ID: 901097756

View in Genome Browser
Species Human (GRCh38)
Location 1:6695905-6695927
Sequence ACTATGTAGGGCTTTGCAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 93
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 86}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901097756_901097765 15 Left 901097756 1:6695905-6695927 CCAGCTGCAAAGCCCTACATAGT 0: 1
1: 0
2: 0
3: 6
4: 86
Right 901097765 1:6695943-6695965 CATTGTTAACTAAGAAGTACTGG 0: 1
1: 0
2: 2
3: 6
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901097756 Original CRISPR ACTATGTAGGGCTTTGCAGC TGG (reversed) Intronic