ID: 901089870

View in Genome Browser
Species Human (GRCh38)
Location 1:6634121-6634143
Sequence GTGTTCATCTTCAGGAGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 220
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 197}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901089870_901089876 13 Left 901089870 1:6634121-6634143 CCCTCCCTCCTGAAGATGAACAC 0: 1
1: 0
2: 1
3: 21
4: 197
Right 901089876 1:6634157-6634179 GAGCGCCAGCCTCTGCTTTCAGG 0: 1
1: 0
2: 0
3: 19
4: 214
901089870_901089878 18 Left 901089870 1:6634121-6634143 CCCTCCCTCCTGAAGATGAACAC 0: 1
1: 0
2: 1
3: 21
4: 197
Right 901089878 1:6634162-6634184 CCAGCCTCTGCTTTCAGGAAAGG 0: 1
1: 0
2: 3
3: 54
4: 361
901089870_901089880 28 Left 901089870 1:6634121-6634143 CCCTCCCTCCTGAAGATGAACAC 0: 1
1: 0
2: 1
3: 21
4: 197
Right 901089880 1:6634172-6634194 CTTTCAGGAAAGGTTTATTGTGG 0: 1
1: 0
2: 0
3: 30
4: 310

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901089870 Original CRISPR GTGTTCATCTTCAGGAGGGA GGG (reversed) Intronic
900704655 1:4072843-4072865 GTTTTCAGCTTCAGAAGTGACGG - Intergenic
901089870 1:6634121-6634143 GTGTTCATCTTCAGGAGGGAGGG - Intronic
902676017 1:18009134-18009156 GTGGGGATCCTCAGGAGGGAAGG - Intergenic
903293931 1:22331913-22331935 GTGTTTATCTTGAAAAGGGATGG - Intergenic
903957608 1:27035989-27036011 GAGTTCGTCCTCAGGAGTGAGGG - Intergenic
904012729 1:27399013-27399035 GTCTTCATTCTGAGGAGGGAGGG - Intergenic
904295433 1:29517137-29517159 ATGTTCATCTTCAACAGTGAGGG - Intergenic
904495944 1:30886748-30886770 GTGATCATTTTCATAAGGGATGG - Intronic
904830535 1:33303721-33303743 GGGATCTTCTTGAGGAGGGAGGG - Intergenic
907624410 1:56014635-56014657 GTCTTCATCTCCAGGATGCAAGG + Intergenic
911069710 1:93823021-93823043 CTGTGCATCTACAGCAGGGAGGG - Intronic
911149723 1:94586065-94586087 GTGTTCATTTGAAGGAGGGAGGG - Intergenic
912638447 1:111320704-111320726 GTGTTCATCTGCATGAAGGTTGG + Intergenic
914694617 1:150065761-150065783 GTGGTTTTCTTCAGGAAGGAAGG + Intergenic
914847197 1:151289809-151289831 GTCTTCATCTTCAGAAGAGGAGG + Exonic
918042988 1:180924418-180924440 CTGTTCATCTTCAGGAAGGCAGG + Intronic
920173237 1:204084414-204084436 TTGTTGATTTTCAGGAGGGTAGG - Intronic
920984282 1:210870874-210870896 TTGTTCATCTTAAAGAAGGATGG - Intronic
922325056 1:224520719-224520741 GGTTTCATCTTAAGGAAGGATGG + Intronic
922374282 1:224945539-224945561 GTGTTCCTCTGGAGGAGGCAAGG + Intronic
923687788 1:236165513-236165535 GTGTTCATGTTCATGGGGTAAGG + Intronic
924264173 1:242264431-242264453 TTTTTCTTCTTCAGGAGGAAGGG + Intronic
1064443290 10:15371689-15371711 GTGGACAGCTTCAGGAGGAATGG + Intergenic
1065094171 10:22264163-22264185 GTGTTCCCTTTCAGGAGGTACGG + Intergenic
1066720624 10:38334034-38334056 TTTTTCTTCTTCAGGAGGAAGGG - Intergenic
1067882338 10:50056997-50057019 ATATTAATCTTCGGGAGGGAAGG - Intergenic
1068120619 10:52779413-52779435 GTGTTGTGCTTGAGGAGGGAGGG - Intergenic
1069324965 10:67222147-67222169 GTGTTTATTTTCAGAAGGGAAGG - Intronic
1069567010 10:69470333-69470355 GTGTTCATCATCATGGGGAAAGG - Intronic
1070674656 10:78404249-78404271 GTCTGCATCTTCATGGGGGAGGG - Intergenic
1072796708 10:98361589-98361611 ATGAGCATCTTCCGGAGGGAGGG + Intergenic
1073939251 10:108675460-108675482 GTGTTCCTCTTCTTGTGGGAGGG - Intergenic
1074717964 10:116237314-116237336 GTGTTCATCATCAAGAGGTGTGG - Intronic
1075752637 10:124786060-124786082 GTGGTCACCTTTAGAAGGGAAGG + Intronic
1076101339 10:127781517-127781539 TAGTTCATCTTTAGGAGGGTGGG - Intergenic
1076185110 10:128440663-128440685 GTTTTCCTCTGCTGGAGGGAGGG + Intergenic
1076294773 10:129375849-129375871 GAGTTCAGCTCCAGCAGGGAGGG - Intergenic
1076480854 10:130784471-130784493 GGGTTCATGTTCAGCAGTGAGGG + Intergenic
1077809712 11:5624931-5624953 CAGTTCCTCCTCAGGAGGGAGGG + Intronic
1078026089 11:7696855-7696877 GTTTGCAGCTTCTGGAGGGAGGG - Intronic
1078635144 11:13042760-13042782 GTTTTCATTTTTAGGAGGGTGGG - Intergenic
1079757438 11:24282335-24282357 GTGTTCATTTGCAGGAGGAGAGG - Intergenic
1081023084 11:37971566-37971588 ATCTTCATCTTCAGTAGGTAAGG - Intergenic
1082879456 11:58024024-58024046 GTCTTCATCTTCAAACGGGAAGG - Exonic
1087274597 11:96148539-96148561 ATGTTCAGCTTCAGGCGGGTAGG - Intronic
1088305202 11:108400207-108400229 TTGTGCTTCTTCAGGATGGATGG + Intronic
1089165085 11:116469722-116469744 GTGCTCAGGTCCAGGAGGGAAGG + Intergenic
1091103568 11:132897951-132897973 ATGTTAATATTCAGGAGGGTAGG + Intronic
1092391166 12:8081172-8081194 GTTTTCTTCTTCAGAAGGAAAGG - Intergenic
1093093310 12:14944832-14944854 CTGTTCACCTGCAGGTGGGAAGG + Exonic
1097168514 12:57098951-57098973 GTGCTTATCTGCAGGAAGGAGGG - Intronic
1098994607 12:77104516-77104538 GAGTGCATCTTCTGGAAGGATGG - Intergenic
1099384662 12:81999734-81999756 GTGTTCATCAGAAGGAGGTAGGG + Intergenic
1099887649 12:88551685-88551707 GTGTTCATCATCAAGAGTGCAGG - Intronic
1100195983 12:92245136-92245158 GTGATGATCTTTAGGAGGTAAGG - Intergenic
1101289552 12:103353721-103353743 GTTTTCACCAACAGGAGGGATGG + Intronic
1102064616 12:109963654-109963676 CAGTTCTTCATCAGGAGGGAGGG + Intronic
1105809895 13:23985737-23985759 GTGTTCATTTCCAGGACAGAAGG + Intronic
1105929752 13:25041411-25041433 GTGTTCATTTCCAGGACAGAAGG - Intergenic
1107447859 13:40484333-40484355 GGGTTAATCTCCAGGAGGGCAGG - Intergenic
1109092755 13:58069773-58069795 GTGATCATCAGAAGGAGGGAAGG + Intergenic
1110398007 13:75054717-75054739 GGATTAATCTCCAGGAGGGAAGG + Intergenic
1117105281 14:52391931-52391953 GTGGTCAGCTTTATGAGGGATGG - Intergenic
1118115603 14:62773048-62773070 GTGTTCATTTTTAATAGGGAAGG - Intronic
1119883800 14:78123377-78123399 GTGTTCATCTCCTGGAGGTGTGG + Intergenic
1120188418 14:81418012-81418034 GAGTTTAGCTTCTGGAGGGATGG + Intronic
1120917193 14:89720564-89720586 GTGTTCTTCTTCATGAAGCAAGG - Intergenic
1121396123 14:93624825-93624847 GTGTCCATCATCAGGAGTGAGGG + Intronic
1121829405 14:97036663-97036685 GTGTTCATGTTGATGAGGGAAGG + Intergenic
1122454027 14:101835668-101835690 GTCTTCATCTTGAGCAGGAACGG + Intronic
1122763999 14:104052253-104052275 GTGTTTTTGTTCAGGTGGGAAGG + Exonic
1123804864 15:23860488-23860510 GGGGTCGGCTTCAGGAGGGAAGG + Intergenic
1123934014 15:25185431-25185453 GTGCTCACCATCTGGAGGGACGG - Intergenic
1124097958 15:26666961-26666983 GAGGTCATTTTCAGAAGGGATGG - Intronic
1124963099 15:34412691-34412713 GTGTTCATCTTCAAGAGAGGGGG + Intronic
1124979722 15:34558917-34558939 GTGTTCATCTTCAAGAGAGGGGG + Intronic
1126373463 15:47971099-47971121 GTGTTTATCTTCAGCAAGCAGGG + Intergenic
1129535069 15:76307063-76307085 GTGTTTATTGTCAGGTGGGAAGG - Intronic
1131442302 15:92468178-92468200 CTGTGCATGTTCAGGATGGACGG - Exonic
1131492986 15:92879155-92879177 GTGCTGATCTTTAGGAGGGAAGG - Intergenic
1141307675 16:82881613-82881635 GTATTCCTTTTCAGGACGGAAGG - Intronic
1142767774 17:2075291-2075313 GACTACATCTTCAGGAGGGCGGG + Intronic
1144195563 17:12891492-12891514 GTGTTCATTATCATGAGGGTGGG - Intronic
1145812795 17:27774589-27774611 GTGTTTATTTTCAGCAGGCAAGG - Intronic
1146136280 17:30323691-30323713 GTGTTCATAGTCAGGATGGCAGG + Intronic
1147185853 17:38712796-38712818 CTGCCCACCTTCAGGAGGGATGG + Intronic
1150847726 17:68676680-68676702 GTTTGCAGTTTCAGGAGGGAAGG + Intergenic
1151320425 17:73349295-73349317 GTGTTCATCTAGAGGATGGAGGG - Intronic
1151678785 17:75613456-75613478 GTGTTCACCTTCAGCGGTGAGGG + Intergenic
1153796732 18:8630486-8630508 GTGTTCATGTTCATGCTGGAGGG + Intronic
1156634947 18:39016219-39016241 GTGCTCAGCTTCAGGAGGGATGG + Intergenic
1159625789 18:70692363-70692385 GAGTTCATCTTCAGGAATGAGGG - Intergenic
1166340423 19:42133693-42133715 GTGACCATCGTCAGCAGGGAGGG - Intronic
925639963 2:5978025-5978047 GTGTTCAAGTCCAGGAGGAATGG + Intergenic
926142201 2:10374472-10374494 CTGTTCCTCTTCAGGATGCAAGG + Intronic
926747475 2:16170890-16170912 GTGTTCACTTCCAAGAGGGAGGG - Intergenic
926942318 2:18151578-18151600 GTGTTCTTATTAAAGAGGGAAGG + Intronic
927122488 2:19979925-19979947 GTTATCATCTTCAAAAGGGAAGG - Intronic
929093849 2:38245597-38245619 CTGTACATCCTCAGGAAGGAAGG + Intergenic
931221869 2:60295660-60295682 GTTTTCATGTTCAGGCGGGCAGG - Intergenic
931647376 2:64436871-64436893 GTGTGAATTTTCAAGAGGGAGGG + Intergenic
933505023 2:83165936-83165958 TTGCTCATTTTCAGGAGAGAAGG - Intergenic
934098685 2:88630658-88630680 GTGTTAACCTTCAGAAGGGCGGG - Intergenic
934739297 2:96707602-96707624 GTGTTCTTCTTCTGAAGGGTAGG - Intronic
935435592 2:103028502-103028524 GAGTTTATATTCAGGAGAGAAGG + Intergenic
937026209 2:118699802-118699824 CTGTTTATCTTCAGTAGGGAGGG + Intergenic
937426446 2:121803593-121803615 CTGTGCATTTTCAGGAGGTAAGG + Intergenic
938164423 2:129014322-129014344 GTGTTCATATTCATGAGAGAGGG + Intergenic
943028111 2:182653630-182653652 AGTTTCATCTTCAGGATGGAAGG + Intergenic
943147580 2:184065204-184065226 GTGATCATTTGCAGGAGGGGAGG + Intergenic
944300822 2:198123160-198123182 ATGCTCATCTTCAGTGGGGAGGG + Intronic
945622769 2:212162396-212162418 GTGTTTATCTTGAGAAGTGAGGG + Intronic
945843426 2:214915175-214915197 GTGTTTATCTGCTGGAGGGTAGG + Intergenic
948577849 2:238965677-238965699 GGGTTCATGTTCAGGCGGGAAGG - Intergenic
1170735787 20:19013148-19013170 GTGATTTCCTTCAGGAGGGAGGG + Intergenic
1171134954 20:22687742-22687764 GTGTTCATCTTCAGCCATGAGGG + Intergenic
1171224019 20:23425494-23425516 GTGTTCTGCTTCAGAAGGCAGGG + Intergenic
1175017107 20:55803511-55803533 GTGTTCATCTTTTGTAGGGGAGG - Intergenic
1176010255 20:62889623-62889645 GTCTTCACCTCCAGGAGGGCCGG + Intronic
1182918542 22:34058480-34058502 GTGGTCAGGTTCTGGAGGGAGGG - Intergenic
1183469736 22:37998992-37999014 GTCTTCATCTTGTGTAGGGACGG - Intronic
1185080740 22:48708199-48708221 AAGTTCATCTTCAGGAGGGGCGG - Intronic
952193687 3:31050063-31050085 GTGTACATCTTGGGGAAGGAAGG + Intergenic
954088236 3:48264054-48264076 GTGTACATCATCAGGAGGGGAGG + Intronic
954680150 3:52341233-52341255 GGCTTCATCTTCAGGCGAGATGG + Intronic
955084058 3:55685535-55685557 CTTTTCATCTTCATGAAGGAGGG + Intronic
956736636 3:72243591-72243613 GTGCTCATCTTCAGGAGAACAGG + Intergenic
956971451 3:74531287-74531309 GTTTTCATCTGCAGCAGGAAAGG + Intergenic
960322879 3:116258709-116258731 GTGTTCACCTTCAGGAAGCAGGG - Intronic
960420555 3:117440212-117440234 GAGTTCTTCTTAAGGAGAGAAGG - Intergenic
960969412 3:123129006-123129028 CTGTCCATCTACACGAGGGAGGG - Intronic
961243143 3:125429751-125429773 GTTTTCATTCTCAGGAGGGTTGG + Intergenic
961333232 3:126155157-126155179 CTGTTCCTCTTTAGGAGGAATGG - Intronic
962428549 3:135297838-135297860 GGGTCCAGCTTCTGGAGGGAGGG + Intergenic
965717002 3:171615511-171615533 GTCTTCCTCTTGGGGAGGGAAGG - Intronic
967025227 3:185558867-185558889 GTGTCTATCTTCTTGAGGGAAGG - Intergenic
969019159 4:4127900-4127922 GTGTTTTTCTTCAAGAGAGAAGG - Intergenic
969513938 4:7636091-7636113 GTGCTCATCTTCAGCAGGGCTGG + Intronic
970296752 4:14638995-14639017 GTGCTCAGCTACAGGAGGCAGGG + Intergenic
975620506 4:76291621-76291643 GTCCTCTTCTGCAGGAGGGATGG - Intronic
978277427 4:106968423-106968445 GTGTTAATATTCTGGAGAGAAGG - Intronic
980346515 4:131628487-131628509 GGCTTCATCTCCAGGAGGCAAGG + Intergenic
981022169 4:140040440-140040462 TTGTTGATGTTCAGGTGGGAGGG - Intronic
981095988 4:140782271-140782293 GTATTTTTCTTCTGGAGGGAGGG + Intergenic
984812392 4:183806809-183806831 GTGTTCGTGTTCAGGACGGTAGG + Intergenic
986100827 5:4609606-4609628 GTGATCTACTTTAGGAGGGAAGG + Intergenic
987160814 5:15140236-15140258 GACTTCTCCTTCAGGAGGGAGGG + Intergenic
987520096 5:18970709-18970731 TTTTTCCTCTTCAGGAGAGAGGG - Intergenic
989207714 5:38827944-38827966 GTCTTCACATGCAGGAGGGATGG - Intergenic
990186165 5:53212266-53212288 GTGTGCATTTTCATGAGGAATGG - Intergenic
990663343 5:58043534-58043556 GTATCCATCTTGAGGATGGAAGG - Intergenic
993078364 5:83264612-83264634 GTGGTCATCTCCAGGTGGGTGGG - Intronic
996685212 5:126272456-126272478 TTTTTCATCTTCAGGAAGAAAGG + Intergenic
996744042 5:126829877-126829899 GGGCTCTTATTCAGGAGGGAGGG + Intronic
999848776 5:155514837-155514859 ATGTACATCTTCTGGAGAGATGG + Intergenic
1000843594 5:166252051-166252073 GTTTTCATCTTCAGAGGGGGAGG + Intergenic
1001818935 5:174694545-174694567 TTATTGATCCTCAGGAGGGAGGG - Intergenic
1003320226 6:5044488-5044510 GGGTCCAGCTTCAGGAGGGCAGG + Intergenic
1003442871 6:6159603-6159625 GTGCCCATCTGCAGGTGGGAAGG - Intronic
1003905660 6:10697307-10697329 GTTTTCATCTTCAGCAGCAATGG + Exonic
1007085383 6:39140826-39140848 GCTTTGATCTTCAGAAGGGAAGG - Intergenic
1007162504 6:39803233-39803255 ATGTTCAGCTTTAGGAGGTATGG + Intronic
1010123475 6:72406623-72406645 CTGTGCATCTTCAGTAGGGCTGG + Intergenic
1012340772 6:98120266-98120288 GTGTGCATTTTTAGGGGGGAGGG + Intergenic
1014243986 6:119048043-119048065 GTCTTCATCTCCGGGATGGAAGG + Intronic
1014903703 6:127001256-127001278 GTATTCATCTGCATGAGGGCAGG + Intergenic
1016363827 6:143294808-143294830 GGGATCATCTTCAGAATGGAGGG - Intronic
1017027435 6:150193644-150193666 GTATACATCTGGAGGAGGGAGGG + Intronic
1017084304 6:150699872-150699894 GTCTTTATCCTCAGAAGGGAAGG - Intronic
1018721039 6:166572880-166572902 GTTTTCTTCTTCAGCAGGCAGGG - Intronic
1019715428 7:2536645-2536667 GTTTTCAGCTTAAGGTGGGAAGG - Intergenic
1019741391 7:2676496-2676518 GTTTTCAGCTTAAGGTGGGAAGG + Intergenic
1019932441 7:4233240-4233262 GCCTTCATCTGCAAGAGGGATGG - Exonic
1023203675 7:37725115-37725137 GTCTCCATCTCCAGGAGAGAAGG - Intronic
1023636607 7:42217676-42217698 TTGCACATCTTAAGGAGGGATGG - Intronic
1024114216 7:46177137-46177159 GTGTTCAAATGCAGGAAGGAGGG - Intergenic
1024674472 7:51625689-51625711 CTGTTCATCTGCTGGAGGGCTGG + Intergenic
1026573117 7:71549084-71549106 GCTGTGATCTTCAGGAGGGAAGG + Intronic
1027051941 7:75026083-75026105 GTGGTCATGTCCAGGAGGCATGG + Intergenic
1027314600 7:76977612-76977634 GTTCTCATCTTCAGGATGGTGGG + Intergenic
1029974050 7:104815966-104815988 GTGGTCAGCTACAGGAAGGAGGG - Intronic
1031125385 7:117768074-117768096 GTGTGCATTTACAGGAGTGATGG - Intronic
1033354228 7:140586346-140586368 GTTTTCTTTTTTAGGAGGGACGG - Intronic
1034567682 7:151928807-151928829 GTGGTCATCTACAGGAGGGGTGG + Intergenic
1034881025 7:154762723-154762745 GTTTTTATCTGCAGGAGAGATGG - Intronic
1035351586 7:158251170-158251192 GTGCTCATCTTCAGGAGAATGGG + Intronic
1035761550 8:2072404-2072426 GGGGTCACCTTCAGGAGGGAAGG + Exonic
1037690883 8:21180554-21180576 ATGTTCAAGATCAGGAGGGATGG - Intergenic
1039552878 8:38455897-38455919 GAGTTTATGGTCAGGAGGGATGG - Intronic
1039678744 8:39704371-39704393 GTCTTCATCTCCAGGATGCAAGG + Intronic
1040565433 8:48562923-48562945 AAGCTCACCTTCAGGAGGGAAGG - Intergenic
1041924200 8:63219561-63219583 GTGTGCATCTGTAGGAGGGTGGG - Intergenic
1046601097 8:116317569-116317591 GTCTTCATCCTCAGGATGCAAGG + Intergenic
1047078425 8:121431732-121431754 GTGTACATGTTCTGGAAGGAAGG + Intergenic
1047384451 8:124396158-124396180 GTGTCCAGCTCCAGCAGGGATGG - Intergenic
1047810838 8:128407107-128407129 GTCTTCAGCTTAAGGAGGAAGGG + Intergenic
1049060751 8:140274336-140274358 GTGTTCTTGCTCAGGAGGGCCGG - Intronic
1050799950 9:9598214-9598236 GTGTCCACCTTGAGGAAGGAGGG - Intronic
1052676967 9:31639003-31639025 ATGTTCATCTATAGGATGGATGG + Intergenic
1055758928 9:79585841-79585863 GTGTTCATCCACAGGACGGGGGG - Intronic
1055768205 9:79688029-79688051 GTTCTCATCTTTAGGTGGGAGGG - Intronic
1057171153 9:92963975-92963997 GTGTAGATCTTCAGGGAGGAGGG - Intronic
1059012377 9:110476399-110476421 GTCTCCATCAGCAGGAGGGAAGG + Intronic
1059308100 9:113370262-113370284 GTGGGCAGCTTTAGGAGGGATGG + Exonic
1061732845 9:132629838-132629860 GGGTTCATCTTCCTGGGGGAGGG + Intronic
1061771193 9:132923485-132923507 GTGTCCATCTGCAGGAGAAAAGG + Exonic
1187365022 X:18659748-18659770 ATGGCCAGCTTCAGGAGGGAGGG - Intronic
1189741261 X:44119284-44119306 GGGGTCATCTTCAGGATGGTGGG - Intergenic
1190805463 X:53831979-53832001 GACTTCTTCCTCAGGAGGGAGGG - Intergenic
1192733812 X:73829104-73829126 ATGTTGATCTTCAGGTGGGAAGG + Intergenic
1192736000 X:73850524-73850546 GTGTTCCTCTTGAGGAAGGCAGG + Intergenic
1193017923 X:76756653-76756675 GTGTTCCTTTGCAGGAGGGGAGG - Intergenic
1193301647 X:79896240-79896262 GTCTTCATCTTCAGGATGCAAGG - Intergenic
1193945468 X:87728278-87728300 CTGTCCTTCTTCCGGAGGGACGG - Intergenic
1195744754 X:108105589-108105611 GGCTTCTTCCTCAGGAGGGAGGG - Intronic
1196004769 X:110823873-110823895 ATTTTTATCTTCAGGAGGGTTGG - Intergenic
1196033979 X:111122917-111122939 GGGTTTCTCTTCTGGAGGGAAGG - Intronic
1198634050 X:138675912-138675934 ATGTTCATCTTTGGTAGGGAAGG + Intronic
1198687431 X:139241843-139241865 GTCTTCATCCTCAGGATGCACGG + Intergenic
1198954666 X:142115211-142115233 GGGTTCTACTTGAGGAGGGATGG + Intergenic