ID: 901095968 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 1:6679970-6679992 |
Sequence | CACTGCAGCCTGATTTTCAC TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 2385 | |||
Summary | {0: 1, 1: 0, 2: 1, 3: 133, 4: 2250} |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
901095967_901095968 | -1 | Left | 901095967 | 1:6679948-6679970 | CCGACTGTACACATTTATCACAC | 0: 1 1: 0 2: 0 3: 8 4: 167 |
||
Right | 901095968 | 1:6679970-6679992 | CACTGCAGCCTGATTTTCACTGG | 0: 1 1: 0 2: 1 3: 133 4: 2250 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
901095968 | Original CRISPR | CACTGCAGCCTGATTTTCAC TGG | Intronic | ||