ID: 901095616

View in Genome Browser
Species Human (GRCh38)
Location 1:6676837-6676859
Sequence GTGCCTGTCTCTTCCAGTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 200}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901095616_901095618 16 Left 901095616 1:6676837-6676859 CCAGAACTGGAAGAGACAGGCAC 0: 1
1: 0
2: 2
3: 19
4: 200
Right 901095618 1:6676876-6676898 ACATTGAATGAACTTTGGCCAGG 0: 1
1: 0
2: 0
3: 9
4: 176
901095616_901095620 24 Left 901095616 1:6676837-6676859 CCAGAACTGGAAGAGACAGGCAC 0: 1
1: 0
2: 2
3: 19
4: 200
Right 901095620 1:6676884-6676906 TGAACTTTGGCCAGGTGTGGTGG 0: 1
1: 12
2: 156
3: 1363
4: 9655
901095616_901095617 11 Left 901095616 1:6676837-6676859 CCAGAACTGGAAGAGACAGGCAC 0: 1
1: 0
2: 2
3: 19
4: 200
Right 901095617 1:6676871-6676893 ACTAAACATTGAATGAACTTTGG 0: 1
1: 0
2: 0
3: 18
4: 281
901095616_901095619 21 Left 901095616 1:6676837-6676859 CCAGAACTGGAAGAGACAGGCAC 0: 1
1: 0
2: 2
3: 19
4: 200
Right 901095619 1:6676881-6676903 GAATGAACTTTGGCCAGGTGTGG 0: 1
1: 0
2: 26
3: 159
4: 954

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901095616 Original CRISPR GTGCCTGTCTCTTCCAGTTC TGG (reversed) Intronic
900489227 1:2938635-2938657 GTGCCTGGCTCCTCCACTCCCGG - Intergenic
900668938 1:3837416-3837438 GTTCCTCTTTCTTCCAGTTGTGG + Exonic
901026139 1:6279673-6279695 GTGCCGGCCTCTCCCAGGTCGGG - Intronic
901095616 1:6676837-6676859 GTGCCTGTCTCTTCCAGTTCTGG - Intronic
902238436 1:15072952-15072974 TTGCCGGTCTCTTCCTCTTCTGG - Intronic
902708684 1:18223963-18223985 GTGACTGTGTCTTCCATTCCAGG - Intronic
905344873 1:37304518-37304540 GTGCCTCTCTCTCCCAGAGCTGG - Intergenic
906521990 1:46472798-46472820 TTGCCTGTCCTTTCCAGATCTGG + Intergenic
912205141 1:107500488-107500510 CTGCCAGTCTCTTCAGGTTCTGG - Intergenic
913130620 1:115835223-115835245 GTGCCTGTCTTTCCCAGTTTAGG - Intergenic
916449847 1:164910063-164910085 GTGGCTGTAGATTCCAGTTCAGG + Intergenic
916800300 1:168209689-168209711 TTGCCTGTCTCTTCAATTTTGGG - Intergenic
917530665 1:175832198-175832220 GTGACTATCTTTTCCATTTCAGG - Intergenic
918835403 1:189457440-189457462 GTGAGTTTCTCTTTCAGTTCAGG - Intergenic
922924867 1:229340400-229340422 GTGCCTGTATTTACCAGCTCAGG - Intronic
924850439 1:247823761-247823783 GTGGGTGTCTCCTCCAATTCTGG - Intergenic
1063879589 10:10517517-10517539 GTGCCTGTCTCCTGGAGTTCAGG + Intergenic
1065903823 10:30230721-30230743 GTGTCTGTCATTTCCAGGTCTGG - Intergenic
1067358824 10:45557702-45557724 GGGCCTGCCTCTTCCTGTTTTGG - Intronic
1067462266 10:46466509-46466531 GAGCCTGTCTTGTCCAGCTCTGG - Intergenic
1067536919 10:47117738-47117760 CTGCCTGTCTCTTCCCTTTTTGG + Intergenic
1067624931 10:47918128-47918150 GAGCCTGTCTTGTCCAGCTCTGG + Intergenic
1068033602 10:51732940-51732962 GTGCCAGTATGGTCCAGTTCTGG + Intronic
1068680535 10:59815078-59815100 GGGCTTGTCCCTTACAGTTCTGG + Intronic
1070326564 10:75393383-75393405 GTGCCTGTCACTTCCAGCTAGGG - Intergenic
1070761601 10:79027628-79027650 GTGCTTGGCTCTTCAAGGTCTGG + Intergenic
1070896872 10:79991559-79991581 GTGCCAGTCTCTTTCTGTTTTGG - Intergenic
1070979324 10:80631790-80631812 GTGCCTGCCTCTCCCAGCCCCGG - Intronic
1071473007 10:85999425-85999447 GTACCTCTCTCTTCTATTTCTGG - Intronic
1071783520 10:88873953-88873975 GTGCCTGCCATTTCCAGTTTTGG + Intergenic
1072497786 10:95979630-95979652 CTGCCTTTCTTTTCCATTTCTGG + Intronic
1073475308 10:103748690-103748712 GTGCCTGTCTCTTCAGTCTCTGG - Intronic
1074809758 10:117091896-117091918 ATGCCTGTATCCTCCAGTTGAGG + Intronic
1077390303 11:2297794-2297816 GTGCTTATTTCTTGCAGTTCTGG + Exonic
1078084068 11:8223329-8223351 CTGCCTGTCTGCTGCAGTTCTGG + Intergenic
1083313409 11:61798441-61798463 GTGCCATTCTCTCCCAGTGCTGG + Intronic
1083625166 11:64068691-64068713 GTGTCTGTCTCTCCCAGCTGAGG + Intronic
1084673131 11:70619336-70619358 TTTCCTGTCTCTTCCAGCTCTGG + Intronic
1084785343 11:71438679-71438701 GTGCCTGTCTCTGCCAGCCCTGG - Intronic
1085113268 11:73907572-73907594 GTGCCTGTCACTGCCAGGTGGGG + Intronic
1085579472 11:77637780-77637802 GTGACTGCCTCTTCCAGGGCGGG - Exonic
1087419180 11:97898719-97898741 CTCTCTGTCTCTTCCAGTTTTGG - Intergenic
1089707402 11:120289602-120289624 GGGGCTTTCTCTTCCTGTTCAGG - Intronic
1091962184 12:4705424-4705446 CTGCCTGTCTCTCCCATTTTGGG - Intronic
1091992501 12:4967284-4967306 GTAACTGACTCTTCCATTTCAGG + Intergenic
1094836998 12:34326732-34326754 GGGCCTGTTTCTCCCATTTCAGG + Intergenic
1095745540 12:45654251-45654273 GTGCCAGTGGCTTCCAGTGCTGG + Intergenic
1095825458 12:46525994-46526016 GTGCCTCTCTCTTCCCATTCTGG - Intergenic
1095969627 12:47892637-47892659 GTGTCTCTCACTTCCAGTACAGG - Intronic
1097178989 12:57160201-57160223 GATCCTGTCACTCCCAGTTCAGG + Intronic
1097843755 12:64345558-64345580 GTGCATGTATCTTCCATTGCAGG + Intronic
1098154859 12:67587301-67587323 GTGCATGTCTTTTGCAGATCAGG - Intergenic
1098840390 12:75470711-75470733 GACCCTGTCTCTTGTAGTTCAGG - Intergenic
1099530851 12:83778997-83779019 TTCCCTGTGTCTTCCAGTTTAGG + Intergenic
1102677185 12:114666884-114666906 GTAGCTGTCTCTTCCAATTTGGG - Intergenic
1105009595 12:132746815-132746837 GTGACTGCCTGTTCCAGTTGGGG + Intronic
1105541518 13:21320754-21320776 GTGGCTGGCCCTTCCAGTCCAGG - Intergenic
1108097511 13:46919226-46919248 GTGTGTGTCTCTGCCAGATCTGG + Intergenic
1110657974 13:78023341-78023363 GGGCCTGCTTCTTCCTGTTCTGG - Intergenic
1111818194 13:93181251-93181273 CTGCCTGTCTCTTCAATTTGGGG + Intergenic
1117051535 14:51865256-51865278 GTGCCTGTCTTTACTAGATCTGG + Intronic
1117125572 14:52620148-52620170 GTGGATTTCTCTTCCAGTTTTGG - Intronic
1117368907 14:55058000-55058022 TTGCCTCCCTCTTCCAGTTCAGG + Intronic
1117753974 14:58954714-58954736 TTGCCTGTCTCCCCCAGTTAGGG - Intergenic
1118832849 14:69451120-69451142 TTGACTGTTCCTTCCAGTTCAGG + Intronic
1120306021 14:82771649-82771671 GTGTGTGTCTCTTCCAGATTTGG + Intergenic
1121507397 14:94487219-94487241 GTGCCTGTGACTTCCATCTCAGG + Intergenic
1124084541 15:26535063-26535085 GTGTGTGTCTCTTCCAGGTTTGG - Intergenic
1124888107 15:33705966-33705988 GTTCCTGGTTTTTCCAGTTCTGG - Intronic
1127192440 15:56545134-56545156 TTACCTGTCTCTGCCATTTCAGG + Intergenic
1127926942 15:63555756-63555778 GTGTCTCTCTCTTACAGTACTGG - Intronic
1127999257 15:64175585-64175607 GAGCCTGTCTTTTCCACTCCTGG - Intronic
1128058817 15:64720462-64720484 GGGACTGTCACTTCCATTTCTGG - Intergenic
1129299546 15:74617669-74617691 GTGACTGTGTCCTCCAGCTCTGG + Intronic
1129819490 15:78588013-78588035 GTGCCTGTGGCTTCAAGTCCTGG + Intronic
1131149475 15:90037870-90037892 AAGCCTGTCTCTTACAGCTCTGG - Intronic
1131978893 15:97976269-97976291 AAGCGTGTCTCTTCCTGTTCAGG - Intergenic
1132678999 16:1132057-1132079 CTTCCTGCCTCTTCCAGCTCCGG + Intergenic
1135019190 16:18949259-18949281 GTGGCTGAATCTGCCAGTTCTGG + Intergenic
1136006729 16:27335630-27335652 GTGCCTGTTTTGTCCAGGTCAGG + Intronic
1136236043 16:28914336-28914358 GAGGCCGTCTCTTCCTGTTCAGG + Exonic
1136417875 16:30114438-30114460 GTCCCAGTCTCTGGCAGTTCTGG - Exonic
1137275572 16:46931124-46931146 TTGCCTGGCTATTCCTGTTCTGG + Exonic
1142273473 16:89103394-89103416 GTTCCTGCCTCTTGCAGCTCTGG + Intronic
1143308912 17:5972141-5972163 TCTCCTGTCTCTTCCAGCTCTGG + Intronic
1145408311 17:22630752-22630774 TTCCCTGCCTCTTCTAGTTCCGG - Intergenic
1146668459 17:34720616-34720638 GTGCCTTTCTCTCCCAGGCCAGG - Intergenic
1148438825 17:47701326-47701348 GTGTCTGTGTGTTCCAGGTCTGG - Intronic
1148628829 17:49091170-49091192 GTGCCTGGCAATTCCAGTTAGGG - Intergenic
1155098251 18:22580940-22580962 GACACTGTCTCTTCCTGTTCAGG - Intergenic
1155491310 18:26404565-26404587 GTCCCTGTCTCTTCCAGAGTAGG - Intergenic
1155740900 18:29286364-29286386 GTGCCTGTCATTTGCAGGTCAGG - Intergenic
1158031258 18:52967599-52967621 CTGTCTCTCTCTTCAAGTTCTGG + Intronic
1159744208 18:72211106-72211128 GTGGCTCTCTGTTCCAATTCAGG - Intergenic
1159855638 18:73584295-73584317 TTACCTTTCTCTTCCAATTCTGG - Intergenic
1161123129 19:2541046-2541068 GTCCCTGTCTCTGCCAGGCCGGG - Intronic
1162157882 19:8692095-8692117 CTGCCTTTCTCTTCCAGTTATGG - Intergenic
1162457147 19:10792230-10792252 GTGCTTGCCTCTCCCAGTTGGGG + Intronic
1163641133 19:18462729-18462751 GTGACTGCCTCTTGCAGTTCAGG - Intronic
1164430959 19:28188424-28188446 GTGCCTGTCTCTTATGGTTGAGG + Intergenic
1164540681 19:29119579-29119601 GTGCCTGTCTCCCCCACTGCTGG - Intergenic
1168380817 19:55921843-55921865 GTTCTGGTCTCTTCCAGCTCTGG - Intronic
928241794 2:29592869-29592891 ATTCTTGCCTCTTCCAGTTCTGG - Intronic
928473644 2:31601078-31601100 GTCTCTGTCTCCTTCAGTTCAGG - Intergenic
928772933 2:34723292-34723314 ATGCTTGTCTCTTCTAATTCTGG + Intergenic
929541739 2:42828212-42828234 GTTCCTGGCTCTTCCAGCCCAGG - Intergenic
932783322 2:74577775-74577797 GTGCCTGACTTCTCCATTTCCGG + Intronic
933117013 2:78486698-78486720 GTGCCTTTGTCTTCCACATCTGG - Intergenic
934489050 2:94745470-94745492 GTGCATGTCTCTGCCAGCACAGG + Intergenic
935437541 2:103052153-103052175 GTTACTGTCTGTTCAAGTTCTGG + Intergenic
937563783 2:123258689-123258711 GTGCCTGTCACTTCAGATTCTGG + Intergenic
938567829 2:132536059-132536081 GTCTCTGTCTCCTTCAGTTCTGG + Intronic
938764027 2:134448627-134448649 GTGCCTTTCTCTTCCTCTTCAGG + Exonic
940529054 2:154856556-154856578 ATGCCTGTCACTTATAGTTCAGG + Exonic
942389496 2:175477310-175477332 GTGCCTGGGCCCTCCAGTTCTGG - Intergenic
944657536 2:201891122-201891144 TTGCCTTTCTCTTCCACTCCCGG + Intronic
946810016 2:223513744-223513766 AAGCCTGACTCTTCTAGTTCAGG + Intergenic
948263157 2:236619163-236619185 GTGGCTGCCTCTTTCAGTGCAGG + Intergenic
948284444 2:236772974-236772996 CTCCCTGTCTCTTCCAGCTGTGG + Intergenic
948630486 2:239299471-239299493 GTGCATGTCTCTTCTGGTTTCGG - Intronic
948807131 2:240457839-240457861 GGGCCTGTCTCATCCTGTTCTGG - Intronic
948971533 2:241431657-241431679 CTGTCTGTCTCTTGCATTTCAGG + Exonic
1169347401 20:4839478-4839500 GTTCCTGCCTCTCCCACTTCTGG + Intergenic
1172837579 20:37882947-37882969 GTTCCTGTCCCTTCCCCTTCTGG - Intergenic
1173935019 20:46853848-46853870 GGGCCTGACTTTTTCAGTTCAGG - Intergenic
1174190215 20:48735155-48735177 GCTCCTGTCTCTTCCAGTACGGG - Intronic
1175404728 20:58718637-58718659 GTGTCTATCTCTTCCATTTTTGG - Intronic
1176206349 20:63890725-63890747 GTGGCAGCCTCTTCCAGTTGAGG + Exonic
1177930646 21:27278895-27278917 GAGCTTATTTCTTCCAGTTCTGG + Intergenic
1178509023 21:33186664-33186686 GGGCCTGACTCTTCCCGTGCTGG + Intergenic
1178762727 21:35419315-35419337 GGGACTGTCTCTTCTAGTGCAGG - Intronic
1179016681 21:37600055-37600077 TTCCTTGTTTCTTCCAGTTCTGG + Intergenic
1179329129 21:40381437-40381459 TTGACTGTCTGTTCCAGTTGTGG + Intronic
1179561160 21:42217094-42217116 CTGCCTCACACTTCCAGTTCCGG + Intronic
1180708745 22:17825563-17825585 GTGCCTGTTTCTCCCACTGCCGG + Intronic
1180757554 22:18173132-18173154 GTGCCTGTCTCTTTCCAGTCTGG + Exonic
1181074222 22:20364313-20364335 GTGCCTGTCTCTTTCCAGTCTGG - Exonic
1181276206 22:21688715-21688737 GGGCCTTTCTCTTCCAGGTGGGG + Exonic
1181540585 22:23570926-23570948 TTGCCTCTCGCTTCCAGTCCGGG + Intergenic
1181830844 22:25559101-25559123 GAGCTTGTCTCTTCCTGTCCTGG - Intergenic
1182041455 22:27241827-27241849 GTGCCTCCCTCTTCCTGCTCAGG - Intergenic
1183133418 22:35862562-35862584 GTTTCTGTCTCTCCCACTTCAGG + Intronic
1183975332 22:41508765-41508787 GGGCCTCTCTCTCCCAGCTCTGG + Intronic
1184782522 22:46656319-46656341 GTGCCTGTCTCTTCCCTTTTGGG + Intronic
951365472 3:21776805-21776827 GTGCCTTTCTCATGGAGTTCTGG - Intronic
953574891 3:44105095-44105117 GTGCCAGTGTCTCCCAGCTCAGG + Intergenic
953859581 3:46531637-46531659 CTCCCAGTCTTTTCCAGTTCAGG - Intronic
954139874 3:48599345-48599367 GAGCCTGTCCCTTCATGTTCTGG + Intronic
954667363 3:52263723-52263745 ATCTCTGTCTCTTCCAATTCTGG - Intronic
956668718 3:71666099-71666121 GTCTCTGTCTCCTTCAGTTCAGG - Intergenic
956910477 3:73811124-73811146 GTGCCTCTCTGTTTCAGTGCTGG + Intergenic
959861714 3:111223838-111223860 GTGCATGTCTCTTCCCTTTAAGG - Intronic
961633966 3:128321448-128321470 GTCCCTCTCCCTTCCTGTTCAGG + Intronic
962807545 3:138938140-138938162 GTGCCTGACTCATTCAGGTCAGG + Intergenic
963664013 3:148159438-148159460 GTGCCTGTCTCTTATGGTTGAGG + Intergenic
967540220 3:190658350-190658372 CAACCTGTGTCTTCCAGTTCTGG - Intergenic
968460847 4:724020-724042 GTGCCTGACGCTTGCAGTCCTGG - Intronic
968900781 4:3430783-3430805 GAGACTGCCTCTTCCAGATCTGG - Exonic
970550266 4:17173548-17173570 CTGCCTGTCTCCTCCCTTTCAGG - Intergenic
972733153 4:41814782-41814804 CTCCCTGCCTCTTCCAGTTTCGG + Intergenic
979098042 4:116575649-116575671 ATGGCTATCTCTTCCAGTTCTGG + Intergenic
979874315 4:125868229-125868251 GTGTCTGTCTCTGCCAGTTTTGG - Intergenic
982271268 4:153591599-153591621 GTGCCTCTCTCGTCCAGCTCCGG + Intronic
982964044 4:161879531-161879553 GAGCCTGTCTCTGTCAGTTCTGG + Intronic
983629192 4:169832564-169832586 GTGACTGTCTCTTCCAGAATGGG + Intergenic
983864455 4:172748185-172748207 TTACCTGTTTATTCCAGTTCAGG + Intronic
983921092 4:173345835-173345857 GTGGCTGGCTCTTTCACTTCAGG + Intergenic
985639877 5:1058637-1058659 GTGCCAATCTCTTCCCTTTCGGG - Intronic
985976345 5:3421186-3421208 AAGTCTGTCTCTTCCATTTCTGG - Intergenic
986285084 5:6353402-6353424 CTTCCTGCCTCTTCCAGCTCTGG - Intergenic
987488239 5:18547043-18547065 GTGGTTGTCTGTTCCAGTTTGGG + Intergenic
990302903 5:54466485-54466507 GTTCCTATCTCTTCCGGTTAAGG + Intergenic
993147537 5:84114320-84114342 GGGCCTGAATATTCCAGTTCAGG + Intronic
993841835 5:92889783-92889805 GTGCCTCTCACTTCCAGTCAGGG + Intergenic
995710636 5:115031986-115032008 CTGCCTGCCATTTCCAGTTCAGG + Intergenic
997129714 5:131264321-131264343 GAGCCTGCGTCTTCCATTTCAGG + Intronic
1001499104 5:172214979-172215001 CTGCCTGTCTCTCCTATTTCGGG - Intronic
1001788130 5:174431336-174431358 GTGGCTGTTTCTTCCTGTGCTGG + Intergenic
1002182946 5:177440984-177441006 GTGGCTGGCCCTTCCAGTCCAGG - Exonic
1003488959 6:6604632-6604654 ATGCATGTCTTTTGCAGTTCTGG - Intronic
1006107495 6:31725148-31725170 GTGCCTTCCTCTTCCAGGTGAGG - Exonic
1007105958 6:39283082-39283104 CTACCTGTCTCTTCCACATCTGG + Intergenic
1007381904 6:41495479-41495501 GTGCTTCTGTCTTCCATTTCAGG - Intergenic
1007922092 6:45619550-45619572 TTCCTTGTCTCTTCCAGCTCCGG + Intronic
1011293132 6:85798151-85798173 TTCCTTGTCTCTTCCACTTCTGG + Intergenic
1012299435 6:97566326-97566348 TTGTCTGTATCTTCCAGTTTAGG - Intergenic
1013819291 6:114135502-114135524 CCGCCTGTCTGTTCCAGCTCCGG - Intronic
1022782717 7:33602367-33602389 GTGTCTGCCACTTCCAGTTTGGG - Intronic
1026653660 7:72237503-72237525 GTGCCTGTCTCTGCCTCTCCTGG - Intronic
1026844772 7:73692579-73692601 GTTCCTGTTTCTTTCAGGTCCGG + Exonic
1031158776 7:118141611-118141633 GTGCCTGTCTCATAGAGTTTTGG + Intergenic
1032486954 7:132295135-132295157 GTACCTCTCTTTTCCAATTCTGG + Intronic
1033254093 7:139784539-139784561 GTGCCTGGCACTGCGAGTTCTGG + Intronic
1033766066 7:144491725-144491747 CTGCCTGTCTCCTAAAGTTCTGG - Intronic
1034425964 7:151014177-151014199 CTGGCTTTCCCTTCCAGTTCCGG + Exonic
1035069227 7:156128978-156129000 ATTCCCGTTTCTTCCAGTTCTGG + Intergenic
1035280246 7:157773778-157773800 GTGTCCGCCTCATCCAGTTCTGG + Intronic
1036297095 8:7546337-7546359 CTGCCTGTCTCTTCCGGTTCAGG - Intergenic
1036325474 8:7774682-7774704 CTGCCTGTCTCTTCCGGTTCAGG + Intergenic
1041703230 8:60815567-60815589 GTGCATATGTATTCCAGTTCAGG + Intronic
1045311769 8:101009426-101009448 GTTCCAGTCTCTTCCAGGCCTGG - Intergenic
1047337847 8:123953501-123953523 GTGCCTGTCTCTACAAGGTGGGG + Intronic
1047761996 8:127961308-127961330 ATCCCTGTCTCCTCCAGCTCAGG - Intergenic
1048297854 8:133227929-133227951 ATGCCTGTCTCTAGCTGTTCTGG + Exonic
1049297363 8:141849847-141849869 GTGTGTGCCTCTTCCAGTCCTGG - Intergenic
1049381550 8:142318932-142318954 CTGCCTGTCTCTCCCTGTCCTGG - Intronic
1050993590 9:12184338-12184360 GTGCTTATTTCTTCCAGTTGGGG + Intergenic
1053668736 9:40338872-40338894 GTGCATGTCTCTGCCAGCACAGG - Intergenic
1053918538 9:42965145-42965167 GTGCATGTCTCTGCCAGCACAGG - Intergenic
1054379872 9:64478909-64478931 GTGCATGTCTCTGCCAGCACAGG - Intergenic
1054515875 9:66037422-66037444 GTGCATGTCTCTGCCAGCACAGG + Intergenic
1055560356 9:77515985-77516007 ATGGCTGTCTCTTCCTGCTCTGG - Intronic
1060600276 9:124872677-124872699 GTCCCTCTGTCTTTCAGTTCTGG - Intronic
1061934467 9:133849695-133849717 CTTCCTGCCTCTTCCAGCTCAGG + Intronic
1185738140 X:2508987-2509009 GTGTCTCTCTCTTCCTGTTGAGG + Intergenic
1194223714 X:91227989-91228011 GGGCCTGTGTCTTCCCCTTCAGG - Intergenic
1195639129 X:107154832-107154854 GTGCCTGTGTCTTCCACTTAGGG - Intronic
1196419057 X:115504347-115504369 TTGCCTGTCTCTCCAAGTTCAGG + Intergenic
1197958416 X:131978023-131978045 ATTCATGTCTCTTCCAGTTTGGG - Intergenic
1198056135 X:132997073-132997095 GGCCATGTCTCTTCCAATTCAGG - Intergenic
1198152132 X:133921874-133921896 GTGCCTGTCTCTCCTGGTTAGGG + Intronic
1200236610 X:154470767-154470789 GGGCCTGTTGCGTCCAGTTCTGG + Intronic