ID: 901093162

View in Genome Browser
Species Human (GRCh38)
Location 1:6657049-6657071
Sequence CTCCTAAGGAACCATGCCTG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 134}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901093162 Original CRISPR CTCCTAAGGAACCATGCCTG CGG Intronic
900644652 1:3703394-3703416 CTGCTAAGGGAGCCTGCCTGGGG + Intronic
901029590 1:6299200-6299222 CTCCTCAGTCACCTTGCCTGTGG - Intronic
901093162 1:6657049-6657071 CTCCTAAGGAACCATGCCTGCGG + Intronic
903300914 1:22378253-22378275 CTCCTGAGGACCCTTGCCAGAGG + Intergenic
903322239 1:22550164-22550186 CCCCCAAGCAAGCATGCCTGTGG + Intergenic
904291039 1:29485980-29486002 CTCCCTTGGAACCAGGCCTGCGG - Intergenic
904907808 1:33911123-33911145 CTCCTTAGGAACCCAGACTGTGG + Intronic
908512663 1:64861731-64861753 TGCCGAAGGAAGCATGCCTGGGG + Intronic
918232265 1:182547289-182547311 CTCCCAAGAAACCATACCTGAGG - Intronic
918560040 1:185854478-185854500 CTCCTATGGAGCAATGTCTGGGG + Intronic
919763086 1:201110612-201110634 CTCCCAAGGAGCCATGACTTTGG + Intronic
919960787 1:202466479-202466501 AGCCTAAGGAACAATGCCTAAGG - Intronic
922042582 1:221911195-221911217 CTCCTTAGGACCCGTGTCTGTGG - Intergenic
922426572 1:225502158-225502180 ATCTTCAGGAACCATGCCTATGG - Intronic
922703131 1:227773854-227773876 ATCCTGAGGAACCATGGCTCGGG - Intronic
1063295566 10:4801768-4801790 CTCCCAGGGAACCATGCCACAGG - Intronic
1063869439 10:10401905-10401927 CCCCTGAGGGAGCATGCCTGAGG + Intergenic
1066618754 10:37322680-37322702 CTCCCCCGGATCCATGCCTGAGG + Intronic
1069216250 10:65824958-65824980 CTCCTAAGGAACCTCTCATGGGG + Intergenic
1071345351 10:84686928-84686950 CTGCTATGGCACCATGCATGGGG - Intergenic
1077033119 11:479203-479225 CTCCTTTGTCACCATGCCTGGGG - Intronic
1078924838 11:15865208-15865230 CTCCAGAACAACCATGCCTGAGG - Intergenic
1079642436 11:22823619-22823641 CTCCCAAGGAAAACTGCCTGGGG - Intronic
1080070285 11:28075954-28075976 ACCCCAAGTAACCATGCCTGGGG - Intronic
1082810823 11:57477812-57477834 CGCCTGAGGAACTAAGCCTGGGG + Intergenic
1088316480 11:108512054-108512076 CTCAGAAGCATCCATGCCTGAGG + Exonic
1089060500 11:115622450-115622472 CCCCTAAGGAACCATCCCAAGGG + Intergenic
1090609389 11:128456650-128456672 CCCCTTAGTAACCAGGCCTGTGG + Intergenic
1091777078 12:3191556-3191578 CACCTAAGGAACAAAGCCTGAGG - Intronic
1093312485 12:17607689-17607711 CTCCCAATGAACTATGCCTTTGG + Intergenic
1094566725 12:31605370-31605392 CTCCTTAGAAATGATGCCTGTGG - Intergenic
1095149743 12:38778311-38778333 CACCTAAGGAAGCATGTCTCGGG + Intronic
1097790357 12:63808795-63808817 CTCCTATGGCTCCATTCCTGTGG + Exonic
1099062988 12:77935743-77935765 CTCCAAAGGTAGCATGGCTGGGG + Intronic
1101107207 12:101452475-101452497 CTGCAAAAGAAGCATGCCTGTGG - Intergenic
1108123397 13:47214144-47214166 ATCATGAAGAACCATGCCTGAGG + Intergenic
1112310064 13:98310263-98310285 CACCAAAGGAACCATTCCTGGGG - Intronic
1113185033 13:107678422-107678444 CTTCTCAGGCACCATGTCTGTGG - Intronic
1116372561 14:44154631-44154653 CCCCTGAGGACCCATGCCTCAGG + Intergenic
1118663524 14:68041236-68041258 CTGTTAAGGAAGCATGGCTGAGG - Intronic
1119627623 14:76193868-76193890 CTCCTTCTGAATCATGCCTGAGG + Intronic
1120988247 14:90353040-90353062 CTCCTAAATAATTATGCCTGGGG - Intergenic
1123907686 15:24936578-24936600 CTCTAAAGGAATCATGGCTGGGG + Intronic
1127646729 15:60966052-60966074 CTCAGAAGGAACCAGGTCTGTGG - Intronic
1128081142 15:64857615-64857637 CTCCTAAGGAACCCTGTATCTGG - Intronic
1128544451 15:68557813-68557835 CTCCTAAAGGACCATGACTAAGG - Intergenic
1128607129 15:69045421-69045443 CTGCTAAGGCTCCATGCCAGAGG + Intronic
1130607556 15:85331517-85331539 CTCCTAAGGGACACTGCCTGGGG + Intergenic
1131443706 15:92477864-92477886 CTCCAAAGAAATCATTCCTGGGG + Intronic
1131989122 15:98076298-98076320 CTCCTCAGGTACCAAGCCTACGG - Intergenic
1132858376 16:2057738-2057760 CTCCTATGGAACCAGGCCCTGGG + Intronic
1134052105 16:11144536-11144558 TTCCAAAAGAACCATGCCTCTGG - Intronic
1134638042 16:15807782-15807804 CTTCTCAGGAAACGTGCCTGGGG - Intronic
1135375142 16:21939847-21939869 CTCCCAATGAGCCATACCTGTGG - Intergenic
1137721814 16:50631894-50631916 CCCCTGAGGAACCAGGCCAGGGG + Intronic
1141512692 16:84522972-84522994 CTCAGAAGGAACCAGCCCTGTGG - Intronic
1141870876 16:86784636-86784658 CTCCGAAGGAACCAGCCCTATGG + Intergenic
1142243709 16:88958837-88958859 CCCCTAGGGAGCCAGGCCTGTGG - Intronic
1143330604 17:6132262-6132284 TTCCAAAGGGACCCTGCCTGGGG + Intergenic
1144844057 17:18206792-18206814 CTGCAAAGGAAACATGCATGGGG - Intronic
1145811327 17:27765873-27765895 CTCTTAAGCACCCCTGCCTGTGG - Intronic
1146519029 17:33511885-33511907 CACCAAAAGAACCAAGCCTGGGG + Intronic
1147490499 17:40861622-40861644 TTCCTAAGGAACCAATCATGGGG + Exonic
1148135087 17:45286965-45286987 CTCTGAAGGAACCAGGCCTTGGG - Exonic
1150735640 17:67735150-67735172 CTCACAAGGAACCCTGCCTCAGG - Intronic
1152735369 17:81994588-81994610 CTCCCAAGGACCCTGGCCTGTGG - Intronic
1155320893 18:24617886-24617908 CTTGTAAGCCACCATGCCTGTGG - Intergenic
1157720303 18:49918285-49918307 CTCATGAGGAAACATGCCCGAGG - Intronic
1160335959 18:78039905-78039927 CTCCAAAGGAACCAGCCCTAGGG - Intergenic
1166954449 19:46453806-46453828 TTCCAAAGCAGCCATGCCTGAGG + Intergenic
926134550 2:10327115-10327137 CTCCTAAGGAAGTGAGCCTGTGG + Intronic
927970717 2:27304877-27304899 CTCCTAGGCAACCCTGGCTGGGG + Intronic
928359218 2:30649357-30649379 CACCAAAGGAACCAGCCCTGGGG - Intergenic
930973982 2:57431883-57431905 CTGCTTAGGAAACTTGCCTGAGG + Intergenic
932514028 2:72326353-72326375 CTCCCAACAAACCAAGCCTGAGG - Intronic
933213850 2:79603788-79603810 CTCCTAAGGGACATGGCCTGAGG - Intronic
933373480 2:81447446-81447468 CTCCTCATGAACCTTGACTGAGG + Intergenic
935501225 2:103842191-103842213 CACCTAAGGTAACATGTCTGGGG - Intergenic
935979275 2:108610508-108610530 CTCCTCAGGGACCAGCCCTGAGG - Intronic
938990377 2:136622464-136622486 CTGCTTAGGAACCATTGCTGGGG + Intergenic
942951799 2:181729817-181729839 CTGCACAGGATCCATGCCTGTGG + Intergenic
945568896 2:211439347-211439369 CTCCAAAGGCACCATCCCTTGGG + Intronic
946262144 2:218502018-218502040 CTCCAAAGGAACTATGCTTTAGG + Intronic
946423835 2:219581394-219581416 CTCCTCAGGAAGTATGCTTGAGG - Intergenic
948163838 2:235845808-235845830 CTCCGAAGGAGTCATGCATGTGG + Intronic
948237413 2:236401136-236401158 CTCCTGAGGGACCACACCTGTGG - Intronic
1171961281 20:31496856-31496878 TTCCTGAGGAACCCTGGCTGAGG + Intergenic
1172837316 20:37881460-37881482 CTCCTAAGGGACTTTGCCTTGGG - Intergenic
1172886582 20:38235308-38235330 CTCCTAAGGCTTCGTGCCTGTGG + Intronic
1172950578 20:38721006-38721028 CTCCTAGGGAACCCTTCCAGAGG + Intergenic
1174734145 20:52948738-52948760 CTACCAAGGATCCATCCCTGTGG + Intergenic
1175304105 20:57964263-57964285 CCCCCAGGGAACCAGGCCTGGGG + Intergenic
1179547083 21:42119651-42119673 CTCCTTGGGAACTATGCTTGGGG - Intronic
1184211755 22:43040222-43040244 CTCCAAAGGCAACATGCATGAGG + Intronic
949838340 3:8293154-8293176 CACCTGAAGAACCAGGCCTGTGG - Intergenic
950426900 3:12929239-12929261 CTCATAACGTACCATGCCTCAGG + Intronic
950647988 3:14389126-14389148 ATCCTAGGGAACCATGACTCAGG + Intergenic
951304251 3:21039029-21039051 CTCTTAAACAACCATGACTGTGG + Intergenic
960996989 3:123346768-123346790 GTCCTAGGGAAACTTGCCTGGGG + Intronic
962472501 3:135724179-135724201 CTGTAAAGGAAGCATGCCTGAGG - Intergenic
966068963 3:175851338-175851360 GTCCTAAAGAGACATGCCTGAGG - Intergenic
969097087 4:4741636-4741658 CCCCTGAGAAATCATGCCTGGGG + Intergenic
969106006 4:4807546-4807568 TTCCCAAGGAACCAGACCTGTGG - Intergenic
970723103 4:19010707-19010729 GTCCTATGGAACCATCACTGTGG + Intergenic
975508990 4:75171585-75171607 TTCCTATTGAAACATGCCTGTGG + Intergenic
978332170 4:107625653-107625675 GACCTAAAGAACCATGCATGAGG + Intronic
980399557 4:132262983-132263005 CTCTATAGGAAGCATGCCTGGGG - Intergenic
987476058 5:18393684-18393706 CTCCTCAGGAGCCTTGCCTGAGG + Intergenic
991613261 5:68469805-68469827 CTCAGAAGGAACCAACCCTGTGG + Intergenic
993972539 5:94437757-94437779 CTCTTATAGGACCATGCCTGTGG + Intronic
998583152 5:143402345-143402367 GCCCTAATGAACCATGCCAGAGG + Intronic
998594619 5:143515933-143515955 CTCCTTAGGAACCAGGCATCAGG + Intergenic
998625308 5:143839449-143839471 CCACTAAGGAACGAAGCCTGAGG - Intergenic
1001891957 5:175347025-175347047 TTCCTAAGGAATCATGTCTCTGG + Intergenic
1006569755 6:34992463-34992485 CTCTGAAGGAAGCATGCCGGAGG + Intronic
1007274934 6:40666360-40666382 CTGCTAAGGGAACAAGCCTGTGG - Intergenic
1007735128 6:43977585-43977607 CTGCGAATGAGCCATGCCTGTGG - Intergenic
1010768038 6:79798628-79798650 GGCCAAAGGAAACATGCCTGAGG + Intergenic
1015328940 6:131954870-131954892 CTCCCAGGGAAACATGCCGGAGG + Intergenic
1017482101 6:154867075-154867097 CTCCTAAGGAACCAGCACTTAGG - Intronic
1021915914 7:25432106-25432128 CTCCTTAGGAACCCTACCTCAGG - Intergenic
1023337248 7:39183347-39183369 CTACAAAGGAAGCATGGCTGCGG + Intronic
1024235266 7:47392868-47392890 CTCAAAAGGACCCAAGCCTGGGG + Intronic
1024918131 7:54526015-54526037 CCCCTAAGGAACCATTCTTTAGG - Intergenic
1026882532 7:73916619-73916641 GTGCTAAGGAACGGTGCCTGGGG - Intergenic
1027751391 7:82151230-82151252 CTCCTATGAAAATATGCCTGAGG - Intronic
1031530296 7:122867551-122867573 CTCTTAAATCACCATGCCTGAGG + Intronic
1033834441 7:145291788-145291810 CTCCAAAGGAAGCATTCCTTAGG + Intergenic
1038649618 8:29390636-29390658 CTCCTAAGGAGAGATGCCAGAGG - Intergenic
1038817726 8:30922845-30922867 CTCCCAAGGAAACATACCTATGG - Intergenic
1039071341 8:33651908-33651930 CTCCTAAGCCTCCAAGCCTGTGG - Intergenic
1039116303 8:34094956-34094978 CTCCAAACGAACAATGCCTAAGG - Intergenic
1049364790 8:142231966-142231988 AGCCTGAGGAACCATGCGTGGGG + Intronic
1052436775 9:28439697-28439719 CTGTGCAGGAACCATGCCTGGGG - Intronic
1055182549 9:73405679-73405701 CTCCTGAGAAACCAACCCTGAGG + Intergenic
1059042102 9:110826202-110826224 CACCTAATGAACCCTGCCTTGGG + Intergenic
1061002522 9:127910368-127910390 CATCTAAGGGACCAGGCCTGGGG + Intronic
1192502510 X:71663224-71663246 CTCCTAAGGTACCATGATTGTGG + Intergenic
1192509713 X:71714600-71714622 CTCCTAAGGTACCATGATTGTGG + Intronic
1192516984 X:71766953-71766975 CTCCTAAGGTACCATGATTGTGG - Intronic
1192789228 X:74364904-74364926 CTCCCAAGGGACCACCCCTGAGG + Intergenic
1200160094 X:154002644-154002666 CTCCCCAAGAGCCATGCCTGTGG - Intergenic
1201349351 Y:13022897-13022919 CTGATAAGGAACCATTACTGGGG + Intergenic