ID: 901095968

View in Genome Browser
Species Human (GRCh38)
Location 1:6679970-6679992
Sequence CACTGCAGCCTGATTTTCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2385
Summary {0: 1, 1: 0, 2: 1, 3: 133, 4: 2250}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901095967_901095968 -1 Left 901095967 1:6679948-6679970 CCGACTGTACACATTTATCACAC 0: 1
1: 0
2: 0
3: 8
4: 167
Right 901095968 1:6679970-6679992 CACTGCAGCCTGATTTTCACTGG 0: 1
1: 0
2: 1
3: 133
4: 2250

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901095968 Original CRISPR CACTGCAGCCTGATTTTCAC TGG Intronic
Too many off-targets to display for this crispr