ID: 901095970 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:6679992-6680014 |
| Sequence | GCCATTAAAATCTAACTTTT TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 283 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 25, 4: 257} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 901095969_901095970 | -9 | Left | 901095969 | 1:6679978-6680000 | CCTGATTTTCACTGGCCATTAAA | 0: 1 1: 0 2: 5 3: 27 4: 193 |
||
| Right | 901095970 | 1:6679992-6680014 | GCCATTAAAATCTAACTTTTTGG | 0: 1 1: 0 2: 0 3: 25 4: 257 |
||||
| 901095967_901095970 | 21 | Left | 901095967 | 1:6679948-6679970 | CCGACTGTACACATTTATCACAC | 0: 1 1: 0 2: 0 3: 8 4: 167 |
||
| Right | 901095970 | 1:6679992-6680014 | GCCATTAAAATCTAACTTTTTGG | 0: 1 1: 0 2: 0 3: 25 4: 257 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 901095970 | Original CRISPR | GCCATTAAAATCTAACTTTT TGG | Intronic | ||