ID: 901097756

View in Genome Browser
Species Human (GRCh38)
Location 1:6695905-6695927
Sequence ACTATGTAGGGCTTTGCAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 93
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 86}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901097756_901097765 15 Left 901097756 1:6695905-6695927 CCAGCTGCAAAGCCCTACATAGT 0: 1
1: 0
2: 0
3: 6
4: 86
Right 901097765 1:6695943-6695965 CATTGTTAACTAAGAAGTACTGG 0: 1
1: 0
2: 2
3: 6
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901097756 Original CRISPR ACTATGTAGGGCTTTGCAGC TGG (reversed) Intronic
901097756 1:6695905-6695927 ACTATGTAGGGCTTTGCAGCTGG - Intronic
903184910 1:21623324-21623346 ACTCTGTAGGCCCTTCCAGCTGG + Intronic
905275892 1:36817890-36817912 GCTATGCAGTGCTTTGCAGGAGG + Intronic
908215675 1:61949240-61949262 AGTATGTAATGTTTTGCAGCAGG - Intronic
914898873 1:151701171-151701193 ACTTGGTAGGGCTTTGCAGTTGG + Intergenic
916475329 1:165163265-165163287 CCTATGCAGGGTTTTGGAGCTGG - Intergenic
919782351 1:201229088-201229110 ACTATGTAGGCCTGGGCTGCAGG - Intergenic
1063965242 10:11341319-11341341 ACTAGGTAGGTCTTTGCTGCAGG - Intergenic
1068770956 10:60820117-60820139 GCTATGAAGGGCTCTGCAGTGGG + Intergenic
1071830116 10:89363169-89363191 ACCAGATAGGGCTTTGCTGCAGG + Intronic
1072872525 10:99134975-99134997 ACTATGTGTGTCTTTGCAGGTGG - Intronic
1076113195 10:127876628-127876650 AATAAGTAGGGCTTTAGAGCAGG + Intergenic
1080409894 11:32013727-32013749 ACTGTGGAAGGCTTTGCATCAGG - Intronic
1084891658 11:72239835-72239857 ACTACTTAAGGCTTGGCAGCCGG - Exonic
1085180992 11:74535859-74535881 ACTTTGTAGGGCATTTCACCAGG + Intronic
1085943680 11:81239196-81239218 ATTTTGTAGGGCTTGTCAGCAGG + Intergenic
1092026786 12:5247355-5247377 AATATCTAGGGCTTTGCTGCAGG - Intergenic
1094650648 12:32372580-32372602 ACAATGTAGAACTTTTCAGCCGG + Intronic
1103369279 12:120406498-120406520 AATATGTAGGGATTTGCAGGTGG - Intergenic
1107011459 13:35674894-35674916 ACTAGAAATGGCTTTGCAGCAGG - Intergenic
1121515663 14:94548295-94548317 GCTATGAAGGACTTGGCAGCAGG - Intergenic
1122057617 14:99115336-99115358 ATGAAGTAGGGGTTTGCAGCAGG - Intergenic
1122794403 14:104198774-104198796 TCTACGCAGGGCTCTGCAGCAGG - Intergenic
1127134479 15:55905388-55905410 ATTATGTTGGGCTTTTCAACTGG - Intronic
1127982119 15:64042799-64042821 ACTCTCCAGGGCTTTCCAGCTGG - Intronic
1141404988 16:83784816-83784838 ACTCTGTTGGGCTTTGCAGTGGG - Intronic
1147930714 17:43978839-43978861 AGTATGGAGGGCTATGCTGCTGG - Intronic
1149239750 17:54635398-54635420 ACTAGGTAGGGCTTGGCCTCAGG - Intergenic
1151472850 17:74328505-74328527 GGTATGCAGGGCTCTGCAGCAGG + Exonic
1158350455 18:56559949-56559971 AATATGTAAGGATTTGCAGATGG + Intergenic
1161462031 19:4403167-4403189 ACCATGTTGGACCTTGCAGCGGG + Intronic
1166133901 19:40763772-40763794 GCCAAGTAGGGCTTTGCAGAAGG + Intronic
1167004037 19:46763874-46763896 ACTATGTAGCGTCTTGCATCTGG - Intronic
1167983520 19:53296520-53296542 AATATGTAGGGCCTTCAAGCAGG - Intergenic
925867269 2:8239664-8239686 AATTTATAGGACTTTGCAGCCGG + Intergenic
927690160 2:25202507-25202529 TCTATCTAGGGCGTTACAGCCGG + Intergenic
931931421 2:67139935-67139957 ATTATTTAGGGTTTTCCAGCAGG + Intergenic
932466268 2:71926264-71926286 ACTCTGTAAGGCTTGGGAGCTGG - Intergenic
935223153 2:101032032-101032054 ACTCTGTAGGTCTTTATAGCAGG + Intronic
936652965 2:114450863-114450885 AATAGGTAGGGCTTTTCAGGGGG + Intronic
937067385 2:119028143-119028165 ACTGTGAAGAGCTTTGCAGATGG + Intergenic
939292755 2:140216982-140217004 ACTGGGTAGGACTTTGCATCTGG - Intergenic
940697776 2:157001392-157001414 ACTTTGTAAGCCTCTGCAGCAGG + Intergenic
945129486 2:206553793-206553815 AATATGTGGGGATTTGCTGCTGG + Intronic
946412991 2:219524716-219524738 ACTAGGTTGGGCTTTCCATCTGG + Intronic
949055532 2:241926354-241926376 ACGATGTAGGACTGTGCATCTGG - Intergenic
1175519051 20:59588012-59588034 AATGTGAAGGCCTTTGCAGCTGG - Intronic
1176995565 21:15551556-15551578 ACTATTTAAGGCTTTTGAGCAGG - Intergenic
1182267347 22:29127973-29127995 AATATGTAGCCCTTTGCATCTGG - Intronic
1182273513 22:29170683-29170705 ATAATGGTGGGCTTTGCAGCTGG - Intergenic
1184095040 22:42311825-42311847 ACTATGCAGGGCTCTGGTGCAGG - Intronic
949393849 3:3593681-3593703 ACTGTGTAGTGTTTTGCATCTGG + Intergenic
950354594 3:12396066-12396088 ACTATAAAGGACTTGGCAGCAGG - Intronic
950927648 3:16759035-16759057 ATTATTTAGGTCTTTGCAGTTGG + Intergenic
957580710 3:82068991-82069013 ACTATTTAGAGATTGGCAGCTGG + Intergenic
960234392 3:115264873-115264895 AAAATGTAAGGCTTTGCAGTTGG + Intergenic
962253131 3:133851512-133851534 CCTGTCTAGGCCTTTGCAGCAGG - Intronic
973644314 4:52934606-52934628 ACTATGTGAAGCTTTGCAGAAGG - Intronic
973823260 4:54681554-54681576 CCTATGAAGGTCTTTGCTGCTGG + Intronic
980328988 4:131386788-131386810 TGTATGTAGGGCTTTTCAGCAGG - Intergenic
980797067 4:137698686-137698708 ACTATGTATTTTTTTGCAGCTGG - Intergenic
982316480 4:154037107-154037129 ACCATGAAGTGCTATGCAGCTGG + Intergenic
983892044 4:173039718-173039740 ACTATGTAGGGCCTACAAGCAGG - Intronic
985207814 4:187559202-187559224 AATATGTAGTGTTTTGTAGCTGG + Intergenic
985534619 5:457055-457077 AGTAACTAGGGCTTGGCAGCAGG + Intronic
992448752 5:76856882-76856904 ACTATGTAGAGCTCTGGAGAAGG + Intronic
993139780 5:84017271-84017293 GCTATGCAGGGCTTTGCTACTGG + Intronic
1000339784 5:160268258-160268280 ACTGTGTAAGGCAGTGCAGCGGG + Intronic
1005168398 6:22952625-22952647 CCTATGTATGGCATAGCAGCAGG + Intergenic
1005835935 6:29709648-29709670 ACTAAGTAGTGCTTTGCAAAGGG - Intergenic
1017322464 6:153109871-153109893 ACCATGTTGGGCTTTGCCTCAGG - Intronic
1020873686 7:13667560-13667582 ACAATGTAGTGCTTTGAATCTGG + Intergenic
1022738893 7:33102528-33102550 ACTAAGTAAGGCTTTTCAGATGG - Intronic
1023506334 7:40903227-40903249 CCTCTGAAGGGCTGTGCAGCTGG + Intergenic
1025986912 7:66461995-66462017 ACTATTTATGGTTTTGAAGCTGG + Intergenic
1032506283 7:132436983-132437005 CATCTGTAGGGCATTGCAGCAGG - Intronic
1038646416 8:29365873-29365895 CCCATGCAGGGCTTAGCAGCTGG - Intergenic
1040531523 8:48270277-48270299 ACCATGTTGGGGTTTGCAGAGGG - Intergenic
1042683662 8:71414085-71414107 ACTATGTAGGGCCTTCCCTCTGG - Intronic
1048041944 8:130739071-130739093 ACAATATACGTCTTTGCAGCCGG - Intergenic
1051607677 9:18931268-18931290 AATATGTAGCGTTTTGCATCTGG + Intronic
1052094677 9:24369747-24369769 ACTAGGTAGGGCCTCCCAGCTGG - Intergenic
1052348002 9:27429295-27429317 TCCATGTGGGGCTATGCAGCTGG - Intronic
1053461706 9:38276626-38276648 ACCATGAAGGGATTTGCATCTGG - Intergenic
1059989016 9:119847059-119847081 ACTATGTAAGTCTTTGCTTCTGG - Intergenic
1060782845 9:126425805-126425827 ACTCTGTAGGGTTTTGAAGATGG + Intronic
1189972493 X:46432661-46432683 AATCTGTAGGGCTGGGCAGCAGG - Intergenic
1190801950 X:53797549-53797571 ACTATGTAGGGATTAGCATGAGG - Intergenic
1192298571 X:69876690-69876712 AATATGTAGGTTTTTGCATCTGG + Intronic
1193473167 X:81931413-81931435 AATATGCAGGGATTTGCTGCAGG + Intergenic
1195479611 X:105328602-105328624 ATTCTGTAGGGTTTTGCTGCAGG - Intronic
1199168316 X:144704223-144704245 ATTATGTAGGACATGGCAGCAGG + Intergenic
1199508090 X:148588985-148589007 ACTAGGTTGGCATTTGCAGCAGG + Intronic