ID: 901090439

View in Genome Browser
Species Human (GRCh38)
Location 1:6637369-6637391
Sequence CACAAGGAGGTGCCTGGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 407
Summary {0: 1, 1: 0, 2: 6, 3: 46, 4: 354}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901090439_901090445 7 Left 901090439 1:6637369-6637391 CCTCCTCCAGGCACCTCCTTGTG 0: 1
1: 0
2: 6
3: 46
4: 354
Right 901090445 1:6637399-6637421 GAGACCCCCAGCGCCCACCCTGG 0: 1
1: 0
2: 4
3: 33
4: 355
901090439_901090450 18 Left 901090439 1:6637369-6637391 CCTCCTCCAGGCACCTCCTTGTG 0: 1
1: 0
2: 6
3: 46
4: 354
Right 901090450 1:6637410-6637432 CGCCCACCCTGGACCAAGAGAGG 0: 1
1: 0
2: 0
3: 5
4: 91

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901090439 Original CRISPR CACAAGGAGGTGCCTGGAGG AGG (reversed) Intronic
900136816 1:1121264-1121286 CACCAGGACGTGCGTGGACGAGG + Intergenic
900787749 1:4659355-4659377 CACAAGGAGGAGACAGGAGCAGG + Intronic
900959584 1:5910409-5910431 CACATGGGGGTGACGGGAGGTGG - Intronic
901047405 1:6405543-6405565 AGCTAGGAGGTGCATGGAGGTGG - Intergenic
901090439 1:6637369-6637391 CACAAGGAGGTGCCTGGAGGAGG - Intronic
901718778 1:11178269-11178291 AACCAGGAGATGCCTGGAGACGG - Intronic
903593818 1:24478913-24478935 AAAATGCAGGTGCCTGGAGGAGG + Intergenic
904295982 1:29519983-29520005 GACATGGAGGTGCTGGGAGGGGG + Intergenic
905017101 1:34785417-34785439 CACAAGGACAAGCCTCGAGGGGG + Exonic
905070771 1:35223438-35223460 CTCAAGGAAGTGGGTGGAGGAGG - Intergenic
905502214 1:38448828-38448850 CACAAGGAGGTGCTGGGGAGAGG + Intergenic
906727451 1:48054508-48054530 CAAAAGGAGGTGGGTGGAGTGGG + Intergenic
907976022 1:59432164-59432186 CAAGTGGAGGTGCCTGGAGAGGG + Intronic
908080932 1:60577699-60577721 CTCAGGGAGGTGGCAGGAGGAGG - Intergenic
908511734 1:64854935-64854957 CACAGGGGGCTGCCTGGAGGAGG - Intronic
912878695 1:113388736-113388758 CACCAGCAGGAGACTGGAGGAGG + Intergenic
914458111 1:147855513-147855535 CTGGAGGAGGTGCCTTGAGGAGG - Intergenic
914679318 1:149927864-149927886 GAAGAGGAGGTGCCTGGAAGCGG + Exonic
914889871 1:151612649-151612671 CACAAGGAGGGGCCCGGCTGCGG - Intronic
915556883 1:156665676-156665698 CAGGAGGAGGTGCCTGGGGTGGG - Intergenic
916069635 1:161162345-161162367 CGGCAAGAGGTGCCTGGAGGAGG + Exonic
917542803 1:175931455-175931477 CACAGGGAGGGGCCTGTTGGGGG - Intergenic
917924549 1:179778374-179778396 CACAAGTAGGTGCTTGGGGTCGG - Intronic
920082926 1:203389272-203389294 GACAAGTAGTTGCCTGGAGATGG - Intergenic
920847782 1:209608017-209608039 CACATGCACGTGCTTGGAGGAGG - Intronic
924148860 1:241107148-241107170 CACAAGGAGCAGAGTGGAGGGGG - Intronic
1062953832 10:1526791-1526813 GTCAGGGAGGTGCCAGGAGGAGG - Intronic
1063448479 10:6135037-6135059 CACAAGGAGGAGCTGGGAAGTGG + Intergenic
1065579356 10:27155445-27155467 AGCAAGAAGGAGCCTGGAGGAGG + Exonic
1065722894 10:28643368-28643390 CACAAGGCAGGGCCTGGAAGGGG - Intergenic
1065898962 10:30188114-30188136 CAGAAGGGGGTCCCAGGAGGAGG - Intergenic
1067350934 10:45474913-45474935 CAGAGGGAGCTGCCTGGAGATGG + Intronic
1067667131 10:48288263-48288285 CACAAGGAGGAGGCTGAGGGAGG + Intergenic
1067973809 10:51001277-51001299 ATCAAGAAGGAGCCTGGAGGAGG - Intronic
1068657808 10:59592878-59592900 CACAGGGAGCTGCCTGAAGACGG + Intergenic
1068743357 10:60500465-60500487 CAAAAAGAGGTGGGTGGAGGAGG + Intronic
1069534694 10:69244409-69244431 CACAGGCATGTGCCTGGAGTAGG - Intronic
1069755826 10:70774054-70774076 CACTAGAAGGTCCCTGGGGGAGG + Intronic
1069850294 10:71399810-71399832 CAGAAAGAGGTGAGTGGAGGGGG + Intronic
1070112869 10:73501472-73501494 GAAAATGAGGTGCCAGGAGGAGG - Intronic
1070252473 10:74784960-74784982 CACATGGAGGTTCCTGGAGAGGG + Intergenic
1071129043 10:82370338-82370360 CAGCAGGGGGTGACTGGAGGAGG - Intronic
1073326184 10:102645000-102645022 CACCAGGAGGTGCCCGCGGGCGG - Exonic
1075023525 10:118967830-118967852 CACAAGGATGTGGGTGCAGGTGG + Intergenic
1075589118 10:123678684-123678706 CATCAGGGTGTGCCTGGAGGGGG - Intronic
1076455830 10:130594535-130594557 TATGAGCAGGTGCCTGGAGGAGG - Intergenic
1076735507 10:132457237-132457259 CCCTTGGAGGTGCCTGGAGGGGG + Intergenic
1077530643 11:3093255-3093277 CACAGGGAGGTCCCTGCAGGCGG - Intronic
1077890180 11:6412906-6412928 CAGAGGGAGGGGTCTGGAGGGGG - Intronic
1078194164 11:9121131-9121153 CACAGAGTGGAGCCTGGAGGGGG - Intronic
1078851889 11:15171577-15171599 CAGGGGCAGGTGCCTGGAGGAGG - Intronic
1078938758 11:15976963-15976985 CACATGAATGGGCCTGGAGGTGG + Intronic
1080646093 11:34188884-34188906 AACAAAGAGGTGCCTTGATGTGG + Intronic
1083195104 11:61081411-61081433 CTCAATGAAGTGCCTGGAGAGGG + Intergenic
1083230386 11:61314046-61314068 CACAAGGAGATGCTGGGTGGAGG - Exonic
1083810976 11:65106838-65106860 CACAAGGAGGTGACAGGAGGAGG + Intronic
1084161584 11:67353248-67353270 GACACGGAGGGGCCTAGAGGAGG - Intronic
1084166173 11:67375691-67375713 CACAAGGAGCGGCTTCGAGGCGG - Intronic
1085417591 11:76329741-76329763 GAGAAGGAGGTGCGTGGAGGTGG - Intergenic
1089303420 11:117512328-117512350 CCCAAGGAGGGGGGTGGAGGAGG - Intronic
1089622870 11:119731818-119731840 AACATGGAGGTGCGTGGAGGTGG + Intergenic
1090007732 11:123017645-123017667 GAGAAGGAGGAGGCTGGAGGTGG + Intergenic
1090183888 11:124723657-124723679 CACAAGAAGGTTCCTGGGGCAGG + Intergenic
1090400479 11:126445428-126445450 TACAGGGAGGTTCCTGTAGGAGG - Intronic
1090737806 11:129626176-129626198 CTGAAGGAGATCCCTGGAGGGGG + Intergenic
1090995341 11:131860920-131860942 CACAAGGAGGTGCCCAGTTGTGG - Intronic
1091277212 11:134360603-134360625 CGCAGGTGGGTGCCTGGAGGTGG - Intronic
1091411229 12:240833-240855 CACAAAGACGTGCCTGGAAGGGG + Intronic
1091442361 12:521355-521377 CACACTGAGGTGTCTGGAGCCGG + Intronic
1092062101 12:5559716-5559738 CACTTGGAGGTTCCTGGAGGTGG + Intronic
1093786340 12:23195825-23195847 CACAGGGAGGGGCCTGTTGGGGG - Intergenic
1094248372 12:28329758-28329780 CACAGGGTGGGGCCTGGGGGAGG - Intronic
1094477262 12:30850828-30850850 CACATGCAGTTACCTGGAGGTGG - Intergenic
1095562516 12:43583021-43583043 CACAGGGAGGGGCCTGTTGGGGG + Intergenic
1095796717 12:46226984-46227006 CACAATGACGTGCCTTGATGTGG - Intronic
1096215286 12:49795020-49795042 AACAAGGAGGGGGCTGGCGGGGG - Exonic
1096670977 12:53198049-53198071 CTCAAGGAGTGGACTGGAGGTGG - Intronic
1096748322 12:53743095-53743117 CACAGGGAGGTGCCAGTATGTGG - Intergenic
1097029465 12:56080708-56080730 AAACAGGAGGTGCTTGGAGGTGG + Intronic
1097183789 12:57185521-57185543 CACACGTTGGTGCCTGGGGGAGG - Exonic
1097308949 12:58097849-58097871 CATGTGGAGGTGCCTGGAGAGGG - Intergenic
1098550269 12:71754785-71754807 CAGAAGAACGTGCCTGGACGTGG - Intergenic
1100462096 12:94809811-94809833 CTCAAGGAGTTCCTTGGAGGAGG - Intergenic
1100810242 12:98330449-98330471 CACTTGGAGGTGTCTGGTGGGGG - Intergenic
1102934858 12:116887817-116887839 TACAAGGACGTCCCTGGAGAAGG - Intergenic
1103213497 12:119183769-119183791 CCAAAAGAGGGGCCTGGAGGTGG - Intronic
1103931926 12:124455375-124455397 CCCGAGGATGTGCCTGGAGGGGG + Intronic
1104357573 12:128101329-128101351 CTCAAGGAGGTCCCTGGGGTAGG - Intergenic
1104552105 12:129766718-129766740 CACTAGGAGGTGCATAGAGGGGG - Intronic
1104806149 12:131590744-131590766 CACAGGGAGGACCCTGGAGGAGG + Intergenic
1104983185 12:132582961-132582983 CTCCAGGAGGTCCCTGGGGGCGG - Exonic
1105271156 13:18875926-18875948 TACAGGGAGGTGATTGGAGGGGG - Intergenic
1105817077 13:24046214-24046236 GACTAGGAGGTGACAGGAGGAGG - Intronic
1107561948 13:41565168-41565190 CACAAGAAGGAGCCAGGTGGAGG + Intergenic
1108347526 13:49560942-49560964 CACATCGAGGTGCTGGGAGGGGG - Intronic
1108493009 13:51000002-51000024 CACAAGGAGGTGACTAATGGAGG - Intergenic
1108848082 13:54699160-54699182 GAGGAGAAGGTGCCTGGAGGAGG + Intergenic
1109631395 13:65052967-65052989 TAGAAGGAGGTGCCTAGATGAGG - Intergenic
1111205950 13:85011444-85011466 ACCAAGGTGGTGGCTGGAGGTGG + Intergenic
1111509420 13:89241868-89241890 CCCATGGAGGTTCCTGGAGGGGG - Intergenic
1113060190 13:106314313-106314335 AACAAGGTGGTGGCTGGGGGAGG + Intergenic
1113640780 13:111955392-111955414 CACATGCTGGTGCCTGGTGGAGG - Intergenic
1113704166 13:112415188-112415210 CACACTGAGCTGCCTGGAGTTGG + Intronic
1113948360 13:114057683-114057705 CTCAAGGAGGAGAGTGGAGGCGG + Intronic
1114629797 14:24151662-24151684 GACAAGCAGGTGCTGGGAGGAGG + Exonic
1115946305 14:38665253-38665275 CACCAGGAGCTGCCAGGAGCTGG - Intergenic
1116396274 14:44451533-44451555 CATATGGAGGTTTCTGGAGGAGG + Intergenic
1117252242 14:53949609-53949631 CAAAAGGTGGTACCTGGAGGTGG - Intergenic
1119479201 14:74949295-74949317 CACTAGAAGGTACCTGGAGAGGG - Intronic
1119950542 14:78739743-78739765 TACAAGGAGATGGCTGGATGTGG - Intronic
1119977667 14:79043366-79043388 CAGAAGGATGTGGGTGGAGGCGG + Intronic
1122295719 14:100704685-100704707 CAGAAGAGGGTGACTGGAGGGGG - Intergenic
1122621375 14:103059287-103059309 CACAAGGAGAGGCCTCTAGGGGG + Intergenic
1122863180 14:104591654-104591676 CACATGGAGGGTCCTGGTGGGGG - Intronic
1123032281 14:105457545-105457567 CCCCAGAAGGTCCCTGGAGGTGG + Intronic
1123202372 14:106678887-106678909 CACAATGAGGTGCCTGTCTGTGG - Intergenic
1202946265 14_KI270726v1_random:29595-29617 CCCAAGGAGGAGCCTGAGGGAGG - Intergenic
1124504515 15:30261563-30261585 CCCCAGGAGCTACCTGGAGGAGG + Intergenic
1124601496 15:31136248-31136270 CAGCAGGAGGTGTCTGGAGGCGG + Intronic
1124739036 15:32277072-32277094 CCCCAGGAGCTACCTGGAGGAGG - Intergenic
1124795092 15:32770641-32770663 AAACAGGAGGTGCCTGAAGGAGG + Exonic
1125888979 15:43251722-43251744 CACATGGAGGTGAAAGGAGGAGG - Intronic
1128476520 15:68001519-68001541 CACAAGGTGGTGCATGGATGGGG + Intergenic
1128661137 15:69501831-69501853 CACATGGAGGTTCCTGAAGGTGG + Intergenic
1128710446 15:69867487-69867509 CAGATGGAGTTGCCTGGAGAGGG + Intergenic
1128732481 15:70030650-70030672 GAGAAGGAGGTGGCTGGAGCTGG - Intergenic
1128761577 15:70219729-70219751 CACAGGGTGGAGCCTGGAGGAGG - Intergenic
1129325542 15:74798554-74798576 CGCCAGCAGGTGGCTGGAGGGGG + Intronic
1129832953 15:78682455-78682477 CCCAGGGAGGTGCCTGCAGGAGG + Intronic
1130024801 15:80261790-80261812 CAAGAGGAGGTACCGGGAGGCGG + Intergenic
1132462771 16:63545-63567 CGGAAGGAGGGGCCTGCAGGAGG + Intronic
1132550865 16:553329-553351 CACCAGGACCTGCCTGGGGGAGG - Exonic
1133008728 16:2898474-2898496 CACCAGGAGGTCCCTGCAGAGGG + Intronic
1133033720 16:3023478-3023500 CACCAAGCGGCGCCTGGAGGAGG - Exonic
1133431157 16:5738015-5738037 CACACACTGGTGCCTGGAGGGGG - Intergenic
1134016568 16:10892485-10892507 CAGAGGGAGCTTCCTGGAGGAGG - Intronic
1136094830 16:27947936-27947958 CAGAAGGAGGTGCCTGAGGCTGG + Intronic
1137572478 16:49575862-49575884 CACTTGGAGGAGCCTGAAGGAGG + Intronic
1138180999 16:54939947-54939969 CCCATGGAGGGGCTTGGAGGGGG + Intergenic
1138529873 16:57629247-57629269 CACAAGGAGATGCCTGGGAGGGG + Intronic
1139177010 16:64700931-64700953 CACAAGGACCAGCCTGGCGGTGG - Intergenic
1139547580 16:67656862-67656884 CACCAGCAGGGGCCTGGAGCTGG - Exonic
1139715179 16:68807537-68807559 CACATGGTGGTGCATGGTGGTGG + Intronic
1139786464 16:69396919-69396941 CACTAGGAGGAGCCTTGAGAAGG + Intronic
1139952009 16:70677102-70677124 CATTAGGAGGAGCCTGGGGGAGG - Intronic
1141144958 16:81522815-81522837 AATAAGGGGGTACCTGGAGGTGG - Intronic
1141509792 16:84504878-84504900 ACCAAGGAGGCGCCTGGAGAGGG + Intronic
1141976663 16:87520789-87520811 CACAGGGAGTTGGCTGGGGGTGG + Intergenic
1142060799 16:88027854-88027876 CTCACGGAGGAGCCTGGAGCAGG - Intronic
1142218601 16:88841862-88841884 CCCAAGGGTGTCCCTGGAGGCGG + Intronic
1142864038 17:2779671-2779693 CAGAAGCAGGTGCTTGAAGGAGG + Intronic
1143033580 17:3981897-3981919 CACAAGGTGGAGGTTGGAGGAGG - Intergenic
1143103808 17:4518646-4518668 CACGAGGAAGTGCCAGGATGGGG + Intronic
1143370759 17:6437613-6437635 CACAAGGTGTTATCTGGAGGTGG - Intergenic
1144009026 17:11127757-11127779 CATATGGAGGTTCCTGGGGGTGG - Intergenic
1146486546 17:33247664-33247686 CAGAAGGAGCTTCCTGGAGCAGG + Intronic
1146594486 17:34157121-34157143 CACAAAAGGGGGCCTGGAGGAGG - Intronic
1148747445 17:49926637-49926659 CAATAGGTGGTGCCTGGAGGTGG - Intergenic
1148760152 17:49995503-49995525 CTGAAGGAGGGGCGTGGAGGTGG + Intergenic
1150209977 17:63436519-63436541 GACAAGAAGGTGGGTGGAGGGGG - Intronic
1150634734 17:66905009-66905031 CAGAAGGAGAGGCCAGGAGGGGG + Intergenic
1151335322 17:73436218-73436240 CACATGGAGGTGAAAGGAGGAGG + Intronic
1151817366 17:76477874-76477896 CCCAAGGCGCTGCCTGCAGGCGG - Intronic
1151836745 17:76586855-76586877 CAGCAGGAGGTGAGTGGAGGGGG - Intronic
1152139705 17:78529313-78529335 AACAGGGAGGTGCAGGGAGGAGG - Intronic
1152540623 17:80972576-80972598 CAGGAGGAGGTGCCTGTGGGCGG + Intergenic
1153222063 18:2870740-2870762 CACGAGCAGGGACCTGGAGGTGG + Intronic
1153774223 18:8438673-8438695 CACAAGGGGGAGGCTGGAAGGGG - Intergenic
1154490755 18:14920152-14920174 AACAAGGAGGGTCCTGGAAGGGG - Intergenic
1156055006 18:32991777-32991799 TGCAGGGATGTGCCTGGAGGTGG - Intronic
1157890976 18:51417725-51417747 CACTAGGTGGTGCCTGGACTAGG + Intergenic
1159581008 18:70234764-70234786 CACAGGGAGGTGGAAGGAGGTGG + Intergenic
1160039246 18:75330921-75330943 CACAGGGAGACGCCTGGAGATGG - Intergenic
1160238800 18:77107418-77107440 CATAAGGAGGTGGGAGGAGGAGG - Intronic
1160265394 18:77337353-77337375 CACATGCACCTGCCTGGAGGAGG + Intergenic
1161172018 19:2816852-2816874 CACGTGGAGGTGCTTGGAGTGGG + Intergenic
1161281439 19:3447813-3447835 TTCCAGGGGGTGCCTGGAGGGGG + Intronic
1162525168 19:11202571-11202593 CACAAGGACGTGCCTCCAGCCGG + Exonic
1162788652 19:13051834-13051856 CCTTAGCAGGTGCCTGGAGGGGG + Intronic
1162915560 19:13872891-13872913 CTCTAGAAGGTGCCGGGAGGCGG + Intronic
1162966823 19:14160095-14160117 AACAAGGTGGGGCCTGGCGGTGG - Exonic
1163214812 19:15868599-15868621 CAAAAGGAGGGGAGTGGAGGGGG + Intergenic
1163397196 19:17070537-17070559 GAGAGGGAGGTGCCTGCAGGGGG - Intronic
1163418811 19:17202809-17202831 CACAAGGAGGAGGTTGGCGGGGG - Intronic
1163620969 19:18359831-18359853 CACAAGGAGGTGACTCGTGTTGG - Intronic
1163744247 19:19035478-19035500 CATAAGATGGTGCCTGGAGATGG - Intronic
1164754771 19:30681401-30681423 CACAGGGGGCTTCCTGGAGGAGG + Intronic
1165076588 19:33282897-33282919 CTCAAGGATGTTCTTGGAGGTGG - Intergenic
1166378832 19:42344047-42344069 CCCAAGGGGGTCCCAGGAGGGGG - Exonic
1167267558 19:48491185-48491207 CACAGCGGGGGGCCTGGAGGGGG + Exonic
1167291721 19:48628529-48628551 CGTAAGGAGTCGCCTGGAGGTGG + Intronic
1167308014 19:48719969-48719991 CAGAAGCAGGTGCCCGGAGAGGG + Intergenic
1168719215 19:58545558-58545580 CACAAGGAGGTTTCTGGGGAGGG + Intronic
1202649850 1_KI270706v1_random:170248-170270 TGCAAGGATGTGCCTGGAGCTGG - Intergenic
925076583 2:1021687-1021709 AGCCAGGAGGTGCCAGGAGGTGG - Intronic
925131729 2:1498440-1498462 CACAAGGAGCTGCCTGGGCATGG + Intronic
925134825 2:1519124-1519146 CACATCAAGGTGCCTGCAGGCGG - Intronic
926718341 2:15941652-15941674 CACAAGGCACTGCCTGGGGGAGG - Intronic
927290052 2:21396290-21396312 CTCAAGAAGATGCCTGGAGCAGG + Intergenic
928171919 2:29009775-29009797 CCCAAGGAGGTGGGTGGAGCAGG - Intronic
928201685 2:29251313-29251335 CCCAGGGAGGCCCCTGGAGGAGG - Intronic
929548719 2:42875385-42875407 CACAAAGCGGCGCCGGGAGGAGG - Intergenic
930189576 2:48443532-48443554 CGGGAGGATGTGCCTGGAGGAGG + Intronic
931729135 2:65137594-65137616 GACAAGGAGGGGCTTGGAGTGGG + Intergenic
931908550 2:66869374-66869396 CTCAGGGATGGGCCTGGAGGTGG + Intergenic
932447106 2:71787774-71787796 CACAGGGAGATGTCTGCAGGAGG + Intergenic
933717022 2:85369113-85369135 CACAAGGAAGTCCCTGGGGATGG + Intronic
933902935 2:86862132-86862154 CACATGCAGCTGCCTGGGGGAGG - Intergenic
934220125 2:90074907-90074929 CACAGGGAGGGGGCTGGAGATGG - Intergenic
934692504 2:96372380-96372402 CAGTTGGGGGTGCCTGGAGGAGG + Intronic
935051681 2:99530058-99530080 TACAAAGAGGAGTCTGGAGGTGG + Intergenic
935308969 2:101763897-101763919 CACAAGGCTGTGGCTGGAGAGGG + Intronic
935704164 2:105841470-105841492 CACGGGGAGGTTCCTGGAGAAGG - Intronic
935777610 2:106487137-106487159 CACATGCAGCTGCCTGGGGGAGG + Intergenic
936042738 2:109162011-109162033 CCCAAGGAGGGGGCTGGAGGAGG - Intronic
936159354 2:110072010-110072032 GACACGGAGGTGCCTGGAAGAGG - Intergenic
936185307 2:110299322-110299344 GACACGGAGGTGCCTGGAAGAGG + Intergenic
937973444 2:127566849-127566871 TTCAGGGAGATGCCTGGAGGTGG - Intronic
938102265 2:128505164-128505186 CCCAGGGGGGTGACTGGAGGGGG - Intergenic
938211265 2:129467265-129467287 CTGCAGGAGATGCCTGGAGGTGG + Intergenic
938263771 2:129912157-129912179 CACAAAGAGCAGCATGGAGGAGG + Intergenic
938935256 2:136121909-136121931 AAGGAGGAGGTGCCAGGAGGAGG + Intergenic
941870956 2:170385168-170385190 CACATTGAGGTGCTGGGAGGGGG - Intronic
942117294 2:172740678-172740700 CAGAAAGGGGTCCCTGGAGGAGG + Intronic
942224387 2:173802514-173802536 CATGTGGAGGTTCCTGGAGGAGG - Intergenic
942328485 2:174796211-174796233 CACATGGAAGTGTCAGGAGGGGG - Intergenic
943863652 2:192899496-192899518 CACATGGAGGTTCCTGGGGCTGG - Intergenic
944964498 2:204914809-204914831 CACGCGGTGGTGCCTGGAGCAGG + Intronic
946502167 2:220261135-220261157 GAGAAGGAGGTGGCTGGAGAAGG + Intergenic
946937217 2:224734835-224734857 CTGGAGGAGGTGCCTGGTGGGGG - Intergenic
947035279 2:225846343-225846365 CACAAGGATGTGGCGGGCGGGGG + Intergenic
948329534 2:237154257-237154279 CACAGGGAGGTGGCTGCAGGTGG + Intergenic
948481323 2:238252215-238252237 CAGAAGCAGGAGCCCGGAGGTGG + Intronic
948856053 2:240731168-240731190 GTCAGGAAGGTGCCTGGAGGAGG + Intronic
949009204 2:241668865-241668887 CAGGAGGTGGTGCCTGGGGGAGG - Intronic
1169882759 20:10365423-10365445 GACATGGAGGTGCTGGGAGGTGG - Intergenic
1170261338 20:14411741-14411763 CACAGGGAGGTGCTGGTAGGGGG - Intronic
1170918174 20:20649010-20649032 CACAAAGAAGTGCCTGGGAGGGG + Intronic
1171029354 20:21663376-21663398 CAGAAGGAGGAGCCTGGAGAAGG + Intergenic
1172302966 20:33862894-33862916 CGCAGGGAGGGGCCTAGAGGAGG + Intergenic
1172621346 20:36320216-36320238 CACAGAGGGGGGCCTGGAGGAGG - Intronic
1172923475 20:38508450-38508472 CACATGGATGGGCCTGGAAGAGG + Intronic
1174163962 20:48571430-48571452 CACAAGGCAGTGGCCGGAGGCGG + Intergenic
1174559048 20:51416925-51416947 CACATGGAGGGCCCAGGAGGAGG + Intronic
1175351074 20:58318711-58318733 CACAAGGAGGTGGGAGGAGGAGG - Intronic
1175540412 20:59744374-59744396 CACAGGCATGTGGCTGGAGGCGG - Intronic
1175875351 20:62226904-62226926 GAGGAGGTGGTGCCTGGAGGCGG + Intergenic
1175916620 20:62428813-62428835 AACAGGGAGGTGGCCGGAGGAGG - Intergenic
1175940889 20:62537042-62537064 CACTCGGAGGTACCAGGAGGAGG + Intergenic
1175999482 20:62825556-62825578 CACGAGGAGGGGCCTGGACAGGG + Intronic
1176092206 20:63323447-63323469 CACCAGGAGGAACCAGGAGGAGG - Intronic
1176856910 21:13981165-13981187 TACAGGGAGGTGATTGGAGGGGG - Intergenic
1176867680 21:14063056-14063078 TACAGGGAGGTGATTGGAGGGGG + Intergenic
1177314282 21:19436453-19436475 CACACAAAGGTGCCTGGAGGGGG - Intergenic
1179024837 21:37671349-37671371 CACATGGATGTTCCTGGAAGGGG + Intronic
1179069051 21:38054615-38054637 CAGAAGGAGGTGGCTGGATGTGG + Exonic
1179110515 21:38441684-38441706 CACAAGGATGTTCCAGGGGGAGG - Intronic
1179898733 21:44377958-44377980 CGGAGGAAGGTGCCTGGAGGAGG + Intronic
1180797320 22:18612179-18612201 CACCAGGTGGTACCTGGATGTGG - Intergenic
1180872037 22:19151655-19151677 CACCAAGAGGTGGGTGGAGGAGG - Intergenic
1181224402 22:21383093-21383115 CACCAGGTGGTACCTGGATGTGG + Intergenic
1181254230 22:21551720-21551742 CACCAGGTGGTACCTGGATGTGG - Intronic
1181361930 22:22344191-22344213 CACATGGAGGTGACTGGAGATGG - Intergenic
1181495586 22:23285746-23285768 GACAAGGAGGTGCCATGAGTAGG + Intronic
1182472076 22:30554856-30554878 CACCAGGAGGGGGCTGGGGGCGG + Exonic
1182551935 22:31105274-31105296 CACCAGGTTGTGACTGGAGGTGG + Exonic
1183165654 22:36145366-36145388 CAGAGGGGGCTGCCTGGAGGAGG + Intronic
1183171995 22:36195205-36195227 CAGAGGGGGCTGCCTGGAGGAGG + Intronic
1183176935 22:36231233-36231255 CAGAGGGGGCTGCCTGGAGGAGG + Intronic
1183181292 22:36261807-36261829 CAGAGGGGGCTGCCTGGAGGAGG - Intronic
1183212487 22:36459451-36459473 GACAAAGAGGTGGCTGGAGGTGG + Intergenic
1183371223 22:37433601-37433623 CACAAGCAGGTGCTTGGGGAGGG + Intergenic
1183601468 22:38842985-38843007 CTCAGAGAGGTGCCTGGAGACGG + Intronic
1184361342 22:44020727-44020749 CACATGGAGGTTCCTGAGGGTGG - Intronic
1184378013 22:44126988-44127010 CAAAAGGATGTGCCTTGAGAGGG - Intronic
1184693350 22:46127346-46127368 CCAAAGGGGGTTCCTGGAGGAGG - Intergenic
1185072002 22:48661701-48661723 CACAAGGATGTGCAGGGAGGAGG - Intronic
949566167 3:5246742-5246764 CACCAGGAGGTCCCTGGGCGTGG - Intergenic
950543789 3:13627153-13627175 TTCAAGGAGGCCCCTGGAGGAGG + Intronic
952493257 3:33892446-33892468 CATAAGGAAGTTCCTGGAGCAGG - Intergenic
956560134 3:70565833-70565855 CACATGGAGGTTCCTGGAGGTGG - Intergenic
957396849 3:79651225-79651247 CACAAGGAGGAGTTTGTAGGAGG + Intronic
959252230 3:103963768-103963790 CACAGGGAGCTGCCTAGAGATGG + Intergenic
959666053 3:108922832-108922854 CACAGGGAGGGGCCTGTCGGCGG - Intronic
962601062 3:136991074-136991096 CTCAGGGAGGGGCATGGAGGTGG + Intronic
962687683 3:137863199-137863221 CACAAAGAGGAGCTGGGAGGGGG - Intergenic
963570661 3:146990952-146990974 CACAAGGAGGGGACTCTAGGGGG - Intergenic
963698045 3:148587104-148587126 CACAAGAAGATGCATGCAGGTGG + Intergenic
965066593 3:163857884-163857906 GACAAGGAGGTGCCTGAACCTGG - Intergenic
967055392 3:185825246-185825268 CTCAAGGCGGTGGCGGGAGGAGG + Intergenic
968005933 3:195242784-195242806 CACAAGGTGTTATCTGGAGGTGG + Intronic
968744430 4:2352370-2352392 CACATGGAGGAGGCTGGGGGAGG + Intronic
968916255 4:3498241-3498263 CCCAAGGAGGGGACGGGAGGAGG + Intronic
969033984 4:4236638-4236660 CACAGCAAGGTGCCTGAAGGAGG + Intronic
969217612 4:5734823-5734845 CCCATGGAGGTCCCTGGATGGGG + Intronic
969254100 4:5990882-5990904 CCCCAGGAGGTGAGTGGAGGTGG - Intergenic
974446050 4:61983436-61983458 CACCTGGATGTTCCTGGAGGGGG + Exonic
975019374 4:69468018-69468040 CACAAGGTGTTATCTGGAGGTGG + Intergenic
975984930 4:80193694-80193716 CACAGGGAGGTCTCTGGAAGGGG - Intronic
976739095 4:88340366-88340388 CTCATGGAGGTGCCTGGAGGTGG - Intergenic
977396967 4:96483638-96483660 CACGCTGAGCTGCCTGGAGGTGG + Intergenic
977718357 4:100209426-100209448 CACATGGAGGTTCCTGGAAGGGG + Intergenic
979113964 4:116797051-116797073 AACAAGCAGGAGCCTGGTGGTGG - Intergenic
980480848 4:133385364-133385386 TGCAAGCAGGTGCCTGGAGCAGG - Intergenic
983043173 4:162954535-162954557 CACAAGGTGTTATCTGGAGGTGG + Intergenic
983709124 4:170692987-170693009 CACATGGAGGTTCCTGGAGAGGG - Intergenic
985589555 5:757492-757514 CCCAAGGTGGTGCCAGGACGAGG - Intronic
985631629 5:1017120-1017142 CACCAGGACGTGCCTGGACATGG + Intronic
985706190 5:1402797-1402819 CAAGAGGAGGAGACTGGAGGTGG - Intronic
985746695 5:1652174-1652196 AAGAAGGGGGTGCCTGGAGTGGG + Intergenic
985791567 5:1931056-1931078 CAGCCGGCGGTGCCTGGAGGCGG + Intergenic
986062051 5:4201119-4201141 CACATGAAGGTGTCTGGTGGGGG + Intergenic
986620215 5:9665113-9665135 AACAAGGAGGAGCCTGGAAGTGG - Intronic
987160429 5:15135659-15135681 CTCCAAGAGGTGCATGGAGGAGG - Intergenic
988483431 5:31648498-31648520 AACAAGGTGGAGGCTGGAGGTGG - Intronic
989323611 5:40165239-40165261 GACAAGGAGGTGCATGGATCAGG - Intergenic
991915382 5:71599708-71599730 AATGAGGAGGTGCCAGGAGGTGG + Exonic
992045835 5:72888285-72888307 TACAAGAAGCTGCCTGCAGGTGG + Exonic
995530870 5:113090925-113090947 CTGAAGGAGTTGCCAGGAGGTGG + Intronic
995946120 5:117648371-117648393 CACACACTGGTGCCTGGAGGTGG - Intergenic
996953587 5:129157157-129157179 CACATGGAGATTTCTGGAGGTGG + Intergenic
997517810 5:134503358-134503380 GACAAGGCAATGCCTGGAGGGGG - Intergenic
997735909 5:136212541-136212563 CAGGAGGAGGGGCTTGGAGGTGG + Intergenic
999394308 5:151217297-151217319 AACAAGGAGGTGCCTGGACAGGG - Intronic
1001522347 5:172403518-172403540 CACAAGTGGGTGCCTTGAGAAGG + Intronic
1001670079 5:173466555-173466577 CACAAAGAGGTGAGTGGAGTGGG + Intergenic
1001716125 5:173817873-173817895 ATCAGGGAGGAGCCTGGAGGAGG + Intergenic
1002407588 5:179048028-179048050 CACATGGAGGTGCTGGGAGGGGG - Intergenic
1002597306 5:180332450-180332472 CACCAGGAGGTGTCTAGATGTGG + Intronic
1003005185 6:2374735-2374757 CACAAGAAAGTGCTGGGAGGTGG + Intergenic
1003094568 6:3132198-3132220 CAAGAGGAGGTGCGTGGTGGGGG - Intronic
1003838823 6:10099250-10099272 CCCAAGGAGGTGACGGCAGGTGG - Intronic
1003844924 6:10163283-10163305 CAAAAGGAGGGGCGGGGAGGAGG - Intronic
1004720520 6:18264422-18264444 CACGAGGAGGTTCTGGGAGGCGG + Exonic
1004832277 6:19490029-19490051 CACATGGAGGTTCCTGGAGCAGG + Intergenic
1007206103 6:40152591-40152613 CACATGGAGGTGCCTGGAAGTGG + Intergenic
1007254640 6:40520326-40520348 TAGAAGGAGGTGCAGGGAGGGGG + Intronic
1007630766 6:43272083-43272105 CAAGAGGAGGTGGCTGGGGGAGG - Intronic
1007707733 6:43801299-43801321 CACTAGGGGCTTCCTGGAGGAGG + Intergenic
1008128317 6:47692844-47692866 CCCAAGCAGGTGCCATGAGGAGG - Intronic
1012832727 6:104225897-104225919 CAAAAGGAGGAGACTAGAGGAGG + Intergenic
1013186545 6:107764400-107764422 CAGAAGGGGATGCTTGGAGGTGG + Intronic
1014249354 6:119099738-119099760 TACATGGAGCTTCCTGGAGGGGG + Intronic
1016479481 6:144466881-144466903 CAGAAGGAAGGGCCTGGAGGAGG - Intronic
1018890078 6:167976908-167976930 CACGAGGGGGTGGCTCGAGGCGG - Intergenic
1019469422 7:1210870-1210892 AGCCAGGACGTGCCTGGAGGGGG - Intergenic
1021969162 7:25950726-25950748 GAAAAGGGGGTGCCGGGAGGGGG - Intergenic
1022414706 7:30167973-30167995 CAGAAGGACGTTCCTGTAGGAGG + Intergenic
1023526007 7:41104235-41104257 CAAAAGTAGTTGCCTTGAGGAGG + Intergenic
1024613334 7:51085505-51085527 TCCAAGGAGTGGCCTGGAGGTGG + Intronic
1026458725 7:70595244-70595266 CCCAAGGAGGTGCATGGAAGAGG - Intronic
1026828178 7:73596676-73596698 GACAAGCAGGGGCCTGGAAGGGG + Exonic
1026896570 7:74013146-74013168 CATAGGGAGGGGCCTAGAGGCGG + Intergenic
1029038775 7:97550881-97550903 TACAAGGAGGTGTGAGGAGGGGG - Intergenic
1029438759 7:100576183-100576205 CACAAGGAGGTGCCCGGCCCAGG + Intronic
1029745587 7:102514225-102514247 CACAGGGGGCTCCCTGGAGGTGG - Intronic
1029763526 7:102613204-102613226 CACAGGGGGCTCCCTGGAGGTGG - Intronic
1030524784 7:110640010-110640032 CACAAGCAGAAGCCTGGAGAAGG - Intergenic
1032086570 7:128886890-128886912 CAGAAGCAGGGGCCTGGAGAGGG + Exonic
1033571797 7:142636836-142636858 CACAAGGAGGTTGCTGACGGGGG + Intergenic
1035366342 7:158351236-158351258 CAGAAGGAGGGTCCAGGAGGGGG + Intronic
1036415051 8:8539176-8539198 ATCAAGGAGCTGCCTGGAGCAGG - Intergenic
1037058089 8:14469829-14469851 CACATGGAGGTTCCTAGAGAGGG + Intronic
1037884128 8:22587518-22587540 CGCAAGGATGTTCCTGGGGGTGG - Intronic
1039475088 8:37835443-37835465 CAGATGCAGGTGCCTGGTGGGGG + Intronic
1039803855 8:40982474-40982496 CACGTGGAGGTTCCTGGGGGTGG + Intergenic
1039887236 8:41661862-41661884 CACGAGGAGGTGACTGTAGAGGG - Exonic
1040904954 8:52458728-52458750 CAGAATGAGGTGCCTGGAGCAGG - Intronic
1040946186 8:52886845-52886867 CACATGGAGGTTCCTGGAGGTGG + Intergenic
1041028351 8:53709627-53709649 AACAATGAGTTTCCTGGAGGTGG + Intergenic
1043654547 8:82645962-82645984 CACACGGAGGTTCCTGGATGTGG - Intergenic
1045101342 8:98847635-98847657 CAGCAGGAGGTGTCTGGAGGAGG + Intronic
1047114540 8:121826053-121826075 TGGAAGGATGTGCCTGGAGGTGG + Intergenic
1047308072 8:123669278-123669300 AGGAGGGAGGTGCCTGGAGGTGG + Intergenic
1048210785 8:132452772-132452794 CACTGGGATGTGTCTGGAGGAGG - Intronic
1048354673 8:133643274-133643296 CACAAGAAGGTAGCTGCAGGGGG + Intergenic
1048551056 8:135433808-135433830 GAGAAGGATGTGGCTGGAGGAGG + Intergenic
1049161292 8:141099584-141099606 CACACACAAGTGCCTGGAGGTGG - Intergenic
1049429732 8:142555185-142555207 CACACGCAGGTGCCTGGAGGTGG + Intergenic
1049487745 8:142875300-142875322 CACAGGGTAGAGCCTGGAGGTGG + Exonic
1049492517 8:142912873-142912895 CACAGGGTAGAGCCTGGAGGTGG + Exonic
1049729947 8:144171420-144171442 CCCACGCAGGTGCCTGGAGGTGG - Intronic
1052484076 9:29073039-29073061 CACAAGGATGGGGTTGGAGGGGG - Intergenic
1053425833 9:38009287-38009309 CACATGGAGGTGGCTGGGGGTGG + Intronic
1053608664 9:39687138-39687160 CACATGGAGGTACCTGAGGGTGG + Intergenic
1053866513 9:42443496-42443518 CTCATGGAGGTGCCTGAGGGTGG + Intergenic
1054244860 9:62655272-62655294 CACATGGAGGTACCTGAGGGTGG - Intergenic
1054558986 9:66689803-66689825 CACATGGAGGTACCTGAGGGTGG - Intergenic
1060187670 9:121573888-121573910 CACAGGGAGGGGCCTCCAGGTGG - Intronic
1061386885 9:130295661-130295683 CACAGGGAGGATCCTGCAGGAGG + Intronic
1061842504 9:133367499-133367521 CCCAAGGACGTGCCTGGCAGCGG - Intronic
1062275466 9:135728411-135728433 CCCAAGGAGGGGCCTGCGGGTGG - Intronic
1062378354 9:136275098-136275120 CCCAAGGAGGAGCCTGAAGCTGG + Intergenic
1062540990 9:137041505-137041527 CCCGAGAAGGTGCTTGGAGGTGG - Intronic
1186256669 X:7729296-7729318 CACATGGAAGTGTCTGGAGGAGG - Intergenic
1187921068 X:24202499-24202521 CACAAGAAGGAACGTGGAGGAGG - Intronic
1188649471 X:32613964-32613986 CACATGGTGGTGCATGGTGGAGG + Intronic
1189344360 X:40229404-40229426 CACAAGGATGTGGCTGCTGGTGG + Intergenic
1189357187 X:40319002-40319024 CTCGGGGAAGTGCCTGGAGGTGG + Intergenic
1191107570 X:56781025-56781047 CAAAAGGAGGGGCCCCGAGGTGG - Intergenic
1192330575 X:70172372-70172394 CAAAAAGAGGTCCCTAGAGGGGG + Intergenic
1192369087 X:70498648-70498670 CAGAGGGAGGGACCTGGAGGAGG + Intronic
1197726877 X:129782295-129782317 CACAAGGGGGTGCCTGCTGTAGG + Intronic
1198671013 X:139081008-139081030 GATAAGGTGGTGGCTGGAGGAGG - Intronic
1199307368 X:146281856-146281878 CACTGTGAGGTGCCTGGAGGAGG + Intergenic
1199532604 X:148867321-148867343 CACCTGGAGGTCCCTGGAGAAGG + Intronic
1200156873 X:153981438-153981460 CACAAGGTGGGGGATGGAGGAGG - Intronic