 19:3034415-3034437 AAGGTGAAGCTGGCTGGGGCAGG - Intronic
1161296729 19:3523918-3523940 GGGGAGAAGGCGGCTGTGGTGGG - Intronic
1161473843 19:4473819-4473841 ATGTAGAAGCTGGTTTTGGAGGG + Intronic
1161821631 19:6533761-6533783 AGGGAGAAGGTGTCTCTGGAGGG - Intronic
1161957941 19:7506664-7506686 AGGGAGGAGCTGGAGGAGGACGG - Intronic
1162139539 19:8577498-8577520 GGAGGGAAGCTGGGTGTGGAGGG + Exonic
1162152504 19:8656153-8656175 AGGGAGAACGTGGCTATGGAGGG - Intergenic
1162462007 19:10818863-10818885 AGAGGGAAGCTGGCTGCCGAAGG - Intronic
1162916477 19:13877062-13877084 AGGGAGGAGCAGGCTGTGGGAGG - Intronic
1163191254 19:15678527-15678549 AGGGAGCAGATGGCAATGGAGGG - Intronic
1163428011 19:17249803-17249825 AGGGAGATGCTGGGTTTGGCTGG - Exonic
1163767658 19:19172310-19172332 AGAGCGAAGCTGGCTGGGGCTGG + Intronic
1164160547 19:22623284-22623306 AGGGACCAGCGGGCGGTGGAGGG + Intergenic
1164610403 19:29627868-29627890 AGAGAGAAGCTGACTCTGCATGG + Intergenic
1165177249 19:33939290-33939312 TGGGTGAAGGTGGCTGTCGAGGG - Intergenic
1165845105 19:38812985-38813007 AGGGAGTGGCTGGCAGGGGAGGG + Exonic
1166112396 19:40630635-40630657 AGCTAGGAGTTGGCTGTGGATGG + Intergenic
1166631354 19:44410457-44410479 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
1166665959 19:44680611-44680633 AGTGAGGAGCTGGGTGTGGGGGG - Intronic
1166747511 19:45148418-45148440 GGGGACAAGCTGGCTGTGCAGGG - Intronic
1166776391 19:45315464-45315486 GTGGAGAAGCTCTCTGTGGAAGG - Exonic
1166978727 19:46620569-46620591 ATGGAGAAGCTGGCAGATGAAGG - Exonic
1167698281 19:51027398-51027420 AGGGAGAAGCGGGCAGGGGAAGG - Intronic
1168289474 19:55350512-55350534 AGACAGGAGCTGGCTGGGGAGGG + Exonic
1202648894 1_KI270706v1_random:163157-163179 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1202649372 1_KI270706v1_random:166431-166453 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
925847384 2:8046029-8046051 ACGAGGAAGCTGGCAGTGGAAGG - Intergenic
926905053 2:17797941-17797963 AGGGTGAAGCTGTCTGGGCATGG + Intronic
927152006 2:20201650-20201672 ACGGAGAACCTGGCCTTGGATGG + Exonic
927393281 2:22620511-22620533 AGGGAGAAACTAGATGAGGATGG + Intergenic
927697502 2:25247971-25247993 CGGGAGGAGCTGGCAGTGGAAGG + Intronic
927702546 2:25277266-25277288 AGTGGGGAGCTGGCTGTGGTGGG - Intronic
927843978 2:26461987-26462009 AGAGGGAAGGTGGCTGTGGGTGG - Intronic
927886703 2:26723272-26723294 AGGGAGATGCGGGGTGGGGATGG - Intronic
928379947 2:30809223-30809245 AGGGAGAGGAGGGCTGTGGTGGG - Intronic
929127402 2:38534351-38534373 GGGGGGAGGCTGGCTGTGCAGGG + Intergenic
929473520 2:42221226-42221248 AAGGACAAGCTGACTGTTGAGGG + Intronic
929669055 2:43854767-43854789 AGGGAGATCCTGGCTGTGGCTGG + Intronic
929843369 2:45495453-45495475 AGTGAGATGCTTACTGTGGAAGG - Intronic
929915353 2:46131194-46131216 AGGAAGCAGTTGGCTGGGGATGG + Intronic
930016509 2:46974527-46974549 ATGGATAAGCTTGCTGTGTAGGG + Intronic
931721896 2:65072697-65072719 AGGGGGAAGCTGGCTTTGGCTGG - Exonic
932487501 2:72093507-72093529 AAGGAGAAGCTTGCTGGGGAAGG - Intergenic
933368655 2:81387944-81387966 AGGAAGGAGCTGCCTGTTGAGGG - Intergenic
934116856 2:88807087-88807109 AGGGAGGACCAGGCTTTGGAGGG + Intergenic
934523343 2:95033433-95033455 AGGGAGAAGCCGGCTGGGAGTGG + Intronic
934746619 2:96763661-96763683 AGGGAGGAGCTGGCTTTGCCAGG + Intronic
935081300 2:99798108-99798130 AGGAAAAAGGTGGCTGGGGAAGG + Intronic
936022464 2:109005366-109005388 AGGGAGATCCAGGCTGTGGAAGG - Intergenic
936462815 2:112724692-112724714 GGGGAGAGGCAGGCTGTGGTGGG + Intronic
936853767 2:116932973-116932995 AGGAAGAAGCTGGGAGTGAATGG + Intergenic
938021274 2:127907660-127907682 AGGGAGACCCTGTCTCTGGAGGG + Intergenic
938051339 2:128175334-128175356 AGGTAAAAGCTGGCTATAGAGGG - Intronic
938180613 2:129178976-129178998 TGGGATACCCTGGCTGTGGAAGG - Intergenic
938540798 2:132282138-132282160 AGGGAGAAGCTGGGTGAGACAGG + Intergenic
938541628 2:132288041-132288063 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
939582258 2:143964646-143964668 AAGGAGAAGATGGAAGTGGAGGG + Intronic
940463288 2:153995811-153995833 AGGGAGAAGGTGGGAGTGGTAGG - Intronic
941702138 2:168614836-168614858 AGGGAGCATCAGGCAGTGGATGG - Intronic
944546595 2:200805046-200805068 AGGGAGCAGCTTGCTGTGTGTGG - Intergenic
944834959 2:203570223-203570245 AGTGAGAAGATGGCTGTGGCTGG - Intergenic
946026968 2:216677728-216677750 AAGGAGAGCCTGGCTGTGAAGGG + Intronic
946371130 2:219281954-219281976 GGGCAGAAGCTGGCAGTGGTGGG + Exonic
946829284 2:223711668-223711690 AGGTAGTACCTGGCTCTGGAAGG - Intergenic
946873950 2:224110053-224110075 GGGGAGAAGCTGCCTTTGGGAGG + Intergenic
947745995 2:232507671-232507693 GGGGAGACACTGGCTGGGGATGG - Intergenic
947955367 2:234185312-234185334 AGGGAGAGGTTGGCAGTGGAAGG + Intergenic
948162059 2:235833096-235833118 GGAGAGCAGCTGGCTCTGGAGGG + Intronic
948426931 2:237894453-237894475 AGGGCGAGGCTGGCTGTGGAAGG + Intronic
948632036 2:239308542-239308564 AAGCAGTATCTGGCTGTGGATGG - Intronic
948740139 2:240041112-240041134 AGGGAGGTCCTGACTGTGGATGG + Intergenic
948768692 2:240236412-240236434 AGAGACATGCTGGCTGAGGAGGG - Intergenic
948977837 2:241474498-241474520 AGGGAGAAGGTGGCCGGGCATGG + Intronic
1168799563 20:635462-635484 AGGGAGCAGATGGTTGTGGGGGG + Intergenic
1169213960 20:3783262-3783284 AGGGAGGGGCTGGCTCTGAAAGG + Intergenic
1170306476 20:14944231-14944253 AGGGAGAGGAGGGCTGGGGAAGG + Intronic
1171272655 20:23828625-23828647 AGGGAGCAGCTGTCTGTTCAGGG - Intergenic
1171721498 20:28568267-28568289 AGGGAAAGGCTGGCAGTGGTGGG + Intergenic
1171768390 20:29302153-29302175 AGGGATAAGCTGGGGGGGGAAGG + Intergenic
1171869706 20:30515139-30515161 AGGGAGAAGCTGGGTGAGACAGG + Intergenic
1171870493 20:30520917-30520939 AGGGAGAAGCTGGGTGAGACAGG + Intergenic
1172005413 20:31815991-31816013 AGGGAGCAGCTGGCTGGAGCAGG + Intergenic
1172674876 20:36661687-36661709 AGGCTGGAGCTGACTGTGGAAGG + Intronic
1172744228 20:37194213-37194235 AGAGAGAAGGTGGCACTGGAGGG + Intronic
1172779951 20:37430602-37430624 AGGGAAAATGTGGCTTTGGAAGG - Intergenic
1172873817 20:38152230-38152252 ATGGAGAAGCTGGCCTGGGAAGG + Intronic
1173187065 20:40848444-40848466 AGGGCTGAGCTGGCTGTGGCGGG - Intergenic
1173805942 20:45925448-45925470 AGGGAGATGAGGGCTCTGGAGGG - Intergenic
1173876904 20:46378612-46378634 AGGGAGAAGCTGGTTCTGCAAGG + Intronic
1174052089 20:47773997-47774019 AGGGGCAAGCTGGCTGAGGACGG - Intronic
1175081802 20:56426867-56426889 GGGGAGAAGCTGGCTGGGTGCGG - Intronic
1175100578 20:56576091-56576113 AGGGAGGGGCTGGCTGGGAAGGG - Intergenic
1175598314 20:60253148-60253170 AGAAAGAAGCTGGCTGGAGAAGG - Intergenic
1175780399 20:61678788-61678810 AGGGAGAAGATGGCTATGGGAGG - Intronic
1175800539 20:61798699-61798721 AGGAAGAAGCAGGCTGTCCAGGG - Intronic
1176016271 20:62934893-62934915 AGGAAGAAGCTGCCTATGAAGGG - Intronic
1176288921 21:5034020-5034042 AGAGAGAAGCTGGCGGTGCCCGG - Intronic
1176602449 21:8806115-8806137 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1176602928 21:8809384-8809406 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
1176611894 21:8991218-8991240 AGGGAGAAGCTGGCTGAGGCAGG - Intergenic
1177639004 21:23821917-23821939 AGGGAGAAGTTGGCTGAGCGCGG - Intergenic
1178189829 21:30267583-30267605 AGGGAGAAGCCGTCTATGAATGG - Intergenic
1178605473 21:34032988-34033010 AAGGAGAAGGTAGCAGTGGAGGG - Intergenic
1179166942 21:38942843-38942865 TGGGGGAAGCTGTGTGTGGAAGG - Intergenic
1179549736 21:42136359-42136381 AGGGGGAAGGTGGATGGGGAGGG - Intronic
1179557390 21:42188527-42188549 AGGGAGAAGGGGGCTGGGCAAGG + Intergenic
1179868313 21:44229584-44229606 AGAGAGAAGCTGGCGGTGCCCGG + Intronic
1180071299 21:45436954-45436976 GGGGAGCAGCTGGCTGTGGCAGG + Intronic
1180344734 22:11697668-11697690 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1180345214 22:11700941-11700963 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
1180352557 22:11816662-11816684 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1180352994 22:11819182-11819204 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
1180385698 22:12175695-12175717 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
1181115609 22:20631228-20631250 AGGGTGGAACTGGCTGGGGAAGG - Intergenic
1181728146 22:24825788-24825810 CGGAAGAAACTGGCAGTGGAGGG - Intronic
1182073092 22:27477064-27477086 AGGCAGAAGCTGGCCCAGGAGGG + Intergenic
1182102967 22:27670686-27670708 AGAAAGAAGCAGGCTGGGGAAGG - Intergenic
1182490092 22:30665928-30665950 AGGGAGGGGCTGGGTGGGGATGG + Intronic
1182545064 22:31070375-31070397 AGGGAGAAGTGGGGTTTGGATGG - Intronic
1182663766 22:31943370-31943392 AGGGATAAGCTGGATCTTGAAGG - Intronic
1182845275 22:33425639-33425661 AGGGACAAACTGCCTGTAGATGG - Intronic
1183473299 22:38021150-38021172 AGGGAGTGCCTGGCTGGGGAAGG + Intronic
1183864420 22:40692918-40692940 TGGGAAGAGCTGGATGTGGAGGG + Intergenic
1183978933 22:41528452-41528474 AAGGAGAAGGTGGGTGTGGGTGG - Exonic
1184212496 22:43044110-43044132 AGGGAGAAGATGGGGGTGGGTGG - Intronic
1184485584 22:44776851-44776873 AGGGAGAGGCTCCCAGTGGAAGG - Intronic
1184531848 22:45061385-45061407 GGGGAGCAGCTGGCTGTGGGAGG - Intergenic
1185056479 22:48581307-48581329 AGGGCCAGGCTGGCAGTGGACGG + Intronic
1185127721 22:49021167-49021189 AGAGAGCAGCGGGCTGTGGGGGG - Intergenic
949950463 3:9224808-9224830 AGGGAGGGGCTGGCTGTGCAGGG + Intronic
950160892 3:10760221-10760243 TGGGAGAGGCTGCCTGAGGAAGG - Intergenic
950177861 3:10888390-10888412 AGGAAGAATCTGACTGAGGATGG + Intronic
950548401 3:13652585-13652607 AGGGAGGAGCAGGCTGGGGGTGG + Intergenic
950636543 3:14319442-14319464 TGGGAAAAACTGGGTGTGGAGGG + Intergenic
950672402 3:14535180-14535202 GGGGCGAAGCTGGCTGGGGCTGG - Intronic
952160615 3:30689619-30689641 AGGGGGAACCAGGCTGTGGTGGG + Intronic
952181894 3:30925522-30925544 AAGGAGACGCTCACTGTGGATGG + Intergenic
953121169 3:40044057-40044079 AAGCAGAAGCTGGATGAGGAAGG + Exonic
953289875 3:41650035-41650057 CGGGACAACCTGCCTGTGGAAGG + Intronic
953886989 3:46719706-46719728 AGGGAGAAGCAGCCTCTGGGAGG + Exonic
954133593 3:48572025-48572047 AGGGTGAAGCTGGCCGTGCAGGG - Exonic
954862417 3:53702019-53702041 AGGGAGAACTGGGTTGTGGAGGG + Intronic
955114318 3:55982074-55982096 AAGGAGAGGCTGGCTGGAGAGGG + Intronic
955876533 3:63495786-63495808 AGGGAGATGTGGGGTGTGGAAGG + Intronic
956106425 3:65823531-65823553 CAGGAGAAGCAGGCTGTGGAAGG - Intronic
956722836 3:72133500-72133522 GGTGAGGAGCTGGCTGTGGTTGG - Intergenic
957625541 3:82649043-82649065 GGGGAGAAGCTGCCAGTTGAGGG - Intergenic
957692995 3:83596336-83596358 AGGCAGAAGTTTGCTGTGGGTGG + Intergenic
960623710 3:119660344-119660366 AGGTGGAAGCAGGATGTGGAAGG - Exonic
961435267 3:126912446-126912468 TGGCAGCAGCTGGCTGTGGTGGG + Intronic
961567251 3:127772633-127772655 AGGGAGAGGCTGGATTTGCAGGG + Intronic
961670462 3:128524566-128524588 AGGGAGAAGTGGGCTGAGCACGG + Intergenic
964443895 3:156740246-156740268 AGGCAGAAGCCGGCTTTGGTGGG + Intergenic
964504504 3:157383990-157384012 AGGTAAAAGCTGGATGTGGGGGG + Intronic
964768818 3:160203514-160203536 CGGGAGATGCTGGCTGGGCACGG + Intergenic
966715663 3:183010999-183011021 AGTGAGAAGTTGATTGTGGAGGG + Intergenic
967059505 3:185859557-185859579 AGGAAGAAGCTGGCCCAGGAAGG - Intergenic
967296586 3:187971078-187971100 AGGGAAATCCTGGCTGTGCAGGG + Intergenic
967852708 3:194094077-194094099 AGGGATGAGCTGACTGTGGGAGG - Intergenic
967977663 3:195044520-195044542 GGGGAGTAGCTGGGTGAGGAGGG - Intergenic
968615053 4:1573949-1573971 AGGGAGGAGCTGGATGAGGGAGG - Intergenic
969484468 4:7464421-7464443 AGGGAGCCGCAGCCTGTGGAGGG + Intronic
969650143 4:8461500-8461522 AGGGAAGAGCTGGCTGCTGAGGG + Intronic
969869579 4:10096228-10096250 AGCTAGAAGCCGGCTGTGGGTGG - Intronic
970596502 4:17605078-17605100 GGGAAGAGGCTGGCTGTGAAGGG - Intronic
971261964 4:25065474-25065496 AGGCAGCAGCAGGGTGTGGAGGG - Intergenic
971686496 4:29776269-29776291 AGGCAGAAGCTGACTGTGCATGG - Intergenic
971703720 4:30012903-30012925 ATGCAGAAGCTGGCTGTAGTAGG + Intergenic
972342791 4:38167038-38167060 AGGAAGAAGCTGGCAGTGACAGG + Intergenic
972401173 4:38705175-38705197 AGCGATTAGCTGGCTGTGAAGGG - Intergenic
972474939 4:39441258-39441280 AGGTAGGAACTGGCTCTGGAGGG - Intronic
973078992 4:45966070-45966092 AGAGAGAAGCTGATAGTGGATGG - Intergenic
973375099 4:49280976-49280998 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
973375998 4:49286998-49287020 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
973376923 4:49293161-49293183 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
973377843 4:49299316-49299338 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
973378787 4:49305596-49305618 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
973379431 4:49310058-49310080 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
973380304 4:49316054-49316076 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
973381227 4:49322220-49322242 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
973382312 4:49329265-49329287 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
973385851 4:49513877-49513899 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
974425637 4:61739725-61739747 AGGGAGAAGCTGGTGGTACAGGG - Intronic
976124501 4:81819108-81819130 ATGGTGAAGCTGGCTGGGCACGG + Intronic
976231209 4:82845212-82845234 AGGGAGAGGCTGCAGGTGGATGG + Intronic
976735128 4:88301449-88301471 AGGGGCAGGCTGGCTTTGGAGGG + Intergenic
977399750 4:96517681-96517703 GGGGAAAAACTGGCTTTGGAAGG + Intergenic
978134970 4:105246211-105246233 ATGGAAAAGCTGGCTGGGCATGG - Intronic
984947729 4:184983083-184983105 GGGGACCAGCTGGCTGGGGATGG - Intergenic
985534525 5:456564-456586 AGGGTGAAGCTGGGGTTGGAGGG + Intronic
985966365 5:3341631-3341653 TGGGAGCAGGAGGCTGTGGAGGG - Intergenic
986445395 5:7816496-7816518 AGGCAAAGGCCGGCTGTGGAGGG + Intronic
986648466 5:9941162-9941184 TGGGAGAGGCTGTGTGTGGAGGG - Intergenic
987610921 5:20201215-20201237 AGAGAGAAGATGGCTGTAGGAGG - Intronic
987621725 5:20344293-20344315 GGAGAGAAGCTGTCTGTTGAGGG - Intronic
987955539 5:24735175-24735197 AGGGAGAATCCGGATGTGGTAGG + Intergenic
988625260 5:32868371-32868393 AGGGATAAGCTTGCAGTGGTTGG + Intergenic
989973599 5:50555054-50555076 AGGGAGAAGAGGACTGTAGAAGG - Intergenic
990597845 5:57329308-57329330 AGCAAGAAGGTGGCTGTAGAAGG - Intergenic
991185398 5:63800796-63800818 AGGGAGTAGCTGGAGGTGCAGGG + Intergenic
992381856 5:76245322-76245344 ATGGAGAAACAGGCTGTGGAAGG + Intronic
992834795 5:80629751-80629773 GTGGAGAAGCTGGGTTTGGAAGG - Intronic
992898682 5:81270577-81270599 AGGGAGAACCAGGCAGTGGGCGG - Intergenic
994318101 5:98357761-98357783 AGGGAAAAGGTGGCTGTAAATGG + Intergenic
995724623 5:115170108-115170130 AGGGGGAAGGTGGCGGCGGAGGG - Intronic
997361410 5:133297636-133297658 AGGGAGCAGGAGGCTGTGGCTGG - Intronic
997428889 5:133823807-133823829 AGGGGCAGGCTGGCTTTGGAGGG - Intergenic
997444124 5:133928902-133928924 AGGGAGCAGCTGGCTGAGGGAGG - Intergenic
997908646 5:137845913-137845935 ATGGAGAAGCTGTCTGAGAAAGG + Intergenic
998057153 5:139087927-139087949 AGTGAGCACCTGGCTGTGGGTGG - Intronic
998136847 5:139678523-139678545 AGGGAGTATCTGACTGTTGATGG + Intronic
998372175 5:141668977-141668999 AGGGAAAAGCTGTCTTAGGATGG + Intronic
998632751 5:143918397-143918419 GGGAAGAACCTGCCTGTGGATGG - Intergenic
998912234 5:146972419-146972441 AGGGAGATGTTGGCTGGGCACGG + Intronic
999682950 5:154076766-154076788 GGGGAGAAGATGGCAGTGGGAGG - Intronic
1001310033 5:170603932-170603954 AGGGAGAAACAGGAGGTGGAGGG + Intronic
1001579935 5:172791576-172791598 ATGAAGAAGCTGGGTGTGGGTGG - Intergenic
1002521557 5:179795574-179795596 AGGGAGAAGTAGGCTGGGGGAGG - Exonic
1002542592 5:179915867-179915889 AGGGTGAATCTGGATGAGGAGGG - Intronic
1002703254 5:181142275-181142297 GCAGAGCAGCTGGCTGTGGAGGG + Intergenic
1003425767 6:5997261-5997283 TTGGAGAAGGTGGCTGTGGGAGG - Intergenic
1003534766 6:6967138-6967160 GGGGAGAAGCTGGGTGTGTAAGG - Intergenic
1003882480 6:10491117-10491139 AGGGAGATGCTGGCTGGGTGCGG - Intergenic
1004223393 6:13766031-13766053 AGGAAGAAGATGTCTGAGGAGGG + Intergenic
1007642683 6:43355236-43355258 CAGGAGAAGGTGGGTGTGGATGG + Exonic
1011746781 6:90413947-90413969 GGGGAGAGGCTGGCGGGGGATGG + Intergenic
1013809242 6:114026261-114026283 AGGGAAATGCTGGCAGGGGAGGG - Intergenic
1014000179 6:116356748-116356770 AGGGAGAAGCTAGCATTGGATGG - Intronic
1014157967 6:118134153-118134175 AAGGAGAAACTGCCTGTGCAGGG + Intronic
1015379652 6:132551728-132551750 AGGGGGAATCTGGCAGTGGGTGG + Intergenic
1015535985 6:134268198-134268220 AGGGAGTAGCTGACTGTGAGTGG + Intronic
1015960026 6:138638927-138638949 AGAGAGAAACTGCCTTTGGATGG + Intronic
1016046496 6:139486309-139486331 AGGGAGGAGCTGCCTGTCCAAGG + Intergenic
1016766788 6:147803867-147803889 ACAGTGGAGCTGGCTGTGGATGG - Intergenic
1017126594 6:151070383-151070405 AGAGAGAAGCTGGTTGGTGATGG - Intronic
1018614996 6:165678693-165678715 AGGGAGATGCTGAGTGTGGGCGG - Intronic
1018907071 6:168081705-168081727 AGGGAGAAGCTGGATGCAAAAGG + Intergenic
1019052357 6:169192848-169192870 AGGAAGAAGCAGGCACTGGAAGG - Intergenic
1020225822 7:6279196-6279218 AACGAGAAGGTGGCGGTGGAAGG - Intergenic
1020415551 7:7941905-7941927 TGGGAGAAGCTGACTATGCAGGG - Intronic
1021341915 7:19475208-19475230 AGAAAGAAGCTGGCTGTGTTGGG - Intergenic
1021481554 7:21123374-21123396 AAAGTGAAGATGGCTGTGGAAGG - Intergenic
1021601423 7:22367946-22367968 TGGGAAAAGCTGGCTGGGCACGG + Intergenic
1022499059 7:30871205-30871227 ACAGAGAAGCTGGCTCTGGGGGG - Intronic
1022819864 7:33948979-33949001 AGGGAGAAGGGGGCTGTGCCCGG - Intronic
1022819908 7:33949395-33949417 ATGCAGAGGCTGGCTCTGGAAGG - Intronic
1022835538 7:34110298-34110320 TGGGAGAAGCTGAGTGGGGAAGG - Intronic
1023769084 7:43538248-43538270 AGGGAGAAACTGGATGAGGGAGG + Intronic
1024174788 7:46827875-46827897 AGGGAGAATCTGGTGGTGGGTGG - Intergenic
1024497833 7:50068589-50068611 AAAGAGAAGCTGGCTTTGCAAGG - Intronic
1024602722 7:50998649-50998671 AGGGCAAAGAGGGCTGTGGAAGG + Intergenic
1024849648 7:53696463-53696485 AGGGAGAAGCTGGGAGAGGAGGG + Intergenic
1025176332 7:56804206-56804228 AGGCAGGAGCTGGCCCTGGAGGG - Intergenic
1025695461 7:63772216-63772238 AGGCAGGAGCTGGCCCTGGAGGG + Intergenic
1026590986 7:71695397-71695419 AGGGAGAAGCCAGCAGAGGAAGG + Intronic
1026661688 7:72308348-72308370 AGTGAGATGCTGTCTGTGGGGGG + Intronic
1028548994 7:92035793-92035815 TGGGAGAAGCAGGCTGTAGTGGG + Intronic
1029485320 7:100836548-100836570 GGGCAGCAGCTGGATGTGGAAGG - Intronic
1029571567 7:101373128-101373150 GGGGAGAGGCTGGCAGAGGAAGG + Intronic
1029969603 7:104776447-104776469 AAGGAGAAGCTGGCTGTGGGGGG - Intronic
1030354287 7:108525867-108525889 GGGGAGGAGCTGGCGCTGGAAGG - Intronic
1030955298 7:115844570-115844592 ATGGAGAAGCAGGTTTTGGAGGG + Intergenic
1030968123 7:116019015-116019037 AGGTAAAGGCTGGATGTGGAAGG + Intronic
1031820417 7:126493912-126493934 TGGGATCAGCTGGCTGTAGAAGG + Intronic
1032012596 7:128356677-128356699 AGGCAGGCGCTGGCTGGGGAGGG + Intronic
1032738498 7:134714379-134714401 AGGGAGAACCTGCCAGAGGAAGG - Intergenic
1032765033 7:134983513-134983535 AGGCAGAAGCTGTCTATAGAAGG + Intergenic
1033541387 7:142358923-142358945 AGAGAGCAGCTGGCTGTGCAGGG - Intergenic
1033544388 7:142386653-142386675 AGAGGGCAGCTGGCTGTGCAGGG - Intergenic
1033926099 7:146462404-146462426 GGGGAGAATGTGGCTGTGTAGGG - Intronic
1034282515 7:149864039-149864061 TGGGCGAAGCTGGATGTGGAAGG + Intronic
1034435292 7:151060231-151060253 AGGGAGCAGCTGGGTGGGAATGG + Intronic
1034523034 7:151635453-151635475 ATGGTGAAGCGGGCTGTGGTAGG + Intronic
1034813303 7:154151071-154151093 AGGGACAAGCTTGCTATGCACGG - Intronic
1034907026 7:154958260-154958282 ATGGAGATGCTGACTGTGGTAGG - Intronic
1035247355 7:157572510-157572532 AGGGGCAGGGTGGCTGTGGAAGG + Intronic
1035459896 7:159032144-159032166 AGGGGGCAGCTGGGTGTGGGAGG + Intronic
1035731899 8:1859624-1859646 AGGGAGAAGCTGCCGGAGGAGGG - Intronic
1035778847 8:2211274-2211296 AGGGCGCAGTTGTCTGTGGAAGG - Intergenic
1035819731 8:2578628-2578650 ACTGGGAAGCTGGCAGTGGATGG + Intergenic
1036560093 8:9894363-9894385 GGGAAGGAGCTGGCTGAGGATGG + Intergenic
1036593192 8:10187412-10187434 CGGCAGAAGCTGGTGGTGGAAGG - Intronic
1037891156 8:22624367-22624389 TGGGACAAGCTGGCTGGAGATGG + Intronic
1037923091 8:22821683-22821705 AGGGAGAAAGAGGCTGAGGAGGG + Intronic
1037940090 8:22944746-22944768 AGGCACAAGCTGGCAGTGGTAGG - Intronic
1039468839 8:37801419-37801441 AGGGAGAACCTGGGTGTGGGAGG + Intronic
1039753332 8:40497224-40497246 AGGGAGAGGGAGGCAGTGGAGGG + Intergenic
1039865334 8:41496210-41496232 TGGGAGAATCTGGCTGTGCATGG + Intronic
1040492776 8:47940447-47940469 ATGGATAAGTTGGCAGTGGAAGG - Intronic
1040510021 8:48085070-48085092 AAGGAGAAGCTGGGTGAGGCTGG + Intergenic
1041256528 8:55983739-55983761 AATGAGAAGCTGGCTGGTGAGGG - Intronic
1041523426 8:58779201-58779223 AAGGAGCAGCAGGCCGTGGAAGG + Intergenic
1042762039 8:72281592-72281614 AGGAAGGAGCTGCCTGTTGAGGG - Intergenic
1042958915 8:74281833-74281855 AGGAAGAGGCTGGCAGTGGGTGG - Intronic
1043438973 8:80260278-80260300 AGGGAAGAGCTGGCTGGAGATGG - Intergenic
1044794682 8:95885001-95885023 AGGAAGAGGATGGCAGTGGAAGG - Intergenic
1045689926 8:104749779-104749801 AGTGAGAAGCTTGGTGTGGCTGG + Intronic
1046057663 8:109097990-109098012 AGGGAGATACTGGATGTGGGAGG - Intronic
1046903060 8:119543391-119543413 TGGGAGAAGCTTGCTGTAAAGGG - Intergenic
1047021026 8:120775191-120775213 AGGGAGATGCTTGCTTTGTATGG + Intronic
1047253085 8:123195247-123195269 TGGGATAAGCTGGGAGTGGAAGG + Intronic
1047618824 8:126585809-126585831 AGGGTGGAAATGGCTGTGGAGGG + Intergenic
1047698422 8:127426800-127426822 AGGGAGGAGCTGGGGGAGGAGGG - Intergenic
1048276225 8:133068007-133068029 AGGGAGTAGCTGCCTGGGGCTGG + Intronic
1048502860 8:134994503-134994525 AAGGAGAAGATGCCTGTGGAAGG + Intergenic
1048813619 8:138310581-138310603 GGAGATAAACTGGCTGTGGAGGG - Intronic
1048879081 8:138858531-138858553 AGGGGAAAGCTGGATGTGGTGGG - Intronic
1049072721 8:140369275-140369297 AGTTAGAAGCAGGCTCTGGAAGG + Intronic
1049108813 8:140630019-140630041 TGGGAGAAGCAGGGTGTGGGAGG - Intronic
1049379297 8:142304030-142304052 AGGAAGAAGCTGGCTTGGGAAGG - Intronic
1049583162 8:143421786-143421808 AGGGAGAAGCTGGGGATGGGTGG + Intronic
1051147681 9:14045883-14045905 AGGGGGAAGCTGGATGAGAAAGG + Intergenic
1051250050 9:15150459-15150481 AGGGAGAAGGTGAGTGTGGCTGG + Intergenic
1052389793 9:27866348-27866370 TGGGAGAAGTTGTCTGGGGAAGG + Intergenic
1052884744 9:33633954-33633976 AGGGAGGTGCTGGCCGGGGAGGG - Intergenic
1054775460 9:69120858-69120880 AGGGTGAGGCTGGCGGGGGAGGG + Intergenic
1055244234 9:74220663-74220685 AGGGAAAAGCTGGCAGTGACAGG - Intergenic
1056090797 9:83203732-83203754 AGTGAGGAGCTGGCTATGGGTGG + Intergenic
1056262099 9:84859157-84859179 TGGGAGAAGCGGGGTGTGAATGG + Intronic
1056479678 9:86988462-86988484 AGGCAGAGGCTGGATGAGGAGGG - Intergenic
1056523542 9:87421901-87421923 AGGGAGCAGATTGCTGTGGAGGG - Intergenic
1056598014 9:88023629-88023651 GGGGAGAAGCTGGCTGTTGGTGG + Intergenic
1056606832 9:88092927-88092949 AGGAGGAAGCTGGCTCAGGAAGG + Intergenic
1056687467 9:88778333-88778355 TGGGAGAACCCGGCTGGGGAGGG - Intergenic
1056775932 9:89512613-89512635 AAGGAGAAGCTTGGGGTGGAGGG - Intergenic
1057055813 9:91959858-91959880 AGAGAGAAGCAGGCTGGGCACGG - Intergenic
1057130598 9:92651662-92651684 AGGGAGGAGCTGGAGGTGGAGGG - Intronic
1057414169 9:94846613-94846635 AGAAAGAAGCTGGCTGGGCATGG + Intronic
1058865809 9:109161197-109161219 AGGGAAAAGCTGGTTGTGTCTGG - Intronic
1058872829 9:109217133-109217155 AGGGAGCGGGTAGCTGTGGAGGG + Exonic
1059037192 9:110767303-110767325 TGGGAGAATCTGAGTGTGGAAGG + Intronic
1059632342 9:116137897-116137919 AGGGAACAGCTGGTTGTGGTAGG + Intergenic
1059749695 9:117236392-117236414 GGAGAGAAGCTGGCAGTAGATGG + Intronic
1060602579 9:124888047-124888069 GGGGAGAAGAGGGCTGGGGAGGG + Intronic
1060732079 9:126045057-126045079 AGGGAGATGCGGGCTGTATAAGG - Intergenic
1060975528 9:127762709-127762731 GGGCAGAAGCTGACTGTGGGTGG - Intronic
1061191869 9:129086830-129086852 AGGCAGAGGCTGCCTGTGGCTGG - Intronic
1061347854 9:130042085-130042107 GGCGAGGGGCTGGCTGTGGATGG - Intronic
1061629965 9:131866122-131866144 AGGGAACAGCAGGCTGGGGAGGG - Intronic
1062062131 9:134502381-134502403 AGGGAGAAGCTGGGGTTGGGGGG - Intergenic
1062148814 9:135007056-135007078 GGGGAGGACCTGGCTGTGGAGGG - Intergenic
1062506604 9:136880756-136880778 TGGGAGAATGTGGCTGTGGCAGG + Intronic
1062523940 9:136970727-136970749 AGGGACATGGTGGCTGTGGCTGG + Intronic
1203698817 Un_GL000214v1:119225-119247 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1203699773 Un_GL000214v1:125523-125545 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1203479507 Un_GL000224v1:113-135 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1203480473 Un_GL000224v1:6409-6431 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1203481440 Un_GL000224v1:12737-12759 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1203482404 Un_GL000224v1:19046-19068 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1203548993 Un_KI270743v1:152910-152932 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1203549457 Un_KI270743v1:155639-155661 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
1203550415 Un_KI270743v1:161951-161973 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
1203569112 Un_KI270744v1:115471-115493 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1203570061 Un_KI270744v1:121760-121782 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1186470737 X:9820324-9820346 AGCTGGAAGCTGGCTGTGGCTGG - Intronic
1189234444 X:39476740-39476762 GGGAAGAAGCCGGCTGCGGAGGG + Intergenic
1189318111 X:40069974-40069996 AGGGATGAGCTGGAAGTGGAGGG + Intronic
1190446584 X:50531559-50531581 AGGGACAAGGTGGCTGGGGCAGG - Intergenic
1192456929 X:71283798-71283820 AGGGCGAAGCTAGGTTTGGAGGG + Intronic
1194468177 X:94257866-94257888 AGGGAAAAGCTGGCAGTGACAGG - Intergenic
1195022594 X:100844901-100844923 AGGGATAAGCTCACAGTGGATGG - Intronic
1195107656 X:101616499-101616521 AGTGAGAAGCTGGAGGAGGAGGG - Exonic
1195134863 X:101894892-101894914 AGTGAGAAGGTGCCTGTGGGGGG + Intronic
1195731281 X:107970355-107970377 GGGAAGAAGCAGGGTGTGGACGG - Intergenic
1196166049 X:112536404-112536426 AGGCAGAACCTGGCTGTGCTGGG - Intergenic
1197040939 X:121934153-121934175 AGAGAGAAGGTGGAAGTGGATGG - Intergenic
1197717333 X:129718968-129718990 AGGGAGAGGATGGCTCTGGCAGG - Intergenic
1197764305 X:130049959-130049981 AGGGAGAAGCAGGCTGGGTGGGG + Intronic
1199548508 X:149032876-149032898 AGGGAGAATCTGGCTGCTGGTGG + Intergenic
1199681836 X:150230103-150230125 GCAGAGAAGATGGCTGTGGAAGG - Intergenic
1199746993 X:150778201-150778223 AGGGAGTAGCTGTCTGTGGAAGG - Intronic
1201175462 Y:11306471-11306493 AGGGAGAAACCGGCTTGGGAGGG - Intergenic
1201438758 Y:13986105-13986127 AGGGAGAAGCAGTTCGTGGAGGG - Exonic
1201445815 Y:14056603-14056625 AGGGAGAAGCAGTTCGTGGAGGG + Exonic