ID: 901094831

View in Genome Browser
Species Human (GRCh38)
Location 1:6669793-6669815
Sequence CAAAGTTATCAGATGGATGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 165}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901094831 Original CRISPR CAAAGTTATCAGATGGATGG GGG Intronic
901094831 1:6669793-6669815 CAAAGTTATCAGATGGATGGGGG + Intronic
903371229 1:22837412-22837434 CAAGTTTATGAGAGGGATGGGGG + Intronic
906238415 1:44226187-44226209 TAAGTTTATCAGATGGGTGGGGG + Intronic
907156539 1:52340210-52340232 AAAAGTAATCAGATGGACAGAGG + Exonic
908080584 1:60573926-60573948 TAAAGTTCTCAGATGGAATGGGG - Intergenic
908428570 1:64033023-64033045 AAAAGTTTTGGGATGGATGGTGG + Intronic
910355304 1:86345880-86345902 GAAAGTTATCAGATGGTAAGAGG + Intergenic
910963642 1:92786313-92786335 CAAAGTTTTTAGCTGGGTGGAGG - Intronic
912720554 1:112016403-112016425 CAAAGTGAGCAGAGGGTTGGGGG - Intergenic
916811223 1:168307366-168307388 GAAAGGCATCACATGGATGGTGG + Intronic
918256039 1:182748308-182748330 CAAAGTTATCACATAGAAGTTGG - Intergenic
920355848 1:205371824-205371846 AAAAGTTCTAAGATGGATGGTGG - Intergenic
1064825804 10:19398634-19398656 GAGAGTTATAACATGGATGGAGG - Intronic
1066359479 10:34716472-34716494 TAAACTTATCAGATGGGAGGAGG + Intronic
1066504169 10:36024685-36024707 CAAATTTATCAAATTGATAGAGG - Intergenic
1068212642 10:53941121-53941143 CAAAGGTAGCAGTTGGGTGGGGG - Intronic
1071221158 10:83465897-83465919 CACAGTTATCATACAGATGGAGG + Intergenic
1071235972 10:83648873-83648895 CTCAGTTATCAGATCAATGGTGG - Intergenic
1078292584 11:10027804-10027826 TAAAGTCCTCAGATAGATGGTGG + Intronic
1078908080 11:15705956-15705978 CAAACTTATAATATGTATGGAGG - Intergenic
1080271597 11:30456271-30456293 CAAAGACATTAGATGGATGTGGG + Intronic
1081312668 11:41592790-41592812 CAATGTTATAAAATGGCTGGAGG + Intergenic
1082703130 11:56458701-56458723 CACAATTATCAGATGGCTGTAGG - Intergenic
1083977067 11:66131508-66131530 CAAAGTTAGCAGGTAGATGAGGG - Intronic
1084658062 11:70530801-70530823 GAAAGTTCTGAGATGGATAGTGG + Intronic
1085290580 11:75396369-75396391 GAGAGATAACAGATGGATGGGGG + Intergenic
1087779094 11:102284467-102284489 CAAATTAATCAGAAGGATGTAGG - Intergenic
1090480985 11:127067913-127067935 CAAAGTTATCACATCAATGGTGG - Intergenic
1091247554 11:134111400-134111422 CATAGTTAAAAGATGAATGGTGG - Intronic
1091659503 12:2372893-2372915 CAATGGTAGCAGATGGATGCGGG + Intronic
1092197713 12:6559883-6559905 TAAAGTGTTCATATGGATGGAGG - Intronic
1093246350 12:16742071-16742093 CACAGTTATGAGAATGATGGAGG - Intergenic
1093698550 12:22191282-22191304 CAAAGTTAACCTATGGGTGGAGG - Intronic
1095454267 12:42365683-42365705 CAAAGTCATCAGGAGAATGGAGG - Intronic
1095761402 12:45841562-45841584 AAAAGTTTTCAGAGGGATTGAGG - Intronic
1095939789 12:47718490-47718512 AAAAGTTGACAGATGGATAGAGG + Intronic
1096562901 12:52449725-52449747 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096565052 12:52471388-52471410 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096567064 12:52490825-52490847 CAGAGTAAACAGAAGGATGGTGG + Intronic
1098931888 12:76426745-76426767 CAAAGTTCTCAGATTGTTGCTGG + Intronic
1099683473 12:85857272-85857294 CAAAATTCTGAGATTGATGGTGG - Intergenic
1100982867 12:100176219-100176241 CAAAGATGACAGATGGAAGGAGG + Intergenic
1106853719 13:33823785-33823807 CAAAGTTAAAACATGAATGGTGG + Intronic
1107089013 13:36456159-36456181 CATAGTTAGCTGATGGAAGGTGG + Intergenic
1107777926 13:43866004-43866026 CTCAGTTATCAGATTGATTGTGG - Intronic
1110843196 13:80166086-80166108 CAAAGTGAGCAGATGGCTGAAGG - Intergenic
1116451533 14:45072118-45072140 CAAAGTTAGCAGTTGGCAGGTGG + Intronic
1118683432 14:68266661-68266683 CAAAGTTATCAGAGGGAATGAGG + Intronic
1119439819 14:74620568-74620590 CAAACTTTCCAGATGGAGGGAGG - Intergenic
1119546488 14:75475705-75475727 CAAAGTAATGAGATTGATGCAGG + Intergenic
1125182462 15:36893168-36893190 CAAAGTTATGAGTTAAATGGTGG + Intronic
1127957693 15:63867361-63867383 AAAAGTTTTAAGATGGATGGTGG - Intergenic
1128081337 15:64858857-64858879 GAGAGTTATGTGATGGATGGTGG - Intronic
1129146775 15:73655395-73655417 AAAAGTTCTAAGATGGATAGTGG - Intergenic
1130017840 15:80201402-80201424 CACTGTTATGTGATGGATGGGGG + Intergenic
1133580126 16:7136755-7136777 CACAGTCATCAGGTGGATAGTGG + Intronic
1136778665 16:32884485-32884507 CAAAGTTAGGAGAAGGATGCTGG - Intergenic
1136891955 16:33977029-33977051 CAAAGTTAGGAGAAGGATGCTGG + Intergenic
1137484740 16:48881845-48881867 CCAAGGTATCAGAAGGCTGGTGG - Intergenic
1138308295 16:55999658-55999680 CACAGTTATCATATAGATTGGGG - Intergenic
1140582160 16:76243793-76243815 CAAAATTTTCAGATGGTTGAAGG - Intergenic
1140612243 16:76614287-76614309 CAGAGTTTCCAGATGGATGCTGG + Intronic
1142350011 16:89575580-89575602 CAAAGCTATCAGTTGGGGGGGGG + Intergenic
1203081081 16_KI270728v1_random:1146579-1146601 CAAAGTTAGGAGAAGGATGCTGG - Intergenic
1143111945 17:4557965-4557987 CAGAGTTATCTGAAGCATGGGGG - Exonic
1144630299 17:16868450-16868472 AAAAGTTCTTGGATGGATGGTGG + Intergenic
1148458211 17:47822157-47822179 CAAAAGTATCAGGTTGATGGTGG + Intergenic
1148845962 17:50530100-50530122 CTAAGATATCAGATGGTTGATGG + Intronic
1153668123 18:7384540-7384562 CAAAGTTTGCAGAGGGTTGGAGG - Intergenic
1155603114 18:27572214-27572236 CAAATTTATCAAAAGAATGGAGG + Intergenic
1157500613 18:48187939-48187961 AAAAGTTCTAGGATGGATGGTGG + Intronic
1158582223 18:58693686-58693708 CTGAGTAACCAGATGGATGGTGG + Intronic
1164318958 19:24121383-24121405 CACAAATATCAGATGTATGGTGG - Intronic
1167837594 19:52086853-52086875 TAAAGTTATCAGTGGAATGGTGG + Intronic
1167842453 19:52133091-52133113 TAAAGTTATCAGTGGAATGGTGG + Intronic
926858648 2:17284530-17284552 AAAAGTTATCAGATGGACAGAGG + Intergenic
928534634 2:32228163-32228185 TAAAGTAATTAGATGGGTGGTGG + Intronic
928660820 2:33500302-33500324 CCAAATTATCAGATTGATTGCGG - Intronic
929034523 2:37677985-37678007 CAAAGATAACAGATAGATGCGGG + Intronic
929761008 2:44806136-44806158 CAAAAGTATGGGATGGATGGTGG + Intergenic
930486861 2:52021692-52021714 CAAGGCTATCAGATGGTTGCTGG - Intergenic
930793907 2:55367301-55367323 AAAATTCTTCAGATGGATGGTGG + Intronic
931083252 2:58799780-58799802 CAAACATAGCAGATGGATGCAGG + Intergenic
932392452 2:71407635-71407657 AAAAGTTCACAAATGGATGGTGG - Intronic
932727843 2:74194830-74194852 CAAATTTTGCAGAGGGATGGAGG + Intergenic
933373752 2:81451558-81451580 CATAGCTATCATATGGAAGGGGG + Intergenic
933523529 2:83405723-83405745 CAAAGGTATCAGATCAATGTGGG + Intergenic
936032825 2:109085972-109085994 AACAGTTAAGAGATGGATGGTGG - Intergenic
937491713 2:122376145-122376167 CAAAGTTATTAAAGAGATGGTGG + Intergenic
938071040 2:128308487-128308509 CGAGGTTCTCAGATGGCTGGGGG + Intronic
939475462 2:142680941-142680963 CAAAGTTATGAGAAGCATTGAGG + Intergenic
942550542 2:177111709-177111731 CAGAGTCTTCAGATGGATGGAGG - Intergenic
942991207 2:182205356-182205378 AAAGGTTATAAGAGGGATGGGGG + Intronic
944402088 2:199339285-199339307 CAAAGTTATTAGATTGCTTGAGG - Intronic
945101148 2:206263328-206263350 CAAAATTCTCAGATGCATGATGG - Intergenic
1170399248 20:15961892-15961914 GAAAGAAATCAGAAGGATGGAGG + Intronic
1175549136 20:59805430-59805452 AAAAGATATCAGTTGGTTGGGGG + Intronic
1177837547 21:26201332-26201354 CAATGTGGTAAGATGGATGGAGG - Intergenic
1178703021 21:34850188-34850210 CACAGCTTTCAGATGGATTGCGG - Intronic
1179107445 21:38415432-38415454 TAAAGTTATCAGCTGAATAGCGG - Intronic
1183575122 22:38683100-38683122 CACAGTTTTTACATGGATGGTGG + Intronic
949444978 3:4124955-4124977 CATAGCTATCAGATGAATAGGGG - Intronic
950252851 3:11481221-11481243 AGAAGTTCTGAGATGGATGGTGG + Intronic
950726057 3:14917759-14917781 AAGAGTTCTGAGATGGATGGTGG - Intronic
952523985 3:34190464-34190486 AAAAGTTGTTAGATGGATGCTGG + Intergenic
958272147 3:91514530-91514552 CAAAGTAATCAGATAGCTTGAGG + Intergenic
959158028 3:102690165-102690187 CATAGTAATCAGTTGGAAGGAGG + Intergenic
959175935 3:102910743-102910765 CAAGGTTATCAGATGAATTTAGG + Intergenic
961366765 3:126405090-126405112 AAGAGTTCTGAGATGGATGGTGG - Intronic
961380517 3:126493635-126493657 AAAAGCTCTGAGATGGATGGTGG + Intronic
961765479 3:129207158-129207180 AAAAGTTCTGAGATGGATGGTGG - Intergenic
962126959 3:132630192-132630214 TAAACTTACAAGATGGATGGAGG - Intronic
964913679 3:161813253-161813275 CAAATTTATCACATTGATGGAGG + Intergenic
966005595 3:175007919-175007941 CTCAGTTATCAGATCGATGGTGG - Intronic
966033863 3:175385821-175385843 TAAAGTTATTACATGCATGGGGG + Intronic
967926309 3:194651272-194651294 CAAAGATATGACATAGATGGTGG + Intronic
969467627 4:7366974-7366996 CAATCTTATCAGATGGATATAGG + Intronic
969540420 4:7785096-7785118 CACAGTTAGCAGATGAATGAAGG - Intronic
970666724 4:18345220-18345242 CAAAGTTGTCAGATAGATAGGGG + Intergenic
970712186 4:18876428-18876450 CAAAGTTAGCATTTGGATTGGGG + Intergenic
974003367 4:56532215-56532237 CAAAGTCTTCAGCTGGGTGGGGG - Intronic
984500939 4:180557812-180557834 TAAAGTCATGAGATGGATAGAGG - Intergenic
988513584 5:31886498-31886520 CACAGTTCTCAGAAGGGTGGAGG - Intronic
988773287 5:34452676-34452698 GCAAGGTATCATATGGATGGAGG - Intergenic
991356401 5:65773603-65773625 CAAAGTCATGAGACGGAAGGTGG + Intronic
991368558 5:65894527-65894549 CAAAGTTATGTGATAGAGGGTGG - Intergenic
991413848 5:66371185-66371207 CTTAGATATCAGATGAATGGAGG - Intergenic
991950282 5:71940353-71940375 CAAAGTTGTGAGATGGGAGGAGG + Intergenic
993064497 5:83080690-83080712 CTTGGTTATCAGATTGATGGAGG + Intronic
994120724 5:96109700-96109722 CAAAGTTGTCTGGTGGGTGGAGG + Intergenic
994900065 5:105760042-105760064 CACAGTCATCACATGGCTGGCGG - Intergenic
996382898 5:122880075-122880097 CAAAGTAAACAGAAGGTTGGAGG - Intronic
998951459 5:147396454-147396476 CAAAGTTAAGAAATGGGTGGAGG - Intronic
999865739 5:155698618-155698640 CAAACTTCTCAGATGGATGGAGG + Intergenic
1001730379 5:173950117-173950139 CAAATATAACAGATGAATGGAGG - Intronic
1001815875 5:174669089-174669111 CCAGGTGACCAGATGGATGGTGG + Intergenic
1002336469 5:178482511-178482533 AAAGGTTCTGAGATGGATGGTGG + Intronic
1002554400 5:180023856-180023878 AAAAGTTATCATATGGCAGGGGG + Intronic
1005503176 6:26447874-26447896 AAAAGTTAATAGATGGAGGGAGG + Intronic
1005518124 6:26573766-26573788 CCAAGTTCTGAGATGAATGGTGG - Intergenic
1008982960 6:57506611-57506633 CAAAGTAATCAGATAGCTTGAGG - Intronic
1009171025 6:60399475-60399497 CAAAGTAATCAGATAGCTTGAGG - Intergenic
1010935505 6:81856153-81856175 CAAAGTTTTCACAGGGCTGGTGG + Intergenic
1012100442 6:95078292-95078314 CAAAGTTAGCATTTGGTTGGTGG - Intergenic
1013848950 6:114490492-114490514 CAAAGTTTCCAGATGGACTGTGG + Intergenic
1013873056 6:114791579-114791601 CAAAGTTATCTGATTCATGCTGG + Intergenic
1014925252 6:127263083-127263105 CACAGCTATCAGATGGTTGCCGG + Intergenic
1015408193 6:132861312-132861334 CAAAGTTATCATGAGGATGGTGG + Intergenic
1022481823 7:30749263-30749285 CAAAGTTGTCACATTGATGAAGG + Intronic
1023353484 7:39343710-39343732 CAAAGTTATGAGTTAGTTGGAGG - Intronic
1030304980 7:108008658-108008680 CAATGTTACCAGATGAAGGGAGG - Intergenic
1032338534 7:131049075-131049097 CAAAGTCATAAGAAGGATTGAGG - Intergenic
1034458414 7:151184650-151184672 GAAAGTTTGGAGATGGATGGTGG + Intronic
1035184464 7:157115229-157115251 GAAAGTTTGGAGATGGATGGTGG + Intergenic
1035367554 7:158358838-158358860 GAAAGTTGGCAGGTGGATGGTGG + Intronic
1037085556 8:14844906-14844928 CAGAGTTTTCAGATGCAGGGAGG + Intronic
1039692779 8:39880115-39880137 CAAAGCTATCAGAAAGATGAAGG - Intergenic
1040789509 8:51209459-51209481 CTCAGTTAACAGATGGATTGTGG + Intergenic
1041721395 8:60979393-60979415 CAAAAATATCACATGGCTGGAGG + Intergenic
1043534488 8:81187368-81187390 CAAATTTATTACATGCATGGGGG + Intergenic
1044488757 8:92786975-92786997 CAAATATATCAGATGGATTATGG + Intergenic
1044712226 8:95069001-95069023 GAAAGCAATCAGAGGGATGGAGG - Intronic
1044812690 8:96080244-96080266 CAAGGATATCAGATGGAGAGGGG - Intergenic
1044968777 8:97599516-97599538 CAAAGTTCTCACAAGGATGGAGG + Intergenic
1045567379 8:103334666-103334688 CAAAATTATTAGAGGGATTGAGG - Intergenic
1047575828 8:126154273-126154295 CAAAGATAACTGATGGATAGAGG + Intergenic
1050408933 9:5341046-5341068 CAAAGCTATGAGATGGTTAGAGG + Intergenic
1050474578 9:6027390-6027412 GAAAGTTATAAGAGTGATGGAGG + Intergenic
1052299734 9:26940551-26940573 AAGAGTTAAAAGATGGATGGTGG + Intronic
1059846257 9:118280293-118280315 CAGAGTTAGCAAATGAATGGTGG - Intergenic
1059979649 9:119756972-119756994 CAAAATTATCAGAAGAAAGGAGG - Intergenic
1062456708 9:136643247-136643269 CAGAATTATCAGATTGAAGGTGG - Intergenic
1203748292 Un_GL000218v1:56958-56980 CAACATATTCAGATGGATGGCGG - Intergenic
1186151437 X:6678714-6678736 CCAAGTTATCAGCTGCAAGGAGG + Intergenic
1190740592 X:53285997-53286019 CAATGTTATCAGCTTGATGCTGG - Intronic
1198543156 X:137661909-137661931 AAAAGTCATCAGATGGACAGAGG + Intergenic
1198653456 X:138888872-138888894 CAAAGATATCAGAAGAATGATGG - Intronic
1198992372 X:142529576-142529598 CAAAGTTATTAGATTCATGTTGG - Intergenic
1199619921 X:149689946-149689968 CAAAATTCTCAGAGGGATAGTGG - Intronic