ID: 901091566

View in Genome Browser
Species Human (GRCh38)
Location 1:6645127-6645149
Sequence CTGGGGAGACAGAGGGTGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1458
Summary {0: 1, 1: 1, 2: 13, 3: 145, 4: 1298}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901091566 Original CRISPR CTGGGGAGACAGAGGGTGCA AGG Intronic
900188841 1:1344938-1344960 CAGGTGAGTCAGAGGGTGCTGGG - Intronic
900188848 1:1344978-1345000 CCGGTGAGTCAGAGGGTGCTGGG - Intronic
900620157 1:3583076-3583098 TTGGGGAAAGGGAGGGTGCAAGG + Intronic
900623013 1:3596045-3596067 CTGGGGAGACAGAGGAGACCTGG + Intronic
900672823 1:3866329-3866351 CCTGGGAGGCAGAGGGTGCAGGG - Intronic
900776629 1:4590532-4590554 CTGGGGAGAGAAAGAGAGCACGG - Intergenic
900892380 1:5458675-5458697 CTGGGAAGACAGTGACTGCATGG + Intergenic
901029214 1:6297112-6297134 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
901091566 1:6645127-6645149 CTGGGGAGACAGAGGGTGCAAGG + Intronic
901267711 1:7924549-7924571 CCCGGGAGGCAGAGGTTGCAGGG + Intronic
901308303 1:8249542-8249564 CCCGGGAGGCAGAGGTTGCAGGG + Intergenic
901520875 1:9783915-9783937 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
901674800 1:10876919-10876941 CATGGGAGGCAGAGGTTGCAGGG - Intergenic
901798962 1:11696215-11696237 AAGGGGAGACAGAGGGAGTAAGG - Intronic
901824792 1:11854112-11854134 CCAGGGAGGCAGAGGTTGCAGGG + Intergenic
901870593 1:12136571-12136593 CCTGGGGGACAGAGGTTGCAGGG + Intronic
902061777 1:13650073-13650095 CCGGGGAGGCAGAGGTTGCAGGG - Intergenic
902205252 1:14863747-14863769 CAGGGGAAACTGAAGGTGCACGG + Intronic
902669785 1:17965055-17965077 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
902743580 1:18457812-18457834 CTGGGTAGACTGAGGGAACAAGG + Intergenic
902891075 1:19444080-19444102 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
902941858 1:19806082-19806104 CTGGGGAAAAACAGGGTGAAAGG - Intergenic
902955708 1:19923091-19923113 CTGGGGGGACAGAGTGTTCCTGG - Intronic
903038822 1:20513070-20513092 CCCGGGAGGCAGAGGTTGCAGGG + Intergenic
903174586 1:21573359-21573381 CCCGGGAGGCAGAGGTTGCAGGG + Intronic
903269353 1:22178018-22178040 CTGGGCAGGCAGGGGGTGCGGGG - Intergenic
903397730 1:23014916-23014938 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
903692053 1:25181385-25181407 CTTGGGAGGCGGAGGTTGCAGGG - Intergenic
903737382 1:25538669-25538691 CTAGGGAGTCAGAGGGAGCCTGG - Intergenic
903939187 1:26917180-26917202 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
904122078 1:28205810-28205832 CCCAGGAGACAGAGGTTGCAGGG + Intronic
904392614 1:30195956-30195978 CTCGGGAGACACGGGGTGCTGGG - Intergenic
904496542 1:30890229-30890251 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
904525869 1:31133422-31133444 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
904576606 1:31509091-31509113 CATGGGACATAGAGGGTGCAGGG - Intergenic
904640334 1:31922405-31922427 CCTGGGAGACAGAGGTTGCAGGG + Intronic
904668353 1:32142178-32142200 CCCCGGAGACAGAGGTTGCAGGG + Intronic
904752833 1:32751638-32751660 CTGGGGGAAGAGGGGGTGCAAGG + Intronic
904779622 1:32935820-32935842 CTGGGGAGGCAGAGGTTGCAGGG - Intergenic
904783922 1:32971385-32971407 CTGGGGACACAAAGGATGGAGGG - Intergenic
905259486 1:36707339-36707361 CTGGGGAGAAGGAACGTGCAAGG - Intergenic
905354679 1:37373120-37373142 CTGGGGAGGCAAAGGGAGAAAGG + Intergenic
905389938 1:37629807-37629829 CTGGGGACAGAGAGGGTGTGGGG + Exonic
905444594 1:38018144-38018166 CCCGGGAGGCAGAGGTTGCAGGG - Intronic
905557436 1:38898226-38898248 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
905573309 1:39023748-39023770 CTGGAGAGGCAGAGGTTGCAGGG - Intergenic
905825898 1:41025827-41025849 CTCGGGAGGCGGAGGTTGCAGGG + Intergenic
905991963 1:42345594-42345616 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
906062220 1:42956507-42956529 CCCGGGAGGCAGAGGTTGCAGGG + Intronic
906210835 1:44011411-44011433 CTGGGGGCACAGAGTGGGCAGGG + Intronic
906438342 1:45816751-45816773 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
906733867 1:48105694-48105716 CAGGGGAGATAGCTGGTGCAGGG - Intergenic
906982139 1:50642914-50642936 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
907150954 1:52287163-52287185 CCCGGGAGGCAGAGGTTGCAGGG - Intronic
907377554 1:54056399-54056421 CCAGGGAGGCAGAGGTTGCAGGG - Intronic
907436672 1:54454069-54454091 CCCGGGAGGCAGAGGTTGCAGGG - Intergenic
907814340 1:57903503-57903525 TTGGGGAGAAAGAAGGTGGAAGG - Intronic
907857620 1:58319122-58319144 GTGGGGAGAAAGAGGGGGCTGGG + Intronic
908733084 1:67247378-67247400 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
909259961 1:73474776-73474798 CTTGGGAAACAGAGTGGGCAAGG + Intergenic
909816977 1:80006789-80006811 AAGGGGAGACAGAGGGGGCGGGG - Intergenic
909823463 1:80095921-80095943 CAGGAGAGAGAGAGAGTGCAGGG + Intergenic
910336766 1:86141774-86141796 CCCAGGAGACAGAGGTTGCAGGG - Intronic
910368692 1:86493302-86493324 CTGGGGAGACAGGGGCAGAAGGG + Intronic
910568508 1:88674581-88674603 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
910572794 1:88724645-88724667 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
910602521 1:89047389-89047411 CTGCAGAGGCAGAGGTTGCAGGG - Intergenic
910628892 1:89337074-89337096 CTGTGGATTCAGAGGGTGGAAGG + Intergenic
910731145 1:90398766-90398788 CAGGAGAGAGAGAGGGAGCAAGG + Intergenic
910836954 1:91523619-91523641 CTGGGCACACAAGGGGTGCAGGG + Intronic
911597073 1:99810038-99810060 CTTGGGAGATAGAGGCTACAGGG - Intergenic
911752783 1:101516877-101516899 CAGGGGAGAGAGAGAGTGAAGGG + Intergenic
912220767 1:107672191-107672213 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
912386142 1:109272201-109272223 CTGGGAAGAAGGAGGGTGGAGGG - Intronic
912449354 1:109759796-109759818 CAGGGGAGTCAGAGAGTCCAGGG - Exonic
912544827 1:110443130-110443152 CTGGGGATACAGAGGATCCTTGG + Intergenic
912567329 1:110597469-110597491 ATGGGGAGACAGAGGGAGAGGGG + Intronic
912818921 1:112851257-112851279 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
912886958 1:113484798-113484820 CCCGGGACACAGAGGTTGCAGGG - Intronic
913053252 1:115135022-115135044 GTGGGGAGACCGAGGGATCAGGG + Intergenic
913255639 1:116950695-116950717 CAGTGGAGACAGAGGGGGCAGGG + Intronic
913466007 1:119143399-119143421 CCAGGGAGACAGAGGTTGCAGGG + Intergenic
914452294 1:147803195-147803217 TTGGGGAGACACAGAGTGAATGG + Intergenic
914726756 1:150334435-150334457 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
914893330 1:151648128-151648150 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
915174190 1:154001271-154001293 CCCGGGAGGCAGAGGTTGCAGGG - Intronic
915480756 1:156183207-156183229 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
915575603 1:156774592-156774614 CTGCGGAGACTGAGGCAGCAGGG - Intronic
915615686 1:157036395-157036417 CCCGGGAGACAGAGGTTGCAGGG - Intronic
916246845 1:162696797-162696819 CTGGGCAGACAGCGGGGGCAGGG - Intronic
916413623 1:164572585-164572607 CTAGTGTGACAGAGGGAGCATGG + Intronic
916841950 1:168609862-168609884 CTGAGGAGACAGAGGGGGGAGGG + Intergenic
917372149 1:174305458-174305480 CCCGGGAGGCAGAGGTTGCAGGG - Intronic
918215575 1:182390479-182390501 CTGGGGTGAGTGAGGGGGCAGGG - Exonic
918532604 1:185539695-185539717 CAGGAGAGACAGAGAGTGAAGGG - Intergenic
919153075 1:193724769-193724791 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
919451339 1:197775600-197775622 CCGGGCGGCCAGAGGGTGCAGGG + Intronic
919573857 1:199281998-199282020 CTGGGGAGGTTGAGGCTGCAGGG + Intergenic
919798606 1:201337067-201337089 ATGGGGAGACAGAGGCAGCCCGG + Intergenic
919819140 1:201462013-201462035 GTGGGGAGACCGAGGGAGAAGGG - Intergenic
919937058 1:202260407-202260429 CCCGGGAGGCAGAGGCTGCAGGG - Intronic
920006369 1:202836469-202836491 ATGGGGTGAAAGAGGGTGCCAGG - Intergenic
920234080 1:204491311-204491333 CCTGGGAGACGGAGGTTGCAGGG + Intronic
920288643 1:204900662-204900684 CAGGGGAGACAGGGAGTGCTGGG + Intronic
920841891 1:209562144-209562166 CTGGAAACACAGGGGGTGCAGGG + Intergenic
921163954 1:212492743-212492765 CCCGGGAGGCAGAGGTTGCAGGG - Intergenic
922081350 1:222300278-222300300 CAGGAGAGACAGAGAGTGAAGGG + Intergenic
922183470 1:223254410-223254432 CAGGAGAGACAGAGGGTTAATGG + Intronic
922204187 1:223432244-223432266 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
922228009 1:223662371-223662393 CTGGGGAGGCAGAGGTTGCAGGG + Intronic
922916680 1:229263713-229263735 CCCGGGAGACAGAGTTTGCAGGG - Intergenic
923301729 1:232647594-232647616 CACGGGAGACGGAGGTTGCAGGG - Intergenic
923463820 1:234231291-234231313 CCGGGGAGATAGCGGGTGCAGGG - Intronic
923653361 1:235894471-235894493 CCAGGGAGGCAGAGGTTGCATGG - Intergenic
923677230 1:236090477-236090499 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
924300358 1:242631850-242631872 CCTGGGGGACAGAGGTTGCAGGG - Intergenic
924600199 1:245482165-245482187 CTCAGGAGGCAGAGGTTGCAGGG - Intronic
1062772505 10:114029-114051 CCTGGGAGGCAGAGGTTGCAAGG + Intergenic
1063989260 10:11542641-11542663 CCCGGGAGACAGAGTTTGCAAGG + Intronic
1064002818 10:11677661-11677683 CCGGGGAGGCGGAGGCTGCAGGG + Intergenic
1064219776 10:13430939-13430961 CAGGGGAGACAGAGGCGCCAAGG - Intergenic
1064256420 10:13746284-13746306 CTTGGGAGTCGGAGGTTGCAGGG - Intronic
1064739795 10:18421371-18421393 ATTGGGAGGCAGAGGTTGCAGGG - Intronic
1064764498 10:18657687-18657709 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1064855677 10:19765342-19765364 CCCGGGAGGCAGAGGTTGCAGGG - Intronic
1064906623 10:20353505-20353527 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1064965099 10:21007198-21007220 CTGTGGGGAGAGAGGGTGAATGG - Intronic
1064989901 10:21247047-21247069 CAGGGGAGAGAGAGAGTGAAGGG - Intergenic
1065034105 10:21620764-21620786 CCTGGGAGACGGAGGTTGCAGGG - Intronic
1065204064 10:23341733-23341755 CTGGGTAGAAAGATGGTGCCTGG - Intronic
1065212556 10:23418154-23418176 CTTGGGAGGCAGAGGTTGCAGGG + Intergenic
1065387253 10:25146112-25146134 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1065695301 10:28374272-28374294 CTGGGCAAAGAGAGGGTGGATGG - Intergenic
1065857984 10:29845892-29845914 CTGGGGAGGCAGAGGCAGGAGGG - Intergenic
1065970387 10:30801312-30801334 CCCGGGAGGCAGAGGTTGCAGGG - Intergenic
1066084374 10:31962243-31962265 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1067097574 10:43312544-43312566 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1067104043 10:43353276-43353298 TTGGGCAGACTGGGGGTGCATGG - Intergenic
1067132469 10:43577030-43577052 CTGGAGAGAAATAGGGTGCAAGG - Intergenic
1067147726 10:43705840-43705862 CCCGGGAGGCAGAGGTTGCAGGG - Intergenic
1067419367 10:46133478-46133500 CTGGGGGGACACAGGGCACAAGG - Intergenic
1067504718 10:46840075-46840097 CTGGGGGGACACAGGGCACAAGG - Intergenic
1067556377 10:47276224-47276246 CTGGGGAGACTGAGGAGACACGG - Intergenic
1067563080 10:47317553-47317575 CTTGGAACACAGAGGTTGCATGG + Intergenic
1067616553 10:47762220-47762242 GTGGGGAGGAAGAGGGGGCAAGG + Intergenic
1068009168 10:51426203-51426225 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1068307148 10:55226455-55226477 CCCAGGAGACAGAGGTTGCAGGG - Intronic
1068595197 10:58895674-58895696 CTGGAGAGACAGAGGTGGCCAGG + Intergenic
1069294701 10:66829535-66829557 CCCGGGAGGCAGAGGTTGCAGGG + Intronic
1069425717 10:68287051-68287073 CTTGGGAGATAGAGGTTGCAGGG + Intronic
1069477816 10:68751101-68751123 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1069547800 10:69341235-69341257 CTGGGGAAGCAGAGGTTGCAGGG - Intronic
1069601290 10:69709821-69709843 CTGGGCAGACAGAGGGCTCCCGG + Intergenic
1070004454 10:72409613-72409635 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1070027730 10:72648220-72648242 CCCGGGAGGCAGAGGTTGCAAGG + Intergenic
1070055130 10:72927213-72927235 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1070233439 10:74596619-74596641 CCTGGGAGACAGAGGTTTCAGGG - Intronic
1070378547 10:75858173-75858195 CTGAGTAGACAGAGGGGCCAGGG - Intronic
1070461408 10:76674102-76674124 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1070660252 10:78300585-78300607 CTGGGGAAACAGAAAGTGAAGGG - Intergenic
1071341416 10:84652194-84652216 CTGGTTAGACAGTGGGTACAAGG - Intergenic
1071341687 10:84654680-84654702 CTGGGGACATAGAGGGTAAAAGG - Intergenic
1071606728 10:86998822-86998844 CCTGCGAGGCAGAGGGTGCAGGG + Intergenic
1072059372 10:91794697-91794719 CCCGGGAGGCAGAGGTTGCAGGG + Intergenic
1072125196 10:92439384-92439406 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1072400919 10:95099160-95099182 ACGGGGAGGCAGAGGTTGCAGGG - Intergenic
1072569008 10:96642348-96642370 CTGGGGAGGCAGTGGTTACAGGG + Intronic
1072732966 10:97860426-97860448 GCTGGGAGACAGAGGCTGCAGGG - Intronic
1072741546 10:97912927-97912949 CTGCTGATGCAGAGGGTGCAGGG - Intronic
1072838236 10:98740281-98740303 CTTGGGAGACTGAGGCTGGAGGG - Intronic
1072907788 10:99471073-99471095 CTGGGGAGACCAAGGCTGCTAGG + Intergenic
1072917691 10:99549484-99549506 CTCGGGAGACTGAGGGTGGGAGG - Intergenic
1073077562 10:100834014-100834036 AAGGAGAGACAGTGGGTGCAGGG + Intergenic
1073148025 10:101293023-101293045 CTGGAGAGACACAGGGTGGGTGG - Intergenic
1073202499 10:101747250-101747272 GTGTAGAGACAGAGGTTGCAGGG + Intergenic
1073321581 10:102619333-102619355 CTGGGGAGCCAGCGGGTGCTGGG - Intronic
1073630289 10:105141397-105141419 GTGGGGACAGAGAGGGTGGAGGG + Intronic
1073701032 10:105926626-105926648 CCCGGGAGGCAGAGGCTGCAGGG + Intergenic
1073741918 10:106417076-106417098 CAGGAGAGACAGAGTGTGAAGGG + Intergenic
1074370978 10:112900646-112900668 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1074578208 10:114690755-114690777 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1074581861 10:114726703-114726725 ACTGGGAGACAGAGGTTGCAGGG + Intergenic
1074642605 10:115404401-115404423 ATGAGGAAACAGAGGGTGTATGG - Intronic
1075076303 10:119352935-119352957 CAGGGGAGAGAGAGGGAGGACGG - Intronic
1075168153 10:120087847-120087869 CCCAGGAGACAGAGGTTGCAGGG + Intergenic
1075208875 10:120473764-120473786 CAGGGGAGAGAGAGAGTGAAGGG - Intronic
1075667671 10:124242674-124242696 CAGGGGAAACAGAGGGGGAAGGG + Intergenic
1075767708 10:124907473-124907495 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1075874611 10:125796037-125796059 GTGGGGAAGCAGAGGGTGAAGGG - Intronic
1075964508 10:126599546-126599568 ATCGGAAGACAGAGGCTGCATGG + Intronic
1076061025 10:127413985-127414007 CTCGGGAGGCGGAGGTTGCAGGG - Intronic
1076094666 10:127721224-127721246 CTGGGGTGGCAGAGGCTACAGGG + Intergenic
1076182406 10:128420520-128420542 CAGGAGAGAGAGAGGGCGCAGGG + Intergenic
1076608229 10:131703115-131703137 CTGGGATGACACAGGGTTCAGGG + Intergenic
1076764872 10:132627541-132627563 CTGGGGACACAGAGGGAGTCGGG - Intronic
1076883623 10:133251614-133251636 CTGGGGAGCCACAGGGAGCTCGG - Intergenic
1077019102 11:409654-409676 CTGGGGCAGGAGAGGGTGCAGGG + Intronic
1077020242 11:414066-414088 GTGGGGAGGGAGAGGGTGCAGGG - Intronic
1077066891 11:645085-645107 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1077155486 11:1089148-1089170 CTGGGGAGGCAGAGGGAGGCCGG - Intergenic
1077180833 11:1214446-1214468 CAGGGGAGAGAGTGTGTGCAGGG + Intergenic
1077462064 11:2715626-2715648 CTGGGGAGTCACAGGTTCCAAGG - Intronic
1077735119 11:4782831-4782853 CTGTGGCTTCAGAGGGTGCAAGG + Intronic
1078084415 11:8225100-8225122 GTGGGGAGACAGATGGAGAAAGG + Intronic
1078101857 11:8334699-8334721 CAGGGAAGACAGAGGGTACAGGG - Intergenic
1078201093 11:9183973-9183995 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1078282515 11:9917405-9917427 CTCGGGAGGCGGAGGTTGCAGGG - Intronic
1078328348 11:10398417-10398439 CAGGGAGGCCAGAGGGTGCATGG + Intronic
1078620275 11:12900882-12900904 CTGGGGATGCAGAGGCTCCATGG - Intronic
1078714740 11:13829104-13829126 GTGGGGAGACAGAGGGAGAAGGG - Intergenic
1079165944 11:18043527-18043549 CTCAGGAGGCAGAGGTTGCAGGG + Intergenic
1079601377 11:22316158-22316180 CAGGGGAGACAGAGGCAGGAGGG - Intergenic
1079759575 11:24311289-24311311 CAGGAGAGACAGACAGTGCAGGG - Intergenic
1079929260 11:26537579-26537601 ATGGGGAGACAGAAGGCCCATGG - Intronic
1080181455 11:29431175-29431197 TTTGGGAGGCAGAGGGAGCAAGG - Intergenic
1080281736 11:30565101-30565123 CAGGGGAGACACAGGCTGCACGG - Intronic
1080383354 11:31796467-31796489 CTGGGGGGATGGAGGGTGGATGG + Intronic
1080954735 11:37080097-37080119 CTGGGGCGGCAGAGAGGGCAAGG + Intergenic
1081045306 11:38266865-38266887 CAGGAGAGAGAGAGGATGCAGGG - Intergenic
1081668833 11:44932156-44932178 CTGGGGAGACGGCGGGTGCTGGG - Exonic
1081825644 11:46048692-46048714 CCCGGGAGGCAGAGGCTGCAGGG + Intronic
1081947435 11:47009719-47009741 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1081993674 11:47350663-47350685 CTCAGGAGAGAGAGGGTGGAGGG - Intronic
1082019058 11:47515990-47516012 CCCGGGAGGCAGAGGTTGCAGGG - Intronic
1083658882 11:64242994-64243016 CCCGGGAGGCAGAGGCTGCAGGG + Intronic
1083852990 11:65378718-65378740 CTGGGGTGTCAGTGGGTGCCGGG + Intronic
1083946865 11:65928496-65928518 CTGGGGAGACTGAGGCAGAAAGG - Intergenic
1084109480 11:67004336-67004358 CGGGCGAGGCATAGGGTGCAAGG + Intergenic
1084222138 11:67688866-67688888 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1084462021 11:69301596-69301618 ATGGTGGGAAAGAGGGTGCATGG - Intronic
1084495430 11:69500637-69500659 CTGGCCAGACAGCAGGTGCAGGG + Intergenic
1084539960 11:69780031-69780053 GTGTGGGGACAGAGGGTGTAAGG - Intergenic
1084909030 11:72372805-72372827 CTGGGCACACAGTGGGTGCTGGG + Intronic
1084943162 11:72625170-72625192 GTGGGGAGGCAGAGGGCCCAGGG - Intronic
1084985407 11:72866343-72866365 CCCGGGAGGCAGAGGTTGCAGGG - Intronic
1085047099 11:73359974-73359996 CTGGGGAGCCAGAGGGTGGGAGG + Intronic
1085080173 11:73627492-73627514 CCCGGGAGGCAGAGGTTGCAGGG - Intergenic
1085306824 11:75490993-75491015 CTAGGGACACTGAGGCTGCAAGG + Intronic
1085359350 11:75872462-75872484 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1085521860 11:77143790-77143812 GTCAGGAGAAAGAGGGTGCAGGG + Intronic
1085998803 11:81954296-81954318 GTTGGGAGACAGAGGCTGGATGG - Intergenic
1086162081 11:83733163-83733185 CTTGGGAGGCAGAGGTTGCAGGG + Intronic
1086476296 11:87178499-87178521 CCTGGGAGGCAGAGGCTGCAGGG - Intronic
1087576524 11:99996793-99996815 CAGGAGAGAGAGAGGGAGCATGG + Intronic
1087940156 11:104087099-104087121 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1087987994 11:104708936-104708958 CTGGGGGGACAATGGCTGCAGGG - Intergenic
1088074198 11:105826199-105826221 GTGGGGAGAGAGAGGTTGCAGGG + Intronic
1088303565 11:108384695-108384717 CCTGGGAGGCAGAGGCTGCAGGG + Intronic
1088436440 11:109818298-109818320 CCCGGGAGGCAGAGGTTGCAGGG + Intergenic
1088932872 11:114369783-114369805 CTTGGGAGCCAGAAGTTGCAGGG - Intergenic
1088935057 11:114391094-114391116 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1089005905 11:115090613-115090635 CTGAGGACACAGCGGGTCCAGGG + Intergenic
1089304338 11:117517317-117517339 CTGGGGAGAGAGAGTGTCCTGGG + Intronic
1089431986 11:118432903-118432925 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1089517648 11:119043965-119043987 CTTGGGAGACTGAGGCTGGAGGG - Intergenic
1089986964 11:122824004-122824026 CTTGGGAGGCGGAGGTTGCAGGG - Intergenic
1090079648 11:123603418-123603440 CTTGGGACACAGAGGCTTCAGGG - Exonic
1090343893 11:126051721-126051743 CTCGGGAGGCAGAGGTTGCAGGG - Intronic
1090375416 11:126284776-126284798 CGTGGGAGGCAGAGGTTGCAGGG + Intronic
1090418211 11:126555568-126555590 CAGGGTAGACACAGGGAGCAGGG + Intronic
1090459703 11:126879812-126879834 CTCTGGAGACAGAAGGTTCAGGG - Intronic
1090574668 11:128087799-128087821 CTCAGGAGGCAGAGGTTGCAGGG + Intergenic
1090675064 11:128984297-128984319 CCTGGGAGGCAGAGGCTGCAGGG + Intronic
1090803094 11:130186728-130186750 ATGGGGAGAGAAAGGGTGGAAGG + Intronic
1090864944 11:130691408-130691430 GTGGAGAGAGAGAGGGAGCAAGG - Intronic
1091076999 11:132628659-132628681 CTGGGGACACAGGTGGTGTAAGG - Intronic
1091601843 12:1922541-1922563 CGGGGGAGGCAGAGGGTGAGTGG - Intergenic
1091816330 12:3441526-3441548 CTGGGGAGACACAGGGTATGAGG - Intronic
1091898302 12:4122409-4122431 CCCGGGAGACGGAGGTTGCAGGG - Intergenic
1091898744 12:4125205-4125227 CGTGGGAGGCAGAGGCTGCAGGG + Intergenic
1092079903 12:5707197-5707219 CAGGAGAGAGAGAGAGTGCAGGG - Intronic
1092268895 12:7006292-7006314 CCTGGAAGACAGAGGTTGCAGGG - Intronic
1092340806 12:7674203-7674225 CTGGGGGGGCTGAGGTTGCAGGG - Intergenic
1092748261 12:11693720-11693742 CTGGGGACAGAGATAGTGCAGGG - Intronic
1093107327 12:15104360-15104382 CCTGGGAGGCAGAGGCTGCAGGG - Intergenic
1093166212 12:15806812-15806834 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1093180955 12:15966386-15966408 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1093919925 12:24848497-24848519 CTGGGGACACAGAAATTGCAGGG - Intronic
1094063498 12:26340087-26340109 GAGGGGAGACAGAGGGTCCAGGG - Intronic
1094110796 12:26860155-26860177 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1094131255 12:27078404-27078426 CCCAGGAGACAGAGGTTGCAGGG - Intergenic
1094174786 12:27530287-27530309 CTGGGAAGTGAGAGGGTGGAAGG + Intronic
1094349734 12:29510892-29510914 CTAGGGTCAGAGAGGGTGCAGGG - Intronic
1094554345 12:31483514-31483536 CTTGCGAGGCAGAGGTTGCAGGG - Intronic
1095311320 12:40700448-40700470 CCCGGGAGGCAGAGGTTGCAGGG + Intronic
1095487863 12:42703231-42703253 CTGGGGAGGCTGAGGGAACAAGG + Intergenic
1095625329 12:44307642-44307664 GCGGGGAGACAGAGTGTTCAGGG + Intronic
1095816606 12:46429418-46429440 AGGGAGAGACAGAGGGAGCAAGG + Intergenic
1096236713 12:49933391-49933413 CTCGGGGGGCAGAGGTTGCAGGG - Intergenic
1096274119 12:50191031-50191053 CTCAGGAGATAGAGGCTGCAGGG + Intronic
1096333912 12:50738557-50738579 CTGGGGAGATGGAGGTTGCAGGG - Intronic
1096787286 12:54024463-54024485 CTGGGGAGAGAGAGGAGACAGGG + Intronic
1096966135 12:55629561-55629583 ATCGGGAGACAGAGGGAGCAAGG + Intergenic
1097078120 12:56410173-56410195 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1097121505 12:56736577-56736599 CCCGGGAGGCAGAGGTTGCAGGG - Intronic
1097173713 12:57130851-57130873 CTGGAGATACAGAGGGGGCGTGG - Intronic
1097251556 12:57635607-57635629 CTTGGGAGGCAAAGGTTGCAGGG + Intergenic
1097336992 12:58394577-58394599 CTTGGGAGGCTGAGGGTCCATGG + Intergenic
1098196160 12:68004320-68004342 CTGGGGAGAGAGAGGAAGCTGGG - Intergenic
1098328364 12:69326024-69326046 CTGGGGAGGCAGAGGTTGCAGGG + Intergenic
1098407711 12:70143189-70143211 CAGGAGAGACAGAGTGCGCAGGG - Intergenic
1098521008 12:71435628-71435650 CAGGAGAGAGAGAGGGTGAATGG + Intronic
1098715313 12:73822428-73822450 CAGGAGAGAGAGAGAGTGCAGGG + Intergenic
1098771725 12:74560778-74560800 CAGGGAAAACAGAGTGTGCAGGG + Intergenic
1098780070 12:74676195-74676217 CTGGTTAGACAGTGGGTGCAGGG + Intergenic
1098968752 12:76825464-76825486 CTCAGGAGACAGAGAGTGTATGG - Intronic
1099914471 12:88874844-88874866 CAGGGGAGACAGAGCGTGTGGGG + Intergenic
1100263680 12:92955705-92955727 CCTGGGAGACATAGGTTGCAGGG + Intergenic
1100474921 12:94926491-94926513 CCCGGGAGGCAGAGGTTGCAGGG - Intronic
1100714549 12:97292117-97292139 CTGGAGAGACACAGTTTGCATGG + Intergenic
1101330423 12:103753376-103753398 CTGTGCAGACAGAGTCTGCAGGG + Intronic
1101507893 12:105363647-105363669 CCAGGGAGTCAGAGGTTGCAGGG + Intronic
1101594216 12:106149441-106149463 CTGGGGAGACCCAGGAGGCATGG + Intergenic
1101728636 12:107408464-107408486 CTGGGAAGACAGTAGGGGCAGGG + Intronic
1101892047 12:108725909-108725931 CCTGGGAGGCAGAGGCTGCAGGG - Intronic
1102034281 12:109761954-109761976 CTGGGGAAGCAGTTGGTGCAGGG - Intronic
1102067422 12:109988775-109988797 CCCGGGAGGCAGAGGCTGCAGGG + Intronic
1102086409 12:110144584-110144606 CCCGGGAGGCAGAGGTTGCAGGG - Intronic
1102179367 12:110900673-110900695 CCAGGGAGTCAGAGGTTGCAGGG - Intronic
1102243002 12:111337097-111337119 CCCAGGAGACAGAGGTTGCAAGG + Intronic
1102243122 12:111337957-111337979 CCTGGGAGGCAGAGGCTGCAGGG + Intronic
1102281631 12:111623196-111623218 CCTGGGAAACAGAGGCTGCAGGG - Intergenic
1102500617 12:113349739-113349761 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1102934716 12:116886746-116886768 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1103014478 12:117483024-117483046 CTGGGGAGTCAGAGGGAAGAAGG + Intronic
1103037381 12:117667415-117667437 CTGGGGAGAAGGAGGTGGCATGG + Intronic
1103081402 12:118026866-118026888 CTGTGTAGACAGAGGGGGAAAGG - Intronic
1103112639 12:118294489-118294511 CTAGGGAGACTGAGGCTGGAGGG - Intronic
1103443203 12:120978642-120978664 TTGGGGGGGCAGTGGGTGCAAGG + Exonic
1103448926 12:121014254-121014276 CTTGGGAGGCGGAGGTTGCAGGG + Intronic
1103610908 12:122123805-122123827 CTGGGGAGACTGAGGCAGGAAGG - Intronic
1103783629 12:123415927-123415949 GTGGAGAGAGAGAGGGTTCAGGG + Intronic
1103905686 12:124326266-124326288 CTGAGGAGACAGAGGGTGGCCGG + Exonic
1104087990 12:125493427-125493449 GAGTGGAGACAGAGGATGCAGGG + Intronic
1104117146 12:125760508-125760530 CCCGGGAGGCAGAGGTTGCAGGG + Intergenic
1104396066 12:128434374-128434396 CCCGGGAGGCAGAGGTTGCAGGG - Intronic
1104555192 12:129793445-129793467 CTGGGGAGGTTGAGGCTGCAAGG - Intronic
1104569050 12:129909189-129909211 CGCAGGAGACAGAGGATGCAGGG + Intergenic
1104589238 12:130070988-130071010 CACGGGAGGCAGAGGTTGCAGGG - Intergenic
1104616437 12:130273694-130273716 CTGTGGATACAGAGGGTACATGG - Intergenic
1104807903 12:131601128-131601150 CAGGGAAGACAGTGTGTGCAGGG + Intergenic
1104856132 12:131903296-131903318 CCGGGGACACAGAGGGTGACTGG + Intronic
1104951799 12:132444470-132444492 CAGGGGAGACAGAGGGCTCCGGG - Intergenic
1105073834 12:133257151-133257173 CTGGGGAGGTTGAGGCTGCAGGG + Intergenic
1105372579 13:19814722-19814744 CCCGGGAGGCAGAGGTTGCAGGG + Intergenic
1105515575 13:21087342-21087364 CTCGGCAGGCAGAGGTTGCAGGG - Intergenic
1105607665 13:21940133-21940155 TTGGGGATACAGAGGGGGCATGG + Intergenic
1105805562 13:23950009-23950031 CTGGGCAGCCAGGGGGTGCCAGG + Intergenic
1106040859 13:26091488-26091510 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1106124474 13:26889087-26889109 CTGGGAAGACAGAGGTTGCAGGG + Intergenic
1106154135 13:27136420-27136442 CCGGGGAGGCGGAGGTTGCAGGG + Intronic
1106215965 13:27699769-27699791 CCCGGGAGGCAGAGGTTGCAGGG - Intergenic
1106270366 13:28146897-28146919 CCCGGGAGGCAGAGGTTGCAGGG + Intronic
1106761663 13:32874051-32874073 CCCGGGAGGCAGAGGTTGCAGGG + Intergenic
1107466908 13:40659237-40659259 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1107485838 13:40826873-40826895 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1107697853 13:43018261-43018283 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1107887198 13:44883387-44883409 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1107930546 13:45303753-45303775 CCAGGGAGGCAGAGGTTGCAGGG - Intergenic
1107939554 13:45371794-45371816 CCTGGGAGGCAGAGGCTGCAGGG + Intergenic
1108638690 13:52361689-52361711 CCCGGGAGGCAGAGGTTGCAGGG - Intergenic
1108770838 13:53698989-53699011 CAGGAGAGAGAGAGCGTGCAGGG - Intergenic
1109781948 13:67122696-67122718 CTCGGGAGGCAGAGGTTGCAGGG + Intronic
1110906402 13:80896322-80896344 CCAGGGAGGCAGAGGTTGCAGGG - Intergenic
1111394437 13:87646739-87646761 CAGGGAAGACAGTGGGTGAAGGG + Intergenic
1111731300 13:92080206-92080228 CTGTGGAGAACGATGGTGCAGGG - Intronic
1111880771 13:93954388-93954410 CCTGGAAGACAGAGGTTGCATGG - Intronic
1112150978 13:96763413-96763435 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1112253827 13:97809135-97809157 GGGGGGAGACAGTGGGGGCAGGG + Intergenic
1112344900 13:98581091-98581113 CCTGGGAGACAGCGGTTGCAGGG - Intergenic
1112497314 13:99915416-99915438 CTCGGAAGGCAGAGGTTGCAGGG - Intergenic
1112639222 13:101254295-101254317 CTTGGGAGGCAGAGGTTGCAGGG + Intronic
1113035791 13:106047346-106047368 CAGGTGAGAGAGAGAGTGCAGGG - Intergenic
1113141612 13:107158347-107158369 CTCAGGAGGCAGAGGTTGCAGGG + Intergenic
1113153306 13:107288605-107288627 CTGAGGAGGCGGAGGTTGCAGGG - Intronic
1113365733 13:109674125-109674147 CAGGAGAGAGAGAGCGTGCAGGG - Intergenic
1113439331 13:110315469-110315491 CTCAGGAGGCAGAGGTTGCAGGG - Intronic
1114518180 14:23314287-23314309 CCCGGGAGACGGAGGTTGCAGGG + Intronic
1114641093 14:24221671-24221693 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1114994481 14:28331043-28331065 CCCGGGAGGCAGAGGTTGCAGGG + Intergenic
1115176595 14:30569179-30569201 CTGGGGAGAGAGAAGGGGTAGGG - Intronic
1115555007 14:34538533-34538555 ATGGGGAGACATTGGATGCATGG - Intronic
1115598629 14:34934064-34934086 CTCAGGAGGCAGAGGTTGCAGGG + Intergenic
1116038258 14:39655514-39655536 AAGAGGAGACAGAGTGTGCAAGG + Intergenic
1116693126 14:48135946-48135968 CCTGGGAGTCAGAGGTTGCAGGG + Intergenic
1116931701 14:50697200-50697222 CCCGGGAGGCAGAGGTTGCAGGG - Intergenic
1116998117 14:51345594-51345616 CAGGAGAGACAGAGAGTGAAGGG - Intergenic
1117054903 14:51901737-51901759 TTGGGGAGAATGGGGGTGCAGGG + Intronic
1117302779 14:54444931-54444953 CTCGGGAGAGAGAGTTTGCAGGG + Intergenic
1117418887 14:55524041-55524063 CCCGGGAGGCAGAGGTTGCAGGG + Intergenic
1117764035 14:59061352-59061374 GTGGGGAGACAGAGTGGGTAAGG - Intergenic
1118198253 14:63648327-63648349 CAGAGGAGCCAGAGGTTGCATGG + Intergenic
1118208401 14:63744596-63744618 CTCAGGAGGCAGAGGTTGCAGGG + Intergenic
1118211850 14:63772665-63772687 CCCGGGAGACAGAGGTTTCAGGG + Intergenic
1118528107 14:66668954-66668976 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1118634746 14:67737420-67737442 CAGGAGAGAGAGAGAGTGCAGGG + Intronic
1119504897 14:75164139-75164161 CCCGGGAGTCAGAGGTTGCAGGG - Intronic
1119556360 14:75556330-75556352 GCTGGGGGACAGAGGGTGCAAGG - Intergenic
1119662095 14:76459410-76459432 CTGGAGAAACAGAGGGTGGAGGG + Intronic
1119738701 14:77000126-77000148 CTGGGGAGACCAATGGGGCAGGG - Intergenic
1120024662 14:79569682-79569704 CCCGGGAGACGGAGGTTGCAGGG - Intronic
1120046115 14:79808159-79808181 CCCGGGAGGCAGAGGTTGCAGGG + Intronic
1120134958 14:80856804-80856826 CTCGGGAGGCAGAGGTTGTAGGG - Intronic
1120150050 14:81022743-81022765 CCCGGGAGGCAGAGGTTGCAGGG + Intronic
1120810784 14:88801278-88801300 CCCGGGAGGCAGAGGTTGCAGGG + Intergenic
1120920757 14:89753666-89753688 CTGGGGAGGTTGAGGCTGCAGGG - Intergenic
1121027832 14:90629589-90629611 CTGGGGAGCCAGAGGTTTCCAGG + Intronic
1121141296 14:91544973-91544995 CCCAGGAGGCAGAGGGTGCAGGG - Intergenic
1121583110 14:95045335-95045357 CTGGGGAGACAGTGTGAACAAGG - Intergenic
1121599954 14:95195954-95195976 CTTGGGAGAAGGAGGGAGCAGGG - Intronic
1121624176 14:95372455-95372477 CTTGGGAGGCAGAGGTTGCAGGG - Intergenic
1121734688 14:96209918-96209940 CTCAGGAGGCAGAGGTTGCAGGG + Intronic
1122121106 14:99553917-99553939 CTTGGGGGACAGAGGGTCCAGGG + Intronic
1122127294 14:99586237-99586259 CTTGGGAGACAGATGGGGCCTGG - Intronic
1122217338 14:100212997-100213019 TTGGGGTGGCAGAGGGGGCAGGG + Intergenic
1122272991 14:100576655-100576677 CAGGGGACACAGATGGTACAGGG + Intronic
1122278938 14:100610054-100610076 GTGGGGAGGCTGAGGGTGCGTGG - Intergenic
1122483247 14:102061247-102061269 CTCGGGAGGCGGAGGTTGCAGGG + Intergenic
1122568947 14:102680727-102680749 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1122657539 14:103272398-103272420 GAGGGGAGGCAGAGGTTGCAAGG + Intergenic
1122706109 14:103623021-103623043 CCTGGGAGACAGAGGTTGCAGGG - Intronic
1122710673 14:103655149-103655171 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1123686440 15:22800996-22801018 CTCGGGAGGCTGAGGTTGCAGGG + Intronic
1124059622 15:26277941-26277963 CCCGGGAGGCAGAGGTTGCAGGG - Intergenic
1124083264 15:26520443-26520465 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1124139404 15:27064122-27064144 GTGGGGTGGCAGAGAGTGCAGGG + Intronic
1124391090 15:29258135-29258157 CTCGGGAGATGGAGGTTGCAGGG + Intronic
1124930241 15:34112665-34112687 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1125447850 15:39776999-39777021 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1125564358 15:40664755-40664777 CCCGGGAGACAGAGGTTGCAGGG + Intergenic
1125595345 15:40881867-40881889 CTCAGGAGGCAGAGGTTGCAGGG - Intergenic
1125703160 15:41706654-41706676 CCTGGGAGACAGAGATTGCAAGG - Intronic
1125869926 15:43091012-43091034 CCCGGGAGGCAGAGGTTGCATGG - Intronic
1125925295 15:43558301-43558323 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1125976461 15:43957269-43957291 CTTGGGAGGTAGAGGTTGCAGGG - Intronic
1126034065 15:44531228-44531250 CCCGGGAGGCAGAGGTTGCAGGG - Intergenic
1126186052 15:45831318-45831340 ACGGGGAGGCAGAGTGTGCAGGG + Intergenic
1126353970 15:47775422-47775444 CCCGGGATACAGAGGTTGCAGGG - Intergenic
1126354132 15:47776795-47776817 TTGGGGGGATGGAGGGTGCAAGG + Intergenic
1126625262 15:50680156-50680178 CCCGGGAGGCAGAGGCTGCAGGG + Intronic
1126694815 15:51317000-51317022 GTGGCAAGACAGAGGGAGCATGG + Intronic
1127216691 15:56830742-56830764 CTGGGGAGATTGAGGCTGCAGGG + Intronic
1127246149 15:57177343-57177365 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1127346531 15:58106609-58106631 CTTGGGAGGCTGAGGTTGCATGG + Intronic
1127386076 15:58468253-58468275 CTGGGGAAGCAGAGAGAGCAAGG - Intronic
1127436711 15:58964984-58965006 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1127500439 15:59549537-59549559 CTGGTGAGACAGGAGGTGAAAGG + Intergenic
1127672859 15:61212473-61212495 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1127962439 15:63899745-63899767 CTTGGGAGGTAGAGGTTGCAGGG - Intergenic
1128273297 15:66331077-66331099 CCCGGGAGGCAGAGGTTGCAGGG + Intronic
1128349543 15:66879891-66879913 CTGGGGAGCCAGAGGGAGATGGG - Intergenic
1129147583 15:73662904-73662926 CTGGGGCTTCAGAGGTTGCAGGG - Intergenic
1129462415 15:75706225-75706247 CTGGGGAGACAGAGGGGGCTGGG - Intronic
1129722441 15:77885206-77885228 CTGGGGAGTCAGAGGGGGCTGGG + Intergenic
1130063571 15:80586983-80587005 CTGGGGAGGAAGAGGGTGCATGG - Intronic
1130148256 15:81292028-81292050 CAGGGTAGACAGAGGGAGGACGG + Intronic
1130165687 15:81455623-81455645 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1130222653 15:82033651-82033673 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1130348640 15:83070906-83070928 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1131168940 15:90162867-90162889 CTGGGGAGATAAAGGGAGAAAGG - Intronic
1131198280 15:90374655-90374677 CTGGGGAGGTCGAGGCTGCAGGG - Intergenic
1131219419 15:90569393-90569415 CCAGGGAGGCAGAGGCTGCAGGG - Intronic
1131693015 15:94846474-94846496 CTTTGGGGACAGAGGATGCACGG + Intergenic
1131892336 15:96985470-96985492 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1132052997 15:98625904-98625926 CCCGGGAGGCAGAGGTTGCAGGG + Intergenic
1132094214 15:98970122-98970144 CCCGGGAGGCAGAGGTTGCAGGG - Intronic
1132154371 15:99485403-99485425 CTGGGGACTCAGAGTGTCCATGG + Intergenic
1132665918 16:1081270-1081292 CTGGGCAGACGGCGGGAGCACGG - Intergenic
1132738704 16:1400025-1400047 CAGGGGAGGCTGAGGGGGCAGGG + Intronic
1132826471 16:1907900-1907922 CTGTGGAGAGGGTGGGTGCAGGG + Intergenic
1133002993 16:2860465-2860487 CTGGGGAAACAGTGTGGGCAGGG + Intergenic
1133081540 16:3325055-3325077 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1133235865 16:4387180-4387202 CTGGGGAGACTGAGGCTGGGGGG - Intronic
1133266568 16:4588144-4588166 CTAGGGAGACAGGGAGTTCAGGG - Intronic
1133302570 16:4791761-4791783 CCCGGGAGGCAGAGGTTGCAGGG - Intronic
1133566744 16:7002634-7002656 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1133654836 16:7851112-7851134 CTGGGGAGGCAGAGATTGCAGGG - Intergenic
1133792755 16:9021952-9021974 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1133856686 16:9556306-9556328 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1133978639 16:10617833-10617855 CTGGAGAGGGAGAGGGAGCAAGG + Intergenic
1134191116 16:12121889-12121911 CCCGGGAGGCAGAGGTTGCAGGG - Intronic
1134353857 16:13462884-13462906 CCCGGGAGGCAGAGGTTGCAGGG + Intergenic
1134430785 16:14203726-14203748 CCCAGGAGACAGAGGTTGCAGGG + Intronic
1134488221 16:14675861-14675883 CCCGGGAGGCAGAGGTTGCAGGG + Intronic
1134752815 16:16639721-16639743 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1134993243 16:18719355-18719377 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1135032891 16:19052786-19052808 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1135035468 16:19073231-19073253 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1135060425 16:19266857-19266879 CTAGGGAGCCAGAGGGTTGAGGG - Intronic
1135082666 16:19449812-19449834 CAGGAGAGAGAGTGGGTGCAGGG - Intronic
1135257199 16:20950504-20950526 CTGGGAAGACAGAGGCTTAAAGG - Intronic
1135289089 16:21219196-21219218 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1135674998 16:24407712-24407734 CTTGGGAGGCTGAGGTTGCAGGG - Intergenic
1135989883 16:27211752-27211774 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1136026959 16:27474731-27474753 CTGGGGTGGCAGAGGGCGCACGG + Intronic
1136381683 16:29898981-29899003 CTGGGGAGGCGGCGGGTGCTGGG + Exonic
1136392594 16:29974646-29974668 CAGGTGAGACACGGGGTGCAGGG + Exonic
1136504900 16:30696849-30696871 CCCGGGAGACAGAGGCTGCAGGG + Intergenic
1136547737 16:30965134-30965156 CTGGGGAGCCAGAGCGGGCAGGG - Exonic
1136558492 16:31024003-31024025 CTGGGGAGGCAGAGGCTGTAGGG - Intergenic
1136640820 16:31563748-31563770 TTAGGGAGACAGAGGGGGCAGGG - Intergenic
1136664145 16:31793566-31793588 TTAGGGAGACAGAGGGGGCAGGG + Intronic
1137031525 16:35528568-35528590 CAGGGGAGACTCAGTGTGCATGG + Intergenic
1137258402 16:46798430-46798452 CTCGGGAGGCAGAGGTTGCAAGG + Intronic
1137555828 16:49469763-49469785 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1138479978 16:57296234-57296256 CCCGGGAGGCAGAGGTTGCAGGG - Intergenic
1138740623 16:59305348-59305370 CCCGGGAGGCAGAGGTTGCAGGG - Intergenic
1138811537 16:60156368-60156390 GTGGGGGGACAAAGGATGCAGGG + Intergenic
1138833804 16:60409049-60409071 CCCGGGAGGCAGAGGTTGCAGGG - Intergenic
1138880417 16:61007610-61007632 CCAGGGAGGCAGAGGTTGCAGGG - Intergenic
1139252008 16:65505581-65505603 CTGGGGATAAAGAGGGTGTGAGG + Intergenic
1139272890 16:65700034-65700056 CTGGTGAGACATAGGGTGTCAGG - Intergenic
1139410353 16:66753610-66753632 CCCAGGAGACAGAGGCTGCAGGG + Intergenic
1139725046 16:68890947-68890969 CTTGGGAGGCGGAGGTTGCAGGG + Intronic
1139765773 16:69228428-69228450 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1139780161 16:69344695-69344717 CCCGGGAGGCAGAGGTTGCAGGG + Intronic
1140043311 16:71423942-71423964 CTGGGGAGACAGAGAAGGCTTGG + Intergenic
1140273537 16:73487474-73487496 CTCAGGAGACTGAGGCTGCAAGG - Intergenic
1140498524 16:75411333-75411355 CCCGGGAGGCAGAGGTTGCAGGG + Intronic
1140749145 16:78007680-78007702 CTGGGGAGGTGGAGGTTGCAGGG - Intergenic
1140889339 16:79271896-79271918 CAGGGGAGGCAGAGGGGTCAGGG - Intergenic
1141150311 16:81560070-81560092 CTGGGGAGGCAGAGGTTGCAGGG + Intronic
1141194666 16:81851586-81851608 CTCGGGAGGCGGAGGTTGCAGGG - Intronic
1141235849 16:82215577-82215599 CCCGGGAGGCAGAGGTTGCAGGG - Intergenic
1141303704 16:82841060-82841082 CTGGGGACACATGGGATGCATGG + Intronic
1141476767 16:84279319-84279341 CTGGGGCCACGGAGGGTGCATGG - Intergenic
1141664566 16:85459224-85459246 GTGGAGACACAGAGGGTGCCTGG - Intergenic
1141905348 16:87021666-87021688 CCCGGGAGGCAGAGGTTGCAGGG - Intergenic
1141962220 16:87416678-87416700 CCCGGGAGGCAGAGGTTGCAGGG + Intronic
1142144333 16:88486559-88486581 CTGGGTACACAGTGGGTGCTAGG + Intronic
1142289129 16:89184742-89184764 CCAGGGTGACAGAGGATGCATGG - Intronic
1142301198 16:89259113-89259135 CCCGGGAGACGGAGGTTGCAGGG - Intergenic
1142492297 17:286903-286925 CGGTGGAGAGAGAGGGTGCGAGG - Intronic
1142492302 17:286931-286953 CGGTGGAGAGAGAGGGTGCGAGG - Intronic
1142492347 17:287169-287191 CGGTGGAGAGAGAGGGTGCGAGG - Intronic
1142492352 17:287197-287219 CGGTGGAGAGAGAGGGTGCGAGG - Intronic
1142492357 17:287225-287247 CGGTGGAGAGAGAGGGTGCGAGG - Intronic
1142492362 17:287253-287275 CGGTGGAGAGAGAGGGTGCGAGG - Intronic
1142492437 17:287649-287671 CGGTGGAGAGAGAGGGTGCGAGG - Intronic
1142492446 17:287705-287727 CGGTGGAGAGAGAGGGTGCGAGG - Intronic
1142492451 17:287733-287755 CGGTGGAGAGAGAGGGTGCGAGG - Intronic
1142492485 17:287971-287993 CGGTGGAGAGAGAGGGTGCGAGG - Intronic
1142492504 17:288077-288099 CGGTGGAGAGAGAGGGTGCGAGG - Intronic
1142492529 17:288209-288231 CGGTGGAGAGAGAGGGTGCGAGG - Intronic
1142492570 17:288421-288443 CGGTGGAGAGAGAGGGTGCGAGG - Intronic
1142492585 17:288501-288523 CGGTGGAGAGAGAGGGTGCGAGG - Intronic
1142492590 17:288529-288551 CGGTGGAGAGAGAGGGTGCGAGG - Intronic
1142492595 17:288557-288579 CGGTGGAGAGAGAGGGTGCGAGG - Intronic
1142492605 17:288611-288633 CGGTGGAGAGAGAGGGTGCGAGG - Intronic
1142492610 17:288639-288661 CGGTGGAGAGAGAGGGTGCGAGG - Intronic
1142492615 17:288667-288689 CGGTGGAGAGAGAGGGTGCGAGG - Intronic
1142492620 17:288695-288717 CGGTGGAGAGAGAGGGTGCGAGG - Intronic
1142492625 17:288723-288745 CGGTGGAGAGAGAGGGTGCGAGG - Intronic
1142492650 17:288855-288877 CGGTGGAGAGAGAGGGTGCGAGG - Intronic
1142642004 17:1289637-1289659 CTGGGGAGAAGAAGGCTGCAAGG - Intronic
1142746616 17:1962431-1962453 CCCGGGAGACGGAGGTTGCAGGG - Intronic
1142885653 17:2910799-2910821 CCTGGGAGACGGAGGTTGCAGGG - Intronic
1143001280 17:3796754-3796776 TGGGGGAGACAGAGGGTTGAGGG - Intronic
1143137488 17:4719971-4719993 ATGGAGAGCCAGACGGTGCAAGG + Intronic
1143141110 17:4742308-4742330 CTGGGGACACAGCGGGTGGTGGG - Intronic
1143193766 17:5059713-5059735 CTGGGGAGAGGGAGGGAGAAAGG + Intergenic
1143215191 17:5219550-5219572 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1143297064 17:5879161-5879183 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1143317365 17:6042547-6042569 CTGAGAAGCCAGAGGGTGTAAGG + Intronic
1143863985 17:9910832-9910854 CTAGGCAGCCAGAGGGTGGAAGG + Intronic
1143899062 17:10159859-10159881 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1144064781 17:11615076-11615098 CTTGGGAGAATGGGGGTGCAAGG - Intronic
1144118496 17:12125989-12126011 CAGGGGAGAGAGAGAGTGAAGGG + Intronic
1144809961 17:17992742-17992764 CTGGGGAGAAAAAGGGAGAAAGG - Intronic
1146357020 17:32142777-32142799 CAGGGGCGACAGGGGCTGCAGGG - Intronic
1146599563 17:34202939-34202961 CTTGGAAGACAGTGGCTGCAGGG + Intergenic
1146665428 17:34699500-34699522 CTGGAGAGGCAGAGGGAGAAAGG - Intergenic
1147008528 17:37424427-37424449 CCCGGGAGGCAGAGGTTGCAGGG - Intronic
1147113675 17:38282630-38282652 CCCGGGAGGCAGAGGTTGCAGGG - Intergenic
1147154256 17:38535629-38535651 CTGGGGGCACAGAGAGGGCAGGG - Intronic
1147192423 17:38745887-38745909 ATAGGGAAACAGAGGCTGCAGGG + Intronic
1147192652 17:38747039-38747061 CTGGGGAGACTGAGGCAGCATGG + Intronic
1147403623 17:40195381-40195403 CTGGGAAGCCAGGGGCTGCAGGG - Exonic
1147458885 17:40555979-40556001 CTGGAGAGGCCGAGGCTGCAGGG - Intronic
1147583270 17:41638591-41638613 CTGGGTATACAGGGGGTGCTGGG - Intergenic
1147609251 17:41792060-41792082 GTGGGGAGATAGAGGCAGCATGG + Intergenic
1147662633 17:42125158-42125180 TTGGGGTGACCGAGGGTGGAGGG + Intronic
1147681421 17:42249734-42249756 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1147915945 17:43886030-43886052 CCCGGGAGGCAGAGGTTGCAAGG + Intronic
1147976571 17:44251368-44251390 CTGGGGTGGTAGAGGGTGCTGGG - Intronic
1148129527 17:45254697-45254719 GAGGGGAGAATGAGGGTGCAGGG - Intronic
1148136125 17:45293047-45293069 CTGGGGAGGCACTGTGTGCAGGG - Intronic
1148288139 17:46414978-46415000 CTGGGGAGGAGGAGGTTGCAGGG - Intergenic
1148310309 17:46632562-46632584 CTGGGGAGGAGGAGGTTGCAGGG - Intronic
1148323082 17:46769238-46769260 CTCGGGAGGCGGAGGTTGCAGGG + Intronic
1148370650 17:47097315-47097337 CCTGGGAGTCAGAGGTTGCAGGG + Intergenic
1148376229 17:47149001-47149023 CTCGGGAAGCAGAGGTTGCAGGG + Intronic
1148415935 17:47506555-47506577 CCCGGGAGGCAGAGGTTGCAGGG + Intergenic
1148640500 17:49183836-49183858 CTGGGGCACCCGAGGGTGCAGGG + Intergenic
1148753224 17:49957949-49957971 CCCGGGAGGCAGAGGCTGCAGGG + Intergenic
1148758170 17:49985505-49985527 CTGTGGAGGCAGAGCCTGCATGG - Intergenic
1149045955 17:52245956-52245978 CTGGAGAGAAAGAGAGTGCTGGG - Intergenic
1149488488 17:57064468-57064490 CCCGGGAGGCAGAGGTTGCAGGG - Intergenic
1149525955 17:57355946-57355968 CCCGGGAGGCAGAGGTTGCAGGG - Intronic
1149585605 17:57784213-57784235 CTGGAGGGAGATAGGGTGCAAGG - Intergenic
1149591334 17:57831936-57831958 ATGGGGAGGCAGTGGGTGCCAGG - Intergenic
1149702850 17:58669656-58669678 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1149801438 17:59571664-59571686 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1150043811 17:61891217-61891239 CCCGGCAGACAGAGGTTGCAGGG + Intronic
1150356076 17:64485990-64486012 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1150377349 17:64692728-64692750 CCTAGGAGACAGAGGTTGCAGGG - Intergenic
1150422378 17:65049692-65049714 CTGGGGAAAGGGAGGGGGCATGG + Intronic
1150626796 17:66847178-66847200 TCTGGGAGACAGAGGGTGCCAGG - Intronic
1150639903 17:66942518-66942540 CTGGAGGGACAGAGGGAGGAGGG + Intergenic
1151065868 17:71148974-71148996 CCCGGGAGGCAGAGGTTGCAGGG + Intergenic
1151134763 17:71935567-71935589 TTTGGGAGACATTGGGTGCAGGG - Intergenic
1151137141 17:71957611-71957633 CCCGGGAGGCAGAGGTTGCAGGG + Intergenic
1151199235 17:72455646-72455668 CTTGGGAGGCAGATGCTGCAAGG - Intergenic
1151350692 17:73530331-73530353 CAGGAGAGAGAGAGAGTGCAGGG + Intronic
1151421989 17:74004803-74004825 CTGGGGAGGAGGAGGGTGCTGGG + Intergenic
1151738969 17:75966052-75966074 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1151865984 17:76803078-76803100 CCCGGGAGGCAGAGGTTGCAAGG + Intergenic
1151885095 17:76918737-76918759 CTGGGGAGACAGAACGTCCCAGG + Intronic
1151920226 17:77149044-77149066 CTGGAGAGACAGATGGGGAATGG - Intronic
1151934894 17:77255527-77255549 CCGTGGAGACAGAGGGCGCCGGG - Intergenic
1152017659 17:77762180-77762202 CTTGGGAGGCGGAGGTTGCAGGG + Intergenic
1152101790 17:78305755-78305777 CAGTGGGGACAGAGGCTGCAGGG - Intergenic
1152245257 17:79182116-79182138 CTGGAGAGAGAGAGAGTACAGGG - Intronic
1152425656 17:80217201-80217223 GGTGGGAGACAGAGAGTGCACGG + Intronic
1152579819 17:81160898-81160920 CGGGGGAGGCAGAGGGTCCACGG - Intronic
1152622403 17:81372025-81372047 CTGGGGAGGCACAGGGTGAGGGG + Intergenic
1152815742 17:82406717-82406739 CTTGGGAGGCAGAGGGTGGGAGG - Intronic
1152818179 17:82421185-82421207 CAGGGGAGGCCGAGGCTGCAAGG + Intronic
1153660943 18:7325732-7325754 CTGAGGGAACAGAAGGTGCAAGG + Intergenic
1154407671 18:14109029-14109051 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1155107782 18:22684709-22684731 CCGTGGAGGCAGAGGTTGCAGGG + Intergenic
1155150543 18:23119292-23119314 CCCGGGAGGCAGAGGTTGCAGGG + Intergenic
1155151663 18:23127977-23127999 CCTGGGAGACGGAGGTTGCAGGG + Intergenic
1155278249 18:24211039-24211061 CCCGGGAGGCAGAGGTTGCAGGG - Intronic
1155374478 18:25140646-25140668 ATGGGGAGACAGAGGGGAGAAGG + Intronic
1155973816 18:32107194-32107216 CCCGGGAGGCAGAGGTTGCAGGG - Intronic
1156121875 18:33854246-33854268 CTGTGGAGGTAGAGGGTGGAGGG - Intronic
1156273728 18:35561374-35561396 CCTGGGAGACAGAGATTGCAGGG + Intergenic
1156894384 18:42229003-42229025 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1157259675 18:46167238-46167260 CCCGGGAGGCAGAGGTTGCAGGG + Intergenic
1157382545 18:47232560-47232582 CTGGGGACACAGAGGAGGGATGG - Intronic
1157863545 18:51162026-51162048 CGGGGGAGTCTGAGGCTGCAGGG + Intergenic
1158708344 18:59814867-59814889 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1158843981 18:61420973-61420995 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1158959623 18:62578840-62578862 CCAGGGAGGCAGAGGTTGCAGGG - Intronic
1159209826 18:65304142-65304164 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1159570825 18:70110382-70110404 CTGGTTGGACAGTGGGTGCAGGG + Intronic
1159611295 18:70528094-70528116 CCCAGGAGATAGAGGGTGCAGGG + Intergenic
1159674517 18:71265330-71265352 CCAGGGAGTCAGAGGTTGCAGGG - Intergenic
1160178624 18:76615804-76615826 ATGGGGAGGCAGAGGGACCAAGG + Intergenic
1160201943 18:76802857-76802879 CCCGGGAGGCAGAGGTTGCAGGG + Intronic
1160425265 18:78774768-78774790 CTCGGGAGAGAGCGGGTGCCAGG - Intergenic
1160534684 18:79585718-79585740 GTGGGGACACAGTGGGAGCATGG - Intergenic
1160590974 18:79944524-79944546 CTGGGGAGGCAGAGACCGCAGGG - Intronic
1160710935 19:550685-550707 CTGGGGTGACAGTGGGGACAGGG - Intergenic
1160711000 19:550897-550919 CTGGGGTGACAGTGGGGACAGGG - Intergenic
1160839837 19:1141288-1141310 CTCGGGAAGCAGAGGTTGCAGGG - Intronic
1160895402 19:1399939-1399961 CTGGGCAGACACAGGGCGCCTGG + Intronic
1161023913 19:2026182-2026204 CCCGGGAGGCAGAGGTTGCAGGG - Intronic
1161088297 19:2344992-2345014 CTGGGGACACTGAGGCTGCGAGG - Intronic
1161108020 19:2454215-2454237 CCCGGGAGGCAGAGGGTGCGGGG + Intronic
1161173925 19:2828589-2828611 CACGGGAGGCAGAGGTTGCAGGG + Intronic
1161215299 19:3092111-3092133 CCCGGGAGGCAGAGGTTGCAGGG - Intergenic
1161254718 19:3301440-3301462 CCCGGGAGGCAGAGGTTGCAGGG - Intergenic
1161376679 19:3942658-3942680 CCCGGGAGGCAGAGGTTGCAGGG + Intergenic
1161420776 19:4174972-4174994 CGTGGGGGACAGAGGGTGCATGG + Intronic
1161604500 19:5207158-5207180 CCCAGGAGACAGAGGTTGCAGGG - Intronic
1161613095 19:5254582-5254604 TTGGGGAGGCAGAGAGAGCAGGG + Intronic
1161621746 19:5301389-5301411 CCTGGGAGGCAGAGGGTGCAGGG - Intronic
1161790667 19:6357984-6358006 CAGGGCAGGCAGGGGGTGCAGGG + Intergenic
1161849581 19:6731549-6731571 CAGGGGAGACTGAGGGTGGGAGG + Intronic
1162024862 19:7888252-7888274 CTGGGGAAACTGAGGGAGCTGGG - Intergenic
1162087459 19:8257214-8257236 CCTGGAAGACAGAGGGGGCAGGG - Intronic
1162088952 19:8265406-8265428 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1162119422 19:8453680-8453702 CTGGGGAAGCAGAAGGTGCAAGG + Intronic
1162131769 19:8530366-8530388 CTGCGGGGACAGAGGGTGGAGGG + Intronic
1162328458 19:10012230-10012252 CTGGGGAGTCAGAGGCTGGGAGG - Intergenic
1162374105 19:10294979-10295001 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1162582793 19:11540703-11540725 CAGGGGGCACAGAGGGGGCAGGG + Intronic
1162585077 19:11553393-11553415 CTGGGGGGCCAGGGGCTGCAGGG + Exonic
1162654889 19:12121174-12121196 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1162801496 19:13113232-13113254 CTGGGGAAGCGGAGGTTGCAGGG - Intronic
1162933856 19:13970906-13970928 CTTGGGAGGCAGAGGTTGCAGGG + Intronic
1162966410 19:14158281-14158303 CTGGGAACACAGAGGGTACAGGG + Intronic
1163138843 19:15332627-15332649 CTGGAGAGACAGTGGCTGCGAGG + Intergenic
1163233061 19:16016704-16016726 CTGGGGATGCAGATGGGGCAGGG - Intergenic
1163256216 19:16157512-16157534 CTCGGGGGACAGAGGCTACACGG + Exonic
1163432010 19:17273881-17273903 CTGGGGAGGCAGAGAGTACAGGG - Intronic
1163562004 19:18024928-18024950 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1163871467 19:19824809-19824831 CTGGGGAGAGACAGAGAGCATGG + Intergenic
1163907827 19:20162512-20162534 CTGGGGAGAGAAAGAGAGCATGG + Intergenic
1163911890 19:20203016-20203038 CCCGGGAGGCAGAGGTTGCAGGG + Intergenic
1163934912 19:20434011-20434033 CTGGGGAGAGAAAGAGAGCATGG + Intergenic
1163949149 19:20568076-20568098 CTGGGGAGAGAAAGAGAGCATGG + Intronic
1164245703 19:23426524-23426546 CTGAGGAGATCGAGGCTGCAGGG + Intergenic
1164634492 19:29782273-29782295 CTGGGGAGCCACAGGCTGCAGGG - Intergenic
1164932735 19:32187829-32187851 CCTGGGAGACAGAGGTTGCAGGG - Intergenic
1165103009 19:33450043-33450065 CTGCGGAGACAGAGGCAGCTTGG - Intronic
1165407046 19:35637419-35637441 CTGTGGAGACAGAGGGTTCAAGG - Intronic
1165412877 19:35673209-35673231 CTGGGGAGACAGAGGGAGGACGG - Intronic
1165464867 19:35967993-35968015 CTTGGGAGACAGAGGCTACAGGG - Intergenic
1165585432 19:36911285-36911307 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1165696505 19:37905154-37905176 CCAGGGAGTCAGAGGTTGCAGGG + Intronic
1165767131 19:38358588-38358610 CTGGGGAGACAGAGTATGCCTGG - Intronic
1165874716 19:38998037-38998059 CCCAGGAGACAGAGGTTGCAGGG + Intronic
1166005237 19:39902153-39902175 CTGGGGAGGGAGGGGCTGCAAGG + Intronic
1166053350 19:40274241-40274263 CTGGGGACACAGTGGGGGCTAGG - Intronic
1166320628 19:42016482-42016504 CTCAGGGGCCAGAGGGTGCATGG - Intronic
1166533975 19:43560318-43560340 CCCGGGAGGCAGAGGTTGCAAGG + Intronic
1166611342 19:44200387-44200409 CCCGGGAGACAGAAGTTGCAGGG + Intergenic
1166664537 19:44671195-44671217 CTTGGGAGGCAGGGGTTGCAGGG - Intronic
1166983184 19:46643910-46643932 CTTGGGAGGCAGAGGTTGTAAGG - Intergenic
1167056820 19:47116410-47116432 CCCAGGAGACAGAGGTTGCAGGG + Intronic
1167151000 19:47709602-47709624 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1167166440 19:47802848-47802870 GTGCGGAGGCAGAGGCTGCAGGG + Exonic
1167167194 19:47806442-47806464 CCCGGGAGGCAGAGGTTGCAGGG + Intronic
1167249011 19:48391002-48391024 CTGGGCAGCCCGAGGGTTCATGG - Intronic
1167256973 19:48436464-48436486 CGGGGGAGCCAGAGGCTGCATGG + Intronic
1167335039 19:48879976-48879998 CTCGGGAGGCGGAGGTTGCAGGG - Intergenic
1167389963 19:49188618-49188640 CTGGAGAGACAAAGAGGGCACGG - Intronic
1167436193 19:49480275-49480297 CTGGGGAGAAAGAGGAGGCTGGG - Intronic
1167476433 19:49704245-49704267 TCGGGGAGGCAGAGGTTGCAAGG - Intronic
1167507881 19:49880727-49880749 CTGGGGTCACACAGGGTGCAGGG + Intronic
1167644686 19:50699529-50699551 CTGGGGAGGCAAAGAGAGCATGG + Intronic
1167669139 19:50839458-50839480 CTGGGGAGTCTGAGGGAGGAGGG + Intergenic
1167685241 19:50951903-50951925 CTGGAGGGATAGAGGGTGCAGGG - Intronic
1167736448 19:51297262-51297284 CAGGGCACACAGAGAGTGCATGG - Intergenic
1167939938 19:52938378-52938400 CCCAGGAGACAGAGGTTGCAGGG + Intronic
1168052642 19:53840880-53840902 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1168108311 19:54177984-54178006 CCCGGGAGGCAGAGGTTGCAGGG - Intronic
1168328134 19:55548848-55548870 CCCGGGAGGCAGAGGTTGCAGGG + Intergenic
1168454919 19:56499228-56499250 CTGGGGAGGCGGAGGTTTCAGGG + Intergenic
1168595072 19:57668865-57668887 CTGGTGAAACAGAGGGGGCCCGG - Intergenic
1168684192 19:58338082-58338104 CTTGGATGACAAAGGGTGCAGGG - Intronic
925056710 2:862235-862257 CAGCCGAGACAGCGGGTGCACGG + Intergenic
925134061 2:1514438-1514460 CTGGGCAGACAGAGGGCACTGGG - Intronic
925572992 2:5331523-5331545 CTGGGGAGGCAGGGTGTGTAGGG + Intergenic
925637112 2:5951165-5951187 CTGGGGAGAGAGAAGGAGGAAGG - Intergenic
925915772 2:8604765-8604787 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
926091869 2:10056364-10056386 CCTGGGAGGCGGAGGGTGCAGGG + Intergenic
926326846 2:11792456-11792478 CCCGGGAGGCAGAGGTTGCAGGG - Intronic
926398640 2:12471805-12471827 CCTGGAAGACAGAGGTTGCAAGG - Intergenic
926615185 2:14990346-14990368 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
927069684 2:19514604-19514626 CCAGGGAGGCAGAGGTTGCAGGG - Intergenic
927107635 2:19841620-19841642 CTGGGGAGACAGATAGTGTAAGG + Intergenic
927173608 2:20390378-20390400 CTGGAGAGGCAGAGGTTGCAAGG - Intergenic
927589444 2:24340572-24340594 CTGGTGGGACAGAGGCTGGAAGG - Intronic
927930317 2:27039670-27039692 CTGGGGAGACAGACACTACAGGG - Intronic
928155044 2:28868926-28868948 CCCGGGAGGCAGAGGTTGCAGGG + Intronic
928216982 2:29370010-29370032 TTGGGGAGAGAGAGTGTGCAGGG + Intronic
928601313 2:32906450-32906472 CCCGGGAGGCAGAGGTTGCAGGG - Intergenic
928731660 2:34238838-34238860 ATGAGGTGACAGAGGGTTCAGGG + Intergenic
929063688 2:37950193-37950215 CTGGTGAGAGAGATGGTCCAAGG + Intronic
929181775 2:39048474-39048496 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
929279016 2:40057822-40057844 CAGAGGAGACAGAGGGCTCATGG + Intergenic
929489174 2:42381338-42381360 CCCGGGAGACAGAGGTTGCAGGG - Intronic
929518864 2:42629153-42629175 CCTGGGAGACAGAGATTGCAGGG - Intronic
929679146 2:43971022-43971044 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
929824999 2:45303132-45303154 ATGGGGAGAGAGAGGGAGCTGGG + Intergenic
930818401 2:55621554-55621576 CTCAGGAGAGAGAGGATGCAAGG - Intergenic
930826194 2:55699404-55699426 CTGAGGAGGGAGAGGCTGCATGG + Intergenic
930967178 2:57343574-57343596 CTTGGGAGGCTGAGGGTGGATGG + Intergenic
931307935 2:61050298-61050320 CCCGGGAGGCAGAGGTTGCAGGG + Exonic
931352350 2:61503039-61503061 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
931829653 2:66037655-66037677 CTGGGGAGACAGGAAGTGCCTGG + Intergenic
932020147 2:68076219-68076241 CCCAGGAGACAGAGGCTGCAGGG - Intronic
932129555 2:69175514-69175536 CTGGGGAGGCTGAGGCTGGAGGG + Intronic
932150927 2:69371150-69371172 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
932181675 2:69652086-69652108 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
932207452 2:69895632-69895654 CAGGGGAGGCAGAGATTGCAGGG - Intronic
932218814 2:69984694-69984716 CCTGGGAGATAGAGGTTGCAGGG - Intergenic
932769315 2:74491730-74491752 CTGGGGAGGCACAGGGTCTAAGG + Intronic
933990244 2:87628651-87628673 CAAGGGAGACAGAGGGTGGAGGG + Intergenic
934070720 2:88381632-88381654 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
934076190 2:88430575-88430597 CCGGGGAGGCGGAGGTTGCAGGG + Intergenic
934508246 2:94914084-94914106 CTGGAGAGACAGAGGGTGCATGG - Intergenic
934524271 2:95042008-95042030 ATGGGGACTGAGAGGGTGCATGG - Intronic
935035648 2:99369898-99369920 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
935058156 2:99585802-99585824 CCCGGGAGGCAGAGGTTGCAGGG - Intronic
935170856 2:100610625-100610647 CTGCTCAGAAAGAGGGTGCATGG - Intergenic
935224940 2:101045336-101045358 ATGGGGAGACAGAGAGAGAAAGG - Intronic
935226091 2:101054378-101054400 ATGGGAAGGCAGGGGGTGCAAGG + Intronic
935293183 2:101626948-101626970 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
935606347 2:104975336-104975358 CTGGGGAGGCGGAGCTTGCAGGG + Intergenic
935729744 2:106055552-106055574 CTGAGGAGACAGAGAGTGAATGG - Intergenic
935837928 2:107075643-107075665 CTGGTGAGGCAGGTGGTGCAGGG + Intergenic
936082809 2:109446508-109446530 CAGGGGAGGCTGAGGCTGCAGGG + Intronic
936303602 2:111322173-111322195 CAAGGGAGACAGAGGGTGGAGGG - Intergenic
936601672 2:113902673-113902695 CCCGGGAGAAAGAGGTTGCAGGG - Intronic
937316181 2:120933390-120933412 ATGGGGAGACAAATGGGGCAGGG + Intronic
937333440 2:121045991-121046013 CTGGGGAGCCTGTGGGTGGAGGG + Intergenic
937438421 2:121897611-121897633 CTTTGGAGAGAGAGGATGCATGG + Intergenic
938181635 2:129189893-129189915 GCAGGGGGACAGAGGGTGCAGGG + Intergenic
938207757 2:129438537-129438559 CTGGGGAGGGAGAGGGAGCCTGG - Intergenic
938252663 2:129827684-129827706 CGGGAGAGGCAGAGGGTGCGCGG + Intergenic
938560851 2:132470734-132470756 CAGGGGAGACAGGGAGGGCACGG + Intronic
938884465 2:135629238-135629260 CCCGGGAGGCAGAGGTTGCAGGG + Intronic
938943535 2:136190265-136190287 CTTGGGGGACAGAGGGTCCATGG - Intergenic
939444211 2:142287986-142288008 CCCGGGAGGCAGAGGTTGCAAGG - Intergenic
940467771 2:154053768-154053790 CTGGGCTGACAGTGGGTGAAAGG + Intronic
940812684 2:158263053-158263075 CTAGAGAGACAGAGAGGGCAAGG - Intronic
940864194 2:158800913-158800935 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
941640121 2:167978181-167978203 CTTGGCAGACAGAGGCTGCATGG + Intronic
941651962 2:168101660-168101682 CCTGGGAGGCAGAGGCTGCAGGG + Intronic
941670759 2:168289743-168289765 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
941900803 2:170676387-170676409 CCTGGGAGACGGAGGTTGCAGGG + Intergenic
941915633 2:170811847-170811869 GTCGGGAGGCAGAGGTTGCAGGG - Intergenic
941987961 2:171526436-171526458 GTGGGGAGAGAGAGGGGGAAAGG - Intronic
942185964 2:173425630-173425652 CCAGGGAGTCAGAGGTTGCAGGG - Intergenic
942656414 2:178218703-178218725 CCCGGGAGGCAGAGGTTGCAGGG - Intronic
943230826 2:185248923-185248945 CTGGGGAGGTAGAGGTTACAGGG + Intergenic
943678754 2:190745566-190745588 CTGCGGAGACAGAGAATGGATGG + Intergenic
944125074 2:196283449-196283471 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
944232732 2:197412429-197412451 CCCGGGAGACAGAGGTTGCAGGG - Intronic
944369065 2:198960620-198960642 CAGGAGAGAGAGAGTGTGCAGGG - Intergenic
944557783 2:200905270-200905292 CCCGGGAGGCAGAGGTTGCAGGG - Intergenic
944695853 2:202200004-202200026 CCGGGGAGGCAGAGGTTGCAGGG - Intergenic
944733328 2:202536794-202536816 CCCGGGAGGCAGAGGTTGCAAGG + Intronic
945089547 2:206166055-206166077 CCCGGGAGGCAGAGGTTGCAGGG - Intergenic
945217783 2:207453096-207453118 CCCGGGAGGCAGAGGTTGCAGGG + Intergenic
945234590 2:207622981-207623003 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
945475054 2:210272239-210272261 CAGGAGAGAGAGAGAGTGCAGGG + Intergenic
945942668 2:215965470-215965492 CAGGGGATACAGAGGGAGGAAGG + Intronic
946615816 2:221508501-221508523 CCCGGGAGACTGAGGTTGCAGGG + Intronic
946699045 2:222392729-222392751 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
946822752 2:223647263-223647285 CAGGAAAGACAGAGGCTGCAGGG - Intergenic
946999857 2:225441617-225441639 CAGGAGAGAGAGAGTGTGCAGGG + Intronic
947267379 2:228298681-228298703 CTGGGGATACAGAAGTTGAAAGG - Intergenic
947511984 2:230764044-230764066 CGGAGGAGGCAGAGGTTGCAGGG + Intronic
947686826 2:232094641-232094663 CCTGGGAGGCAGAGGCTGCAGGG + Intronic
947688185 2:232109363-232109385 CCAGGGAGGCAGAGGTTGCAGGG + Intronic
947697512 2:232204255-232204277 TTGAGGAGGCTGAGGGTGCAGGG + Intronic
947756072 2:232566260-232566282 CTCGGGAGGCAGAGCTTGCAGGG - Intronic
947766262 2:232639718-232639740 CTTGGGAGCTAGAGGGTGCCAGG + Intronic
948063557 2:235060280-235060302 CTGGGCACACAGAGGGTCCAAGG + Intergenic
948110304 2:235449493-235449515 TTAGAGAGACAGAGAGTGCATGG - Intergenic
948171263 2:235905573-235905595 CCTGGGAGACAGAGATTGCAGGG - Intronic
948454760 2:238099835-238099857 CTGGGGACACAGTGGCTCCACGG - Intergenic
948645026 2:239399398-239399420 CTGGGGAGAGGGAGGGTGGAAGG - Intronic
948845689 2:240681858-240681880 AAGGGGTGATAGAGGGTGCAGGG + Intronic
948848166 2:240692872-240692894 AAGGGGTGATAGAGGGTGCAGGG - Intronic
1168828561 20:831179-831201 CTTGGGAGGCAGAGGTTGCAGGG + Intergenic
1169215000 20:3788059-3788081 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1169418545 20:5439657-5439679 CTTGGGAGGCAGAGGTTGCAGGG - Intergenic
1169712410 20:8579848-8579870 ATCAGGAGACAGAGGGAGCAAGG + Intronic
1169911885 20:10653700-10653722 CTGGGGAGCTAGAGGGGGCGGGG - Intronic
1170084190 20:12510711-12510733 ATGGGGAGGAAGTGGGTGCAAGG + Intergenic
1170722513 20:18896185-18896207 GTGGGCAGGCAGAGGGTACATGG + Intergenic
1171240997 20:23566810-23566832 CCCGGGAGGCAGAGGTTGCAGGG + Intronic
1172011780 20:31849877-31849899 GTGGGGCGAGAGAGGGTGCACGG + Intronic
1172212011 20:33206686-33206708 CTCTGGAGGCAGAGGTTGCAGGG - Intergenic
1172232854 20:33348608-33348630 CTGAGGAGCCAGAAGGAGCAGGG + Intergenic
1172409666 20:34711680-34711702 TGGGGGAGACAGAAGGGGCAGGG + Exonic
1172427018 20:34862439-34862461 TTTGGAGGACAGAGGGTGCAAGG + Intronic
1172427539 20:34865258-34865280 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1172479027 20:35260203-35260225 AGGGGGAGACAGAGGGAGCAGGG - Intronic
1172575616 20:36006102-36006124 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1172656293 20:36540862-36540884 TTGGGCAGACAGGAGGTGCAGGG - Intergenic
1172807684 20:37624342-37624364 CTGGGGAGCCAGAAGATTCATGG + Intergenic
1173019489 20:39255258-39255280 CCTGGGAGCCAGAGGTTGCAGGG - Intergenic
1173061005 20:39661164-39661186 ATGTGGAGACAAAGGGGGCATGG - Intergenic
1173431240 20:42988672-42988694 CAGGAGAGACAGTGGCTGCAGGG + Intronic
1173573312 20:44092579-44092601 CCCGGGAGGCAGAGGTTGCAGGG + Intergenic
1173608659 20:44350700-44350722 CTGGGGGGACAGGAGGAGCACGG - Exonic
1173632665 20:44528339-44528361 CTGGGGAGGCAGAGGCTGCAGGG + Intergenic
1173797916 20:45875575-45875597 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1173856721 20:46255095-46255117 CCGGGGAGGCGGAGGTTGCAGGG - Intronic
1174213655 20:48899576-48899598 CTCGGGAGGTAGAGGTTGCAGGG - Intergenic
1174369038 20:50073881-50073903 CTCGGGAGGCGGAGGTTGCATGG - Intergenic
1174555387 20:51391616-51391638 CTCGGGAGGCTGAGGCTGCAAGG - Intronic
1174834762 20:53846607-53846629 CCCGGGAGGCAGAGGTTGCAGGG - Intergenic
1174863833 20:54116463-54116485 CTGGGGAGGGAGAGGTTGTAGGG + Intergenic
1175028607 20:55929859-55929881 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1175136317 20:56827066-56827088 CTGGGGAGAGAGGGGATGGAGGG - Intergenic
1175257762 20:57657315-57657337 CTGGGGAGAGTGACGGTGCCTGG - Intronic
1175382806 20:58575372-58575394 CTAGGGAGGCAGAGGTTGCAGGG + Intergenic
1175405303 20:58722244-58722266 CTGAGAGGGCAGAGGGTGCAGGG - Intergenic
1175522378 20:59610177-59610199 CTGGGGAAGCAGAGGTTGCATGG + Intronic
1175653455 20:60748936-60748958 CAGGCGGGACAGAGGGGGCATGG + Intergenic
1175786765 20:61716830-61716852 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1175853685 20:62107423-62107445 CTGGGAAGGCAGGGGGTGCCTGG + Intergenic
1176056528 20:63151834-63151856 CTGGAGAGCCAGAGGGAGCCGGG + Intergenic
1176058502 20:63161401-63161423 CTGGGGAGTCAGGGGCTGGAAGG - Intergenic
1176132353 20:63501716-63501738 CTGCGGGGACAGAGGCTACAAGG + Intergenic
1176138918 20:63536762-63536784 CAGGGAGGACAGAGGGTCCAGGG - Intronic
1176724275 21:10417090-10417112 ATGGGGAGTCAGATTGTGCAGGG + Intergenic
1177803376 21:25849608-25849630 CAGGAGAGAGAGACGGTGCAGGG - Intergenic
1178138772 21:29658336-29658358 CTCAGGAGGCAGAGGTTGCAGGG - Intronic
1178194905 21:30333444-30333466 CCCGGGAGACAGAGTTTGCAGGG + Intergenic
1178335544 21:31739436-31739458 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1178357511 21:31921074-31921096 CCCGGGAGGCAGAGGTTGCAGGG + Intronic
1178405862 21:32322827-32322849 CTGGGGAGGCGGAGGGTGCGAGG - Intronic
1178524992 21:33320176-33320198 CTGAGGAGGCAGAGGTTGCTGGG + Intergenic
1178576840 21:33800939-33800961 CCCGGGAGGCAGAGGTTGCAGGG - Intronic
1178861785 21:36295862-36295884 CCCGGGAGGCAGAGGTTGCAGGG - Intergenic
1178972851 21:37196310-37196332 CTCGGGAGGGAGAGGTTGCAGGG - Intronic
1179275212 21:39885692-39885714 CAGGGGAGGGAGAGGGTGCCTGG - Intronic
1179676056 21:42982883-42982905 CCCGGGAGGCAGAGGTTGCAGGG - Intronic
1179890136 21:44331139-44331161 CTGGGGAGCCCCAGGGTGCCGGG - Intronic
1180047221 21:45313342-45313364 GTGGTGGGGCAGAGGGTGCATGG + Intergenic
1180078296 21:45474216-45474238 CTGGTGAGACAGAGGATGTGAGG + Intronic
1180991421 22:19939442-19939464 CTGGTGAGACAGAAAGTGTAAGG - Intronic
1180994135 22:19956450-19956472 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1181006026 22:20013978-20014000 CTGGGGAGACTGAGGCAGGAGGG - Intronic
1181083401 22:20428378-20428400 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1181084848 22:20435137-20435159 CAGGGAAGACTCAGGGTGCAAGG - Intronic
1181302779 22:21893248-21893270 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1181492026 22:23266463-23266485 CCTGGGAGGCAGAGGTTGCAAGG - Intronic
1181679184 22:24479818-24479840 CCCAGGAGACAGAGGTTGCAGGG + Intergenic
1181762431 22:25067521-25067543 CAGGGAACACAGAGGGTGAAAGG - Intronic
1181982533 22:26775604-26775626 CAGGAGAGCCAGAGGGTGCCAGG + Intergenic
1182401851 22:30084287-30084309 CTGGTAAGACAGAGAGAGCAAGG + Intronic
1182472846 22:30559314-30559336 CCGGGGAGTCAAAGGTTGCAGGG - Intronic
1182975946 22:34624214-34624236 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1183322085 22:37171057-37171079 CCCGGGAGGCAGAGGTTGCAGGG - Intronic
1183367800 22:37416530-37416552 CTGGGGAGCGAGAGGGCTCAAGG + Intronic
1183386076 22:37515485-37515507 CCCGGGAGGCAGAGGCTGCAAGG + Intronic
1183551005 22:38485303-38485325 GTGGGGAGGCAGAGTGTGAAGGG + Exonic
1183746991 22:39697770-39697792 GGGGAGAGACACAGGGTGCAGGG + Intergenic
1183995008 22:41626528-41626550 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1184146921 22:42617197-42617219 CCTGGGAGGCAGAGGCTGCAGGG + Intergenic
1184239964 22:43206790-43206812 CTGGGGGGACAGAGATTGCGGGG + Intronic
1184435039 22:44467701-44467723 CTGGAGAGGCAGAGGTTGCAGGG - Intergenic
1184479432 22:44738109-44738131 CTGGGGATAGTGAGGCTGCAGGG - Intronic
1184488183 22:44793972-44793994 CTGGGGAGACCGAGGGAGCGAGG + Intronic
1184493456 22:44823852-44823874 CTGGCAACACTGAGGGTGCAGGG + Intronic
1184605435 22:45571043-45571065 CTTGGGAGGCGGAGGTTGCAGGG + Intronic
1184616184 22:45640150-45640172 GTGGGGAGGCAGAGGGTGCCAGG + Intergenic
1185244918 22:49768374-49768396 GTGGGGAGTCAGAGGAGGCAGGG + Intergenic
1185325705 22:50224995-50225017 CAGGGGAGACACATGGTCCAAGG + Intronic
1185379520 22:50501928-50501950 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
949509655 3:4757148-4757170 CTGGGTAGGCAGAGAGTGCCTGG - Intronic
949624973 3:5855150-5855172 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
949906734 3:8864220-8864242 CTGTGGAGAGAGAGGGGGAAGGG - Intronic
949990049 3:9571291-9571313 CCCGGGAGGCAGAGGCTGCAGGG - Intergenic
950227185 3:11245275-11245297 CCCGGGAGGCAGAGGTTGCAGGG + Intronic
950467136 3:13162244-13162266 CTTGGAAGACAGAGGGAGAAGGG + Intergenic
950645814 3:14376121-14376143 CCCGGGAGACGGAGGTTGCAGGG - Intergenic
950670464 3:14522499-14522521 CTGGGGAGGCCGAGGGATCAGGG + Intronic
951000710 3:17556088-17556110 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
951072559 3:18349419-18349441 CTGGGCAGACAGAGTCTGGATGG + Exonic
951097513 3:18649134-18649156 CTCTGGAGGCAGAGGTTGCAGGG + Intergenic
951204977 3:19916437-19916459 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
951521660 3:23616205-23616227 CTGGGGAGGTTGAGGCTGCAGGG - Intergenic
951620990 3:24602346-24602368 CTGGGCAGATAGAGTGGGCATGG - Intergenic
951629354 3:24702321-24702343 CCCGGGAGGCAGAGGTTGCAGGG - Intergenic
951957251 3:28271004-28271026 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
952292881 3:32035484-32035506 CTTGGGAGGCAGAGGATGCAGGG + Intronic
952445477 3:33377250-33377272 CTGAGGAGAAAGTGGGTACAGGG - Intronic
952767434 3:36966642-36966664 CCCGGGAGGCAGAGGTTGCAAGG + Intergenic
953321234 3:41973791-41973813 CCCGGGAGGCAGAGGTTGCAGGG - Intergenic
953411530 3:42693039-42693061 GTGGGGATACAGAAGGTGCCAGG - Intronic
953537702 3:43788649-43788671 CCCGGGAGGCAGAGGTTGCAGGG - Intergenic
954014330 3:47673312-47673334 CCCGGGAGGCAGAGGTTGCAGGG + Intronic
954184505 3:48906498-48906520 CTCGGGAGGCAGAGTTTGCAGGG - Intergenic
954212130 3:49103828-49103850 CTGGGGAGGCAGACGATGCCTGG + Intronic
954217327 3:49131884-49131906 ATGGGGAGACTCAGGGTTCATGG + Intronic
954331897 3:49895632-49895654 CTGGGCAGAGAGAGGATGTAGGG + Intronic
954638693 3:52085380-52085402 GTGAGGAGGCAGAGGGTGAAGGG - Intronic
954660461 3:52224274-52224296 CAGGAGAGACAGCGGGTGCAGGG + Exonic
954676883 3:52320874-52320896 CCCGGGAGACAGAGGTTGCAAGG - Intronic
954794225 3:53153345-53153367 GTGGGGAGGCAGAGGGAGGAAGG + Intergenic
956277780 3:67521693-67521715 CATGGGAGGCAGAGGTTGCAGGG - Intronic
957170238 3:76729711-76729733 CATGGGAGGCAGAGGCTGCAGGG - Intronic
957399001 3:79684749-79684771 CCCGGGAGGCAGAGGTTGCAGGG - Intronic
957739230 3:84241932-84241954 CTCGGGAGGCAGAGGTTGCAGGG + Intergenic
957837684 3:85618963-85618985 CCCGGGAGGCAGAGGTTGCAGGG + Intronic
957890320 3:86348788-86348810 GTGGGTAGTCAGAGGGTGGAAGG - Intergenic
957893731 3:86391357-86391379 CCTGGGAGACGGAGGTTGCAGGG + Intergenic
958161338 3:89819232-89819254 CTGTGGAGTCAGAGGGGGCCTGG - Intergenic
958185203 3:90110996-90111018 CTTGTCAGACAGTGGGTGCAGGG - Intergenic
958916359 3:100054798-100054820 ATGGTGAGAGAGAGGGGGCAAGG - Intronic
959705259 3:109333264-109333286 CTCGGGAGGCACAGGTTGCAGGG + Intronic
960057184 3:113284095-113284117 GTGGGGAGATACAGGGTCCAGGG - Intronic
960630332 3:119724090-119724112 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
960638111 3:119803831-119803853 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
960679324 3:120230719-120230741 CAGGAGAGAGAGAGTGTGCAGGG + Intronic
960794558 3:121471664-121471686 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
961534292 3:127560197-127560219 CTGGGGACACAGGAAGTGCAGGG - Intergenic
961664891 3:128488869-128488891 CTGGGGAGACGGAGGCTCGAAGG + Intronic
961927668 3:130498511-130498533 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
962126493 3:132624760-132624782 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
962435629 3:135363992-135364014 CTGGGGTGACAGTGAGTGCAAGG + Intergenic
962829309 3:139126114-139126136 CTGAGGAGACTGAGGCTGAAAGG + Intronic
962991569 3:140582187-140582209 TCTGGGAGACAGATGGTGCAGGG + Intergenic
963435761 3:145263544-145263566 CTCAGGAGGCAGAGGTTGCAGGG + Intergenic
963561283 3:146869149-146869171 AAGGGGAGAGAGAGGGAGCAGGG - Intergenic
963678409 3:148343918-148343940 ATGTACAGACAGAGGGTGCATGG - Intergenic
964564088 3:158030626-158030648 CTGAGGAAACAGAGGCTTCAAGG - Intergenic
964976728 3:162630319-162630341 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
965574812 3:170207033-170207055 CCTGGGAGACGGAGGTTGCAGGG + Intergenic
965688788 3:171333479-171333501 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
965910761 3:173772540-173772562 CCTGGGAGACGGAGGTTGCAGGG + Intronic
966039354 3:175462173-175462195 CTTGGGAGACAGAGGGTATTGGG + Intronic
966203943 3:177387095-177387117 CCCGGGAGGCAGAGGTTGCAGGG - Intergenic
966729694 3:183140329-183140351 CACGGGAGGCAGAGGTTGCAGGG + Intronic
966773861 3:183527021-183527043 CCCGGGAGGCAGAGGTTGCAGGG + Intronic
966852914 3:184175512-184175534 CTGGGGAGACAGAGCCTGCTTGG - Intronic
967355733 3:188568862-188568884 GTGGGCAGACAGTGGCTGCAGGG + Intronic
967702214 3:192606376-192606398 GGAGGGAGAAAGAGGGTGCAGGG + Intronic
967865821 3:194188938-194188960 CCGTGGAGACAAGGGGTGCAGGG - Intergenic
968037856 3:195563453-195563475 ATGGGGAGACAGAGGGCAAAAGG - Intergenic
968074324 3:195808289-195808311 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
968297305 3:197586646-197586668 CCCGGGAGGCAGAGGTTGCAGGG - Intergenic
968511101 4:996315-996337 CTGGGGAGACCCAGGGGGCTGGG + Intronic
968514031 4:1008975-1008997 CTGGGAAGACAGAGGTGGCCAGG - Intergenic
968614233 4:1570167-1570189 CTGGGTAGGAAGAGGGTGCAAGG + Intergenic
968747236 4:2366446-2366468 TTGGTGAGACAGCAGGTGCAGGG - Intronic
968821215 4:2853182-2853204 CCTGGGAGACAGAGGTTGCAGGG - Intronic
968933242 4:3595508-3595530 CTGGGGAGACTGAGGCAGCTGGG - Intergenic
969081769 4:4624640-4624662 CTGGGAAGGCAGAAGGTGAAAGG + Intergenic
969217596 4:5734799-5734821 CTGGGGATAGAGGGGGTGAAGGG - Intronic
969261150 4:6034723-6034745 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
969353492 4:6611716-6611738 CCCGGGAGGCAGAGGTTGCAGGG + Intronic
969393556 4:6906794-6906816 CTGGGGAGGCAGAGGTTGCAGGG - Intergenic
969571386 4:8010741-8010763 ATGGAGAGGCAGAGGGGGCAGGG + Intronic
969696326 4:8737193-8737215 CTGGGGACGCAGAGGCTGTAAGG + Intergenic
970246019 4:14064382-14064404 CTCAGGAGGCAGAGGTTGCAGGG + Intergenic
970471772 4:16386239-16386261 CTAGGGAGACAGAGCCTGGAGGG + Intergenic
970659069 4:18264251-18264273 CTGGAGACACAGAGAGTGAAGGG + Intergenic
970708945 4:18839238-18839260 CCGGGGAGGCAGAGGATGCAGGG + Intergenic
970720798 4:18986769-18986791 CAGAGGAGACAGAGCATGCAGGG - Intergenic
970939611 4:21616082-21616104 CTGGGGAGCCAGAGCTTGTAGGG - Intronic
971002488 4:22338583-22338605 CTGGGGAGAGAAAGAGAGCATGG - Intergenic
971482699 4:27128370-27128392 CCCGGGAGGCAGAGGTTGCAGGG - Intergenic
971915264 4:32862093-32862115 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
972052682 4:34758817-34758839 CCCGGGAGGCAGAGGTTGCAGGG + Intergenic
972495408 4:39629697-39629719 CTGGGGAGGCTGAGGCTGCAGGG - Intronic
972636757 4:40891125-40891147 CTGGGGAAACTGAGGCTGAAAGG + Intronic
972820293 4:42694222-42694244 CCTGGGAGACAGAGGTTGCAGGG - Intergenic
973320239 4:48802643-48802665 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
973330367 4:48906237-48906259 CTGAGGAAACAGAGGGTCCCCGG - Intronic
973976807 4:56271027-56271049 CCCGGGAGGCAGAGGTTGCAGGG + Intronic
974056232 4:56985474-56985496 CCCAGGAGACAGAGGTTGCAGGG - Intronic
974090505 4:57305817-57305839 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
974874561 4:67687109-67687131 CCCGGGAGGCAGAGGTTGCAGGG - Intronic
974876904 4:67712868-67712890 CTGGGGAGACCCAGGGGGCTGGG + Intergenic
975056771 4:69943257-69943279 CCCGGGAGGCAGAGGTTGCAGGG - Intronic
975385162 4:73749545-73749567 CAGAGTAGACAGAGGGTGGAGGG + Intergenic
975475873 4:74822744-74822766 CTGGGGAGAGAGAGTGTGGTTGG + Intergenic
975758925 4:77598881-77598903 CTCGGGAGGCAGAGGTTGCAGGG - Intronic
976048147 4:80977680-80977702 CCGGGGAGGCAGAGGTTGCAGGG - Intergenic
976260049 4:83136778-83136800 CTGGGGACCCAGAGTGTGAAGGG - Intronic
976291423 4:83422142-83422164 CCCAGGAGACAGAGGTTGCAGGG + Intronic
976730825 4:88259188-88259210 CCCGGGAGGCAGAGGTTGCAGGG + Exonic
977872799 4:102113342-102113364 CCGGGGAGGTAGAGGTTGCAGGG - Intergenic
978502155 4:109421031-109421053 CAGGAGAGACAGAGAGTGAAGGG + Intergenic
979021088 4:115499065-115499087 CCCGGGAGGCAGAGGTTGCAGGG + Intergenic
979168865 4:117573496-117573518 CATGGGAGGCAGAGGTTGCAGGG + Intergenic
979212346 4:118120318-118120340 CTCAGGAGGCAGAGGGAGCAGGG + Intronic
979237317 4:118415906-118415928 CTTGGGAGGCAGAGGTTGCAGGG + Intergenic
979347694 4:119607627-119607649 CTGGGGAGACTGAGGCAGGAGGG + Intronic
980134381 4:128845846-128845868 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
980693160 4:136321403-136321425 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
980693856 4:136330119-136330141 CCTGGGAGTCAGAGGTTGCAGGG + Intergenic
980738106 4:136917427-136917449 CTGTGGAGCCAGAGGGAGCCAGG + Intergenic
981057536 4:140380271-140380293 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
981093954 4:140759582-140759604 CACGGGAGACGGAGGTTGCAAGG + Intergenic
981145359 4:141317621-141317643 CTGGAGAAACAAAGTGTGCAAGG + Intergenic
981312747 4:143312989-143313011 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
981999772 4:151011520-151011542 CTCAGGAGGCAGAGGTTGCAGGG + Intronic
982329888 4:154169687-154169709 CCCGGGAGGCAGAGGTTGCAGGG - Intergenic
982472023 4:155804119-155804141 CTGGGGAGATAGAGATTTCATGG + Intronic
982631647 4:157838014-157838036 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
982687345 4:158506808-158506830 CCTGGGAGGCAGAGGTTGCAAGG + Intronic
983018677 4:162647252-162647274 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
983306728 4:165999417-165999439 CAGGAGAGAGAGAGAGTGCAGGG + Intronic
984021000 4:174484704-174484726 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
984243604 4:177248069-177248091 CTTGGGAGGCGGAGGTTGCAGGG - Intronic
984779090 4:183507174-183507196 CCCGGGAGGCAGAGGTTGCAGGG - Intronic
984919954 4:184754765-184754787 CTTGGGAGGCAGAGGTTGCGGGG + Intergenic
984996350 4:185434109-185434131 CTCGGGAGGCGGAGGTTGCAGGG + Intronic
985066550 4:186127759-186127781 CTTGGAAGGCAGAGGTTGCAGGG - Intronic
985200139 4:187476166-187476188 CAGGGGAAATTGAGGGTGCAGGG + Intergenic
985234109 4:187853901-187853923 CTGGGGAGGTTGAGGCTGCAGGG - Intergenic
985356630 4:189126764-189126786 CTGGAGAGAGAGAGAGTGAAGGG + Intergenic
985482360 5:122493-122515 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
985566512 5:621015-621037 ATGGGGAAGAAGAGGGTGCAGGG + Intronic
985767174 5:1786211-1786233 CTGGGGGGTCAGATGGGGCAGGG - Intergenic
985843017 5:2323584-2323606 CAGGGGAGACAGGGAGTGAAAGG + Intergenic
986691869 5:10319949-10319971 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
986705750 5:10453332-10453354 CTGGGTAGACAGGAGGTGCTCGG + Intronic
988006328 5:25416546-25416568 CTTGGGAGGCAGAGGTTGCAGGG - Intergenic
988592294 5:32559068-32559090 CTCGGGAGGCAGAGGTTGCAGGG + Intronic
988856803 5:35234965-35234987 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
989068888 5:37490110-37490132 CTGAGGTGACTGATGGTGCAGGG + Intronic
989571356 5:42948894-42948916 CTCAGGAGGCAGAGGTTGCAGGG + Intergenic
990063084 5:51676326-51676348 CCCGGGAGGCAGAGGTTGCAGGG - Intergenic
990141348 5:52707903-52707925 CTATGGAGGCAGAGGGTGTATGG - Intergenic
990364619 5:55057721-55057743 AGTGGGAGACAGAGGGTGGACGG + Intergenic
990407530 5:55505979-55506001 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
990574162 5:57108651-57108673 CCCGGGAGGCAGAGGTTGCAGGG + Intergenic
991589011 5:68229596-68229618 CAGGGTAGACAGAGGGTGCGAGG + Intronic
991698633 5:69297139-69297161 CTTGGGAGGCAGAAGTTGCAGGG - Intronic
992453186 5:76891748-76891770 GTAGATAGACAGAGGGTGCAGGG + Intronic
992911294 5:81398473-81398495 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
993310034 5:86318090-86318112 CCTGGGAGGCAGAGGATGCAGGG - Intergenic
994217376 5:97153092-97153114 CTGGGGAGACTGAGGTGGGAGGG - Intronic
994351422 5:98750672-98750694 TTCGGGAGGCAGAGGTTGCAGGG + Intergenic
994382211 5:99084869-99084891 CCCGGGAGGCAGAGGTTGCAGGG - Intergenic
996847411 5:127915455-127915477 CCCGGGAGGCAGAGGCTGCAGGG - Intergenic
997052782 5:130402313-130402335 CCCGGGAGGCAGAGGTTGCAGGG + Intergenic
997116657 5:131132462-131132484 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
997325855 5:133020366-133020388 CCTGGGAGGCAGAGGCTGCAAGG + Intronic
997514412 5:134476504-134476526 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
997689468 5:135816077-135816099 CAGGAGAGAGAGAGCGTGCAGGG + Intergenic
997690605 5:135825413-135825435 CTGCAGAGACAGAGGAGGCAAGG + Intergenic
997700639 5:135896236-135896258 CTGGGGAGACAGAGCGGGTTGGG + Intergenic
997737495 5:136224783-136224805 CTGTGGAAGCAGAGGGTGGAGGG - Intronic
997937945 5:138130848-138130870 CCCGGGAGGCAGAGGTTGCAGGG + Intronic
998114774 5:139528071-139528093 GTTGGGAGACAGAAGCTGCATGG - Intronic
998471927 5:142390271-142390293 CTGGGGAGAGGGAGAGTGCAGGG + Intergenic
999147466 5:149405776-149405798 CTGGGGACACAGAGCCTGCCAGG + Intergenic
999199627 5:149806471-149806493 CAGGAGAGACCGAGGGAGCAGGG - Intronic
999208706 5:149869252-149869274 CTCGGGAGGCGGAGGTTGCAGGG + Intronic
999290392 5:150421741-150421763 CTCAGGAGGCAGAGGTTGCAGGG - Intergenic
999305990 5:150519950-150519972 CTGGGTGGACAGAAGGTCCAGGG + Intronic
999762873 5:154716193-154716215 CCCGGGAGGCAGAGGGTGCAGGG - Intronic
999831272 5:155322519-155322541 CTGGGGAGGGAGAGGGTCCCAGG + Intergenic
1000317383 5:160105460-160105482 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1001236505 5:170034342-170034364 CTGGGGAGAAAGACTGTGCTGGG - Intronic
1001625153 5:173126214-173126236 CCTGGGAGGCAGAGGCTGCAGGG - Intronic
1002000403 5:176193698-176193720 CTGTGCTGACAGCGGGTGCAGGG - Intergenic
1002100333 5:176854535-176854557 CTGGGGAAGCAGAGGGGTCAGGG - Intronic
1002127947 5:177060730-177060752 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1002182306 5:177437028-177437050 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1002239852 5:177831147-177831169 CCCGGGAGGCAGAGGTTGCAGGG - Intergenic
1002878796 6:1234365-1234387 CTGGAGAGGCACAGGCTGCAGGG - Intergenic
1003042253 6:2699365-2699387 CTCGGGAGATGGAGGTTGCAGGG - Intronic
1003101219 6:3177828-3177850 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1003289860 6:4771187-4771209 CCCGGGAGGCAGAGGTTGCAAGG - Intronic
1003310887 6:4968960-4968982 CTTGGGAGATGGAGGTTGCAGGG + Intergenic
1003636441 6:7835910-7835932 CCCGGGAGGCAGAGGTTGCAGGG - Intronic
1004142050 6:13027137-13027159 GTGGGGAGAAAGAGGGTACCGGG + Intronic
1004215458 6:13699784-13699806 CTTGGGAGGCAGAAGTTGCAAGG + Intronic
1004227003 6:13794724-13794746 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1004394890 6:15239151-15239173 CCCAGGAGACAGAGGTTGCATGG - Intergenic
1004444033 6:15681394-15681416 CCCAGGAGACAGAGGTTGCAGGG - Intergenic
1004547921 6:16616462-16616484 CCTGGGAGGCAGAGGCTGCAGGG + Intronic
1004726803 6:18318926-18318948 CCGGGGAGGCAGAGGTTGCGGGG - Intergenic
1004956591 6:20734071-20734093 CCTGGGAGATAGAGGTTGCAGGG + Intronic
1005579130 6:27216970-27216992 CCCGGGAGGCAGAGGTTGCAGGG + Intergenic
1005632675 6:27723232-27723254 CTGGGGAGACTGAGGCAGGAGGG + Intergenic
1005756094 6:28926017-28926039 CCTGGGAGACAGAGGTTGCAGGG + Intergenic
1006080589 6:31563681-31563703 CCCGGGAGGCAGAGGTTGCAGGG - Intergenic
1006125627 6:31836036-31836058 CCCGGGAGGCAGAGGTTGCAGGG - Intronic
1006298106 6:33179022-33179044 GTGGGGAGACAGGGCCTGCAGGG - Intronic
1006450477 6:34103121-34103143 ATGGGGAGACAGAGGTGGCATGG - Intronic
1006695613 6:35928041-35928063 CCTGGGAGACAGAGGTTTCAGGG + Intergenic
1006851866 6:37104286-37104308 CCCGGGAGGCAGAGGTTGCACGG - Intergenic
1007256181 6:40530612-40530634 CTGGGGAGAACCAGGGTTCAGGG - Intronic
1007393568 6:41564341-41564363 CCCGGGAGACGGAGGTTGCAGGG + Intronic
1007421525 6:41722619-41722641 ATGGGGTGACTGAGGGTGAAGGG + Intronic
1007693411 6:43717207-43717229 CTTGGGAGACAGAGGATCCTGGG - Intergenic
1007717989 6:43868376-43868398 CTGGAGACATAGAGGGTACATGG - Intergenic
1007720898 6:43884917-43884939 CTGGGGAGACATGGGTTGGATGG - Intergenic
1007744835 6:44037237-44037259 CTCGGGAGGCGGAGGTTGCAGGG + Intergenic
1007899831 6:45400239-45400261 GAGGGGAGACAGAGGGAGGAAGG + Intronic
1008272283 6:49504081-49504103 GTGGGGTGACAGAGGGTAAAAGG + Intronic
1010022142 6:71173209-71173231 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1010231516 6:73539364-73539386 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1010391208 6:75339870-75339892 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1010442921 6:75919041-75919063 CGCGGGAGGCAGAGGTTGCAGGG + Intronic
1010830947 6:80528252-80528274 ATTGGGAGACAGAGCTTGCAGGG + Intergenic
1011043546 6:83057380-83057402 CTGGGGATACAGAGTGAACAAGG - Intronic
1012405392 6:98890841-98890863 CTAGGGAGGCGGAGGTTGCAGGG + Intronic
1012578818 6:100837723-100837745 CTGGGGAGATTGGGGGTGGAGGG + Intronic
1012638090 6:101572922-101572944 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1012649233 6:101732894-101732916 CTGGAGAGAAAGAGAGAGCAAGG + Intronic
1013074520 6:106759491-106759513 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1013137580 6:107297456-107297478 CTTGGGAGGCGGAGGTTGCAGGG - Intronic
1013716541 6:112969044-112969066 CAGGGGAGAGAGAGTGTTCAGGG + Intergenic
1014011058 6:116476026-116476048 CCAGGGAGTCAGAGGTTGCAGGG + Intergenic
1014109773 6:117607538-117607560 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1014253080 6:119134810-119134832 CTGGGGAGAGAGAGGTTCCAGGG + Intronic
1014261638 6:119225049-119225071 CCCGGGAGGCAGAGGTTGCAGGG + Intronic
1014419847 6:121229941-121229963 CTGGAGAGAGAGAGAGTGAAGGG - Intronic
1015144266 6:129968024-129968046 CTGGAGAAACAGAGTTTGCAAGG + Intergenic
1015284109 6:131465336-131465358 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1015524571 6:134163407-134163429 CCAGGGAGGCAGAGGATGCAGGG + Intergenic
1015680979 6:135808138-135808160 CTGGAGAGACAGAGGGTGACTGG - Intergenic
1015737129 6:136413084-136413106 CTTGGGAGGCAGAAGATGCAGGG + Intronic
1016466297 6:144328857-144328879 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1016478334 6:144453196-144453218 CCCGGGAGGCAGAGGTTGCAGGG - Intronic
1016860365 6:148711961-148711983 GTGGGGAGGGATAGGGTGCATGG - Intergenic
1017025753 6:150179091-150179113 CTGGGGAGACCCAGGGAGGAAGG + Intronic
1017103585 6:150867871-150867893 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1017309010 6:152955051-152955073 CTTGGGAGGCTGAGGTTGCAGGG + Intergenic
1017506684 6:155074929-155074951 CTGGGGAGTCAGAGGGTGGAGGG + Intronic
1018087086 6:160312193-160312215 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1018381388 6:163261125-163261147 CCGGGAAGACAGAGGGAGGAGGG - Intronic
1018475449 6:164135668-164135690 CGTGGGAGACAGAGGGTGAAAGG - Intergenic
1018701778 6:166432917-166432939 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1018868254 6:167761755-167761777 CTGGGTTGAGAGAGGCTGCATGG - Intergenic
1019020699 6:168915259-168915281 CTTGGGAGAGAGAGGATTCAGGG + Intergenic
1019503390 7:1376952-1376974 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1019558884 7:1646103-1646125 CCTGGGAGGCAGAGGCTGCAGGG - Intergenic
1019740718 7:2671569-2671591 CGGGGGAGGCAGAGGGTGCGTGG + Intergenic
1019773203 7:2896628-2896650 CCCGGGAGGCAGAGGTTGCAGGG - Intergenic
1019885364 7:3899728-3899750 CTGGGGAGAGAGATGCAGCATGG - Intronic
1019920839 7:4162473-4162495 CACGGGAGGCAGAGGTTGCAGGG - Intronic
1019974595 7:4570576-4570598 CTGGGGATGCAGAGGTTGCAAGG + Intergenic
1020031367 7:4935108-4935130 CCCGGGAGGCAGAGGTTGCACGG + Intronic
1020043832 7:5024829-5024851 GTTGGGAGACAGAGGCTGGATGG + Intronic
1020058275 7:5133644-5133666 CTTGGGAGGCAGAGGTTGCAGGG + Intergenic
1020061714 7:5157361-5157383 CCCGGGAGCCAGAGGCTGCAGGG + Intergenic
1020063464 7:5169649-5169671 CTTGGGAGGCAGAGGTTGCAGGG + Intergenic
1020131525 7:5561443-5561465 CACGGGAGGCAGAGGCTGCAGGG + Intronic
1020166445 7:5811309-5811331 CCTGGGAGCCAGAGGCTGCAGGG - Intergenic
1020166973 7:5814922-5814944 CCTGGGAGGCAGAGGCTGCAGGG + Intergenic
1020169832 7:5836511-5836533 CCCGGGAGGCAGAGGTTGCAGGG - Intergenic
1020176324 7:5885042-5885064 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1020190871 7:5996477-5996499 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1020460453 7:8424197-8424219 CCCGGGAGGCAGAGGTTGCAGGG + Intergenic
1020705949 7:11544264-11544286 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1020774478 7:12435829-12435851 CAGGAGAGACAGAGAGTGCAGGG + Intergenic
1021679474 7:23115617-23115639 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1021696685 7:23282933-23282955 CTCGGCAGGCAGAGGTTGCAGGG + Intergenic
1022091441 7:27110353-27110375 CTGGGGCGGCGGCGGGTGCAGGG + Exonic
1022631866 7:32093011-32093033 CTGGGGACTAAGAGGGTTCATGG + Intronic
1022648488 7:32253602-32253624 CTGGGGAAAGAGAGGATTCAGGG + Intronic
1022822648 7:33976226-33976248 CCTGGGAGTCAGAGGCTGCAGGG - Intronic
1023582971 7:41701272-41701294 GTGGTGGGGCAGAGGGTGCAGGG + Intronic
1023647165 7:42330092-42330114 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1023787480 7:43722473-43722495 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1023904890 7:44514935-44514957 CTTGGGAGGCAGAGGTTGCAGGG + Intronic
1023992753 7:45139212-45139234 CTGGGGAGACAGAGAGAGGGCGG - Intergenic
1024932683 7:54680391-54680413 CTGGGGACACAGAAGGTGGTGGG - Intergenic
1025155915 7:56605849-56605871 CCCGGGAGGCAGAGGTTGCAGGG + Intergenic
1025190328 7:56891299-56891321 ATGGGCAGACACAGGGTGGAAGG - Intergenic
1025321413 7:58098059-58098081 CTTGGGAGGCTGAGGCTGCAGGG - Intergenic
1025681611 7:63685621-63685643 ATGGGCAGACACAGGGTGGAAGG + Intergenic
1025988968 7:66480613-66480635 CCTGGGAGACAGAGGTTGCAGGG - Intergenic
1026131609 7:67625621-67625643 CGGGGAAGACGGAGGGTTCAAGG - Intergenic
1026286008 7:68963446-68963468 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1026748779 7:73033447-73033469 CCCGGGAGGCAGAGGTTGCAAGG + Intergenic
1026752427 7:73061592-73061614 CCCGGGAGGCAGAGGTTGCAAGG + Intergenic
1026756078 7:73089719-73089741 CCCGGGAGGCAGAGGTTGCAAGG + Intergenic
1027034975 7:74918713-74918735 CCCGGGAGGCAGAGGTTGCAAGG + Intergenic
1027091327 7:75303710-75303732 CCCGGGAGGCAGAGGTTGCAAGG - Intergenic
1027094971 7:75331681-75331703 CCCGGGAGGCAGAGGTTGCAAGG - Intergenic
1027202158 7:76070979-76071001 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1027211931 7:76156631-76156653 CCTGGGAGACAGAGGTTGCAGGG - Intergenic
1027218919 7:76201928-76201950 GCGGGGAGGCAGAGGGTGCGGGG + Exonic
1027324368 7:77035993-77036015 CCCGGGAGGCAGAGGTTGCAAGG + Intergenic
1027390838 7:77702039-77702061 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1028558903 7:92151871-92151893 CCCGGGAGGCAGAGGTTGCAGGG + Intronic
1028960225 7:96740327-96740349 CTGGGGTGACAGAGGGAGTTAGG + Intergenic
1028989796 7:97036764-97036786 CTGAGGAGGCAGAAGTTGCAGGG - Intergenic
1029244178 7:99186665-99186687 CCCAGGAGACAGAGGTTGCAGGG + Intronic
1029478356 7:100798618-100798640 TAGGGGAGACAGAAGGAGCAGGG + Intergenic
1029531424 7:101127768-101127790 CTGGGGAGGCGGAGGCTGCAGGG + Intronic
1030002726 7:105082619-105082641 CAGGGGTGACAGAGGGAGAAGGG + Intronic
1030876314 7:114817656-114817678 CCCGGGAGGCAGAGGTTGCAGGG - Intergenic
1031039884 7:116828422-116828444 CCCGGGAGGCAGAGGTTGCAGGG - Intronic
1031622492 7:123951695-123951717 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1031652209 7:124304473-124304495 GAGGAGAGACAGAGAGTGCAGGG - Intergenic
1031767895 7:125804475-125804497 CTCTGGAGACAGAGGCTGAATGG - Intergenic
1031936139 7:127737497-127737519 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1032081205 7:128859348-128859370 CTGGGGAGGCAGAGGCGGCCTGG + Intergenic
1032200418 7:129818647-129818669 CCTGGGAGGCAGAGGTTGCAAGG - Intergenic
1032376745 7:131427627-131427649 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1032496749 7:132368532-132368554 CTGGGCAGACAGAGGGTGACAGG - Intronic
1032522822 7:132559306-132559328 GTGGGGAGAAACAGGGGGCAGGG - Intronic
1032559460 7:132873487-132873509 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1032560212 7:132883027-132883049 CAGGAGAGAGAGAGCGTGCAGGG - Intronic
1032862536 7:135894102-135894124 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1033266271 7:139889895-139889917 CTAAGGAGACATTGGGTGCAAGG + Intronic
1033796881 7:144855965-144855987 CCTGGGAGACAGAGGTTGCAGGG - Intergenic
1034052516 7:147998185-147998207 CCCGGGAGGCAGAGGTTGCAGGG - Intronic
1034119646 7:148615973-148615995 CCCGGGAGGCAGAGGTTGCAGGG - Intergenic
1034256526 7:149727759-149727781 CTGGGGCAACAGAGGGAGCCGGG - Intronic
1034263825 7:149772306-149772328 CTGGGGAGACAGAGGGGGAAGGG - Intronic
1034295196 7:149966233-149966255 CTGGAGAAACAGAGGCTGGAAGG + Intergenic
1034398620 7:150846735-150846757 CTGGGGAGATGCAGGGCGCAGGG - Intronic
1034492509 7:151401365-151401387 CTGAGGAAACAGAGGGTTTAGGG - Intronic
1034526784 7:151669136-151669158 CTGGGGAAAGAGTGAGTGCAGGG - Intronic
1034613535 7:152394327-152394349 GTGGGGAGTCAGATTGTGCAGGG - Intronic
1034641506 7:152607678-152607700 CATGGGAGACGGAGGTTGCAGGG - Intergenic
1034810867 7:154130714-154130736 CTGGAGAAACAGAGGCTGGAAGG - Intronic
1034931301 7:155166005-155166027 CTGGGGAGCCAGAAGGGGGATGG - Intergenic
1035494582 7:159312196-159312218 CTGGGGAGGTTGAGGCTGCAGGG + Intergenic
1035694996 8:1589510-1589532 CTGGGGAGGTTGAGGCTGCAGGG - Intronic
1035772259 8:2156968-2156990 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1035987115 8:4446469-4446491 CTTGGGAGACTGAGGCTGCAGGG + Intronic
1036076958 8:5512796-5512818 CTGGGGTGACAGGAGGTGGAAGG + Intergenic
1036181949 8:6593428-6593450 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1036462153 8:8962986-8963008 CTGGGCAAAGAGAGGATGCATGG + Intergenic
1036661941 8:10714580-10714602 CTCGGGAGACACAGGCAGCAGGG + Intergenic
1036788563 8:11703443-11703465 CTGGGGAGCCAGGCGGTCCAGGG - Intronic
1036911673 8:12762469-12762491 CCCGGGAGGCAGAGGTTGCAGGG + Intergenic
1036965325 8:13290982-13291004 CCCGGGAGGCAGAGGTTGCAGGG - Intronic
1037254579 8:16938901-16938923 CCCAGGAGACAGAGGTTGCAGGG + Intergenic
1037342499 8:17861424-17861446 CTGGGGAGGTGGAGGTTGCAGGG - Intergenic
1038141558 8:24850585-24850607 CCCAGGAGACAGAGGTTGCAGGG + Intergenic
1038234493 8:25738808-25738830 CTGGGAAGAGAATGGGTGCAAGG - Intergenic
1038327058 8:26579309-26579331 ATGGGGAGAGGGAGGGAGCAGGG - Intronic
1038575270 8:28699582-28699604 CCCGGGAGGCAGAGGTTGCAGGG - Intronic
1038958063 8:32488745-32488767 ATGGAGAGACAGTGGGTGGAGGG + Intronic
1039347503 8:36723570-36723592 CCTGGGAGGCAGAGGATGCAGGG + Intergenic
1039417482 8:37408133-37408155 CCCGGGAGGCAGAGGTTGCAGGG + Intergenic
1039477057 8:37844618-37844640 CAGTGGAGACAGGGGGTACAGGG + Exonic
1039495013 8:37974070-37974092 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1039991822 8:42494920-42494942 CCCGGGAGGCAGAGGTTGCAGGG - Intronic
1040352964 8:46587029-46587051 CTGGTGAGACAGAAGGTGTAAGG - Intergenic
1040456677 8:47605167-47605189 CTGAGGAGACAGAGGAGGCTGGG + Intronic
1040538079 8:48327027-48327049 CTGGGGACACAGAGGTTGCCTGG - Intergenic
1041266363 8:56069372-56069394 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1041430886 8:57779389-57779411 CTGGTGAGAGAGAGGACGCAGGG + Intergenic
1042025064 8:64414589-64414611 ATTGGGAGACAGAGGGAGAAGGG - Intergenic
1042242791 8:66681698-66681720 CTGGGGAGGCGGTGGTTGCAGGG - Intronic
1042420662 8:68584881-68584903 CTGTGGAGCCAGAGGGAGAAGGG - Intronic
1042579223 8:70258023-70258045 CTGGGGAGACTGAGGTGGGAGGG - Intronic
1042810992 8:72824779-72824801 CTGGGAAGAGAGAGAGTGGATGG + Intronic
1043253241 8:78102075-78102097 CTTGGGAGGCGGAGGTTGCAGGG + Intergenic
1043285559 8:78525151-78525173 CTGGGTAAACAGATGGTGCATGG - Intronic
1043511699 8:80956609-80956631 CTGGGAACACTGAGGGTGGAGGG + Intergenic
1043755402 8:83997526-83997548 AGAGGGAGACAGAGGTTGCAGGG + Intergenic
1044295287 8:90519806-90519828 CAGGAGAGACAGAGGGTGAAGGG - Intergenic
1045341334 8:101257358-101257380 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1045622377 8:103995461-103995483 CAGTGGAGACAGAGGGAGAATGG + Intronic
1045941705 8:107746225-107746247 CTTGGGAGGCAGAGGTTGCAGGG + Intergenic
1046174683 8:110560050-110560072 ATGGGGAGCCAGAAGGTGGAGGG + Intergenic
1046199875 8:110911143-110911165 CTGGGGATACAGAGGGCGGGGGG + Intergenic
1046461061 8:114536770-114536792 CCCGGGAGGCAGAGGTTGCAGGG - Intergenic
1046641494 8:116736584-116736606 CCGGGGAGGCAGAGTTTGCAGGG + Intronic
1047314057 8:123716159-123716181 CCCGGGAGGCAGAGGCTGCAGGG - Intronic
1047322195 8:123796983-123797005 CCTGGGAGGCAGAGGTTGCAGGG + Intronic
1047379546 8:124346154-124346176 CAAGAGAGACAGAGCGTGCAGGG + Intronic
1047464296 8:125097581-125097603 CAGGGGAGACATAGGCTTCACGG - Intronic
1047779035 8:128096944-128096966 CTGGGGAGGCAGAGGAAACATGG - Intergenic
1048223348 8:132563231-132563253 CTGGGGAGAGGGATGTTGCAGGG + Intergenic
1048334930 8:133495573-133495595 CTGGGTAGACAAAGAATGCAAGG + Intronic
1048427550 8:134336820-134336842 CTGGGGAGACACAAGGAGCAAGG - Intergenic
1048841486 8:138570437-138570459 CTGGAGAGGCAGAGTGTGCTGGG - Intergenic
1048891745 8:138954399-138954421 CTAGGGAGGCTGAGGTTGCAGGG + Intergenic
1048993849 8:139776918-139776940 CAGGAGCTACAGAGGGTGCAAGG - Intronic
1049250667 8:141587254-141587276 CTGGGGACACAGAGGTTGGCAGG + Intergenic
1049376172 8:142290177-142290199 CTGGGGCGACAGAGAGGCCAAGG + Intronic
1049399567 8:142418881-142418903 ATGGGGAGACTGAGGCTGGAAGG + Intergenic
1049401655 8:142430337-142430359 CAGGGGAAACACAGGTTGCAGGG - Intergenic
1049503130 8:142978725-142978747 CTGGAGAGACAGAGGGGACATGG + Intergenic
1049574082 8:143382475-143382497 CTAAGGAGCCAGAGGGAGCATGG + Exonic
1049860386 8:144894291-144894313 CTGGGCAGACAGACGGTGCTGGG - Intronic
1050342706 9:4656361-4656383 CACAGGAGACAGAGGTTGCAGGG + Intronic
1050798912 9:9584221-9584243 AAGGGGAGACAGAGGTTGCAGGG - Intronic
1050995924 9:12217651-12217673 CCCGGGAGGCAGAGGGTGCAGGG - Intergenic
1051185896 9:14461024-14461046 CTGAGGAACAAGAGGGTGCACGG - Intergenic
1051278378 9:15418215-15418237 CTTGGGAAACAGCAGGTGCAAGG + Intergenic
1051293060 9:15565162-15565184 CTCGGGAGGCGGAGGTTGCAGGG - Intronic
1051651644 9:19332430-19332452 CCCGGGAGGCAGAGGTTGCAGGG - Intronic
1053259258 9:36647562-36647584 CTCGGGAGGCGGAGGTTGCAGGG - Intronic
1053428714 9:38027835-38027857 CTGGGGAGGCAGAAGGGACAGGG + Intronic
1053514770 9:38721578-38721600 TTGGGAAGACAGAGGCCGCATGG + Intergenic
1054456889 9:65436301-65436323 CTGGGGAGACTGAGGCAGCTGGG + Intergenic
1054866914 9:70012323-70012345 CTGGGGTCACAGAAGTTGCAAGG + Intergenic
1055150933 9:72998746-72998768 CTGTGGAGAAAGAGGGTGTATGG - Intronic
1055243894 9:74217703-74217725 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1055395445 9:75869016-75869038 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1055868948 9:80850956-80850978 CTGGAGAGACAGAGGTTACATGG + Intergenic
1056216557 9:84410344-84410366 CTGGGGAGACAGAGGCTATAGGG + Intergenic
1056388574 9:86119468-86119490 GTCAGGAGACAGAGGGAGCAAGG + Intergenic
1056412324 9:86342231-86342253 CTCGGGAGACTGAGGTTGGAGGG - Intronic
1056654030 9:88494858-88494880 CCCGGGAGGCAGAGGCTGCAGGG - Intergenic
1057175119 9:92991152-92991174 CTAGGGAGGCAGAGGTTGCAGGG - Intronic
1057181996 9:93035350-93035372 CTGGGGAGAGGGATGGTGCGGGG - Exonic
1057326311 9:94067675-94067697 CTTGGGAGGCAGAGGTTACAGGG - Intronic
1057392709 9:94652901-94652923 CTGGGGGGCCAGATGGTGCAGGG - Intergenic
1057999741 9:99852837-99852859 CTGGAAAGACAGATGGTGGAGGG - Intronic
1058059976 9:100484763-100484785 CCGGGGAGGCGGAGGTTGCAGGG - Intronic
1058120731 9:101135833-101135855 CTGGGCAGACAGAGGCAGGAAGG - Intronic
1058442754 9:105024933-105024955 TTGGGGAGGCAGAGGATGCTGGG + Intergenic
1058703421 9:107619749-107619771 CTGGGCAGACAGAGGAACCAGGG + Intergenic
1058817202 9:108695130-108695152 CCCGGGAGGCAGAGGTTGCAGGG + Intergenic
1058952942 9:109920453-109920475 CCCAGGAGACAGAGGCTGCAAGG - Intronic
1058988959 9:110236208-110236230 CCCGGGAGGCAGAGGTTGCAGGG + Intergenic
1059115034 9:111593759-111593781 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1059198711 9:112394999-112395021 CTGGTGAGACAGAAAGTGTAAGG + Intronic
1059653295 9:116334834-116334856 CAGGGGAGACAGAGGGGCCGAGG - Intronic
1059880678 9:118685615-118685637 CTGAGGAAACAGAGAGGGCATGG + Intergenic
1060104819 9:120866966-120866988 CTGGAGAGACAGAGGAGCCAAGG + Intronic
1060110989 9:120906050-120906072 CTGGGGAAACAGGTGGGGCAGGG - Intronic
1060275234 9:122177506-122177528 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1060515070 9:124260467-124260489 CCCAGGAGGCAGAGGGTGCAGGG - Intronic
1060522149 9:124300057-124300079 CTGAGGACACAGAGGGAGAAGGG + Intronic
1060651355 9:125329764-125329786 CCCGGGAGGCAGAGGTTGCAGGG - Intronic
1060691723 9:125667393-125667415 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1060768048 9:126309647-126309669 CTGGGGAGAGGGAGGGTGCTGGG - Intergenic
1060918191 9:127403518-127403540 CTGAGGACACAGGGGGTGCTGGG + Intronic
1060962797 9:127693054-127693076 ACCGGGAGACAGAGGTTGCAGGG - Intronic
1061238829 9:129357666-129357688 GTGGGGAGACGGAGGGGGAAGGG - Intergenic
1061351898 9:130072045-130072067 CCGAGGAGGCAGAGGCTGCAGGG - Intronic
1061610547 9:131742553-131742575 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1061979774 9:134095268-134095290 CTTGGGAGACTGAGGGGGCCAGG + Intergenic
1062035891 9:134382372-134382394 CTGGGGAGACAGTGGGGGCCAGG + Intronic
1062260551 9:135660821-135660843 CCCGGGAGGCAGAGGTTGCAGGG - Intergenic
1062322102 9:135995106-135995128 CTGTGGAGACAGACGGTGGAGGG - Intergenic
1062479218 9:136743750-136743772 CTGGGGTGCCAGAGGCTCCAAGG - Intergenic
1062688210 9:137827314-137827336 CTGAGAAGTGAGAGGGTGCAGGG - Intronic
1185576428 X:1177067-1177089 CCCGGGAGGCAGAGGTTGCAGGG + Intergenic
1185579255 X:1197924-1197946 CGTGGGAGACAGATGTTGCAGGG + Intronic
1185892310 X:3832636-3832658 CTCGGGAGGCAGAGGTTTCAGGG - Intronic
1185897418 X:3871055-3871077 CTCGGGAGGCAGAGGTTTCAGGG - Intergenic
1185902537 X:3909487-3909509 CTCGGGAGGCAGAGGTTTCAGGG - Intergenic
1185972707 X:4682297-4682319 CCTGGGAGGCAGAGGCTGCACGG + Intergenic
1186876520 X:13823593-13823615 CTCGAGAGGCAGAGGTTGCAGGG - Intronic
1187165475 X:16800638-16800660 CCCGGGAGGCAGAGGTTGCAGGG - Intronic
1187244788 X:17544585-17544607 CCCGGGAGGCAGAGGTTGCAGGG - Intronic
1187381614 X:18807103-18807125 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1187423052 X:19153319-19153341 CCCGGGAGGCAGAGGTTGCAGGG - Intergenic
1187575328 X:20547784-20547806 CTGGGGAGAGAGAGGGAGTGAGG + Intergenic
1187910115 X:24103970-24103992 CCCGGGAGGCAGAGGTTGCAGGG - Intergenic
1188079231 X:25815553-25815575 CAGGGGAGAGAGAGGGGGAAGGG - Intergenic
1188878917 X:35468288-35468310 CTGTGGAGGAAGAAGGTGCAAGG + Intergenic
1189288124 X:39866523-39866545 CTGGGGAGTGAGAGTGGGCAGGG + Intergenic
1189340904 X:40203940-40203962 CCCGGGAGGCAGAGGTTGCATGG - Intergenic
1189465914 X:41277254-41277276 CTGGGGAGAGAGAGGCCACAGGG + Intergenic
1189495081 X:41501369-41501391 CCTGGGAGACATAGGTTGCAGGG - Intergenic
1189727244 X:43979868-43979890 GTGTGGAGACAGAGGATACATGG + Intergenic
1189748644 X:44195989-44196011 CTGGGGAGGTCGAGGCTGCAGGG - Intronic
1189809622 X:44769035-44769057 CCCGGGAGGCAGAGGTTGCAGGG + Intergenic
1189837332 X:45039210-45039232 ATGGGGAGGCAGAGGGGGGATGG - Intronic
1190179346 X:48178299-48178321 GTTGGGAGGCAGAGGTTGCAGGG - Intergenic
1190334969 X:49256856-49256878 CTGGGGGGACAGAGGGTGTCAGG + Intronic
1190750638 X:53358658-53358680 CCCGGGAGGCAGAGGTTGCAGGG + Intergenic
1190790021 X:53690353-53690375 CCAGGGAGGCAGAGGTTGCAGGG - Intergenic
1191103495 X:56758238-56758260 CTCAGGAGACAGAGGTTTCAGGG + Intergenic
1191611443 X:63118829-63118851 CCCGGGAGGCAGAGGCTGCAGGG - Intergenic
1192119970 X:68446401-68446423 CCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1192505327 X:71677634-71677656 CCCGGGAGGCAGAGGTTGCAGGG + Intergenic
1193533709 X:82686994-82687016 CTTGGGAGACACATGGAGCAAGG - Intergenic
1195255101 X:103082416-103082438 GGGAGGAGACTGAGGGTGCAGGG - Intronic
1195722556 X:107880227-107880249 CTCGGGAGTCTGAGGTTGCAGGG - Intronic
1195803786 X:108739311-108739333 CCCGGGAGACCGAGGTTGCAGGG - Intergenic
1195914613 X:109924100-109924122 CCCGGGAGGCAGAGGTTGCAGGG - Intergenic
1196422941 X:115541325-115541347 GTTGGGAGACGGAGGCTGCATGG + Intergenic
1196804093 X:119569387-119569409 CTGGGGGGGCGGAGGGGGCAGGG + Intergenic
1196922641 X:120600427-120600449 CCCGGGAAGCAGAGGGTGCAGGG + Intronic
1197257467 X:124279135-124279157 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1197715383 X:129702586-129702608 CCCGGGAGGCAGAGGTTGCAGGG - Intergenic
1198257850 X:134940562-134940584 CCCGGGAGGCAGAGGTTGCAGGG - Intergenic
1198391363 X:136178518-136178540 CCCAGGAGGCAGAGGGTGCAGGG + Intronic
1198462359 X:136876197-136876219 CCTGGGAGGCAGAGGTTGCAGGG - Intronic
1198640548 X:138751216-138751238 ATGGGGCAATAGAGGGTGCAGGG - Intronic
1198854267 X:140999881-140999903 CATGGGAGGCAGAGGTTGCAGGG + Intergenic
1199338392 X:146646195-146646217 CCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1199606673 X:149584305-149584327 CTGGGGTGACAGTAGGGGCAGGG + Intronic
1199632450 X:149785063-149785085 CTGGGGTGACAGTAGGGGCAGGG - Intronic
1199795331 X:151190470-151190492 CAGGAGAGACAGAGAGTGCAGGG - Intergenic
1200018259 X:153181425-153181447 CTGGGGTGACAGCAGGGGCAGGG - Intronic
1200160919 X:154008402-154008424 CCCGGGAGGCAGAGGTTGCAGGG + Intergenic
1200177988 X:154131505-154131527 CCTGAGAGACAGAGGTTGCAGGG - Intergenic
1200787799 Y:7274610-7274632 CCGGGGAGACCCAGGGCGCAAGG - Intergenic
1200858423 Y:7964293-7964315 CCCGGGAGTCAGAGGTTGCAGGG - Intergenic
1201281170 Y:12343674-12343696 CCTGGGCGACAGAGGTTGCAGGG - Intergenic
1201284477 Y:12367586-12367608 CCCGGGAGACAGAGGTTTCAGGG + Intergenic
1201381473 Y:13384585-13384607 ATTGGGAGGCAGAGGTTGCAGGG + Intronic
1202031717 Y:20582284-20582306 CTCGGGAGGCAGAGGTTGCAGGG - Intronic