ID: 901095967

View in Genome Browser
Species Human (GRCh38)
Location 1:6679948-6679970
Sequence GTGTGATAAATGTGTACAGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 167}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901095967_901095968 -1 Left 901095967 1:6679948-6679970 CCGACTGTACACATTTATCACAC 0: 1
1: 0
2: 0
3: 8
4: 167
Right 901095968 1:6679970-6679992 CACTGCAGCCTGATTTTCACTGG 0: 1
1: 0
2: 1
3: 133
4: 2250
901095967_901095970 21 Left 901095967 1:6679948-6679970 CCGACTGTACACATTTATCACAC 0: 1
1: 0
2: 0
3: 8
4: 167
Right 901095970 1:6679992-6680014 GCCATTAAAATCTAACTTTTTGG 0: 1
1: 0
2: 0
3: 25
4: 257

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901095967 Original CRISPR GTGTGATAAATGTGTACAGT CGG (reversed) Intronic