ID: 901101546

View in Genome Browser
Species Human (GRCh38)
Location 1:6722953-6722975
Sequence GTTCCTACCACTCCAAGACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901101546_901101552 26 Left 901101546 1:6722953-6722975 CCAGGTCTTGGAGTGGTAGGAAC No data
Right 901101552 1:6723002-6723024 CCAAAGCTTCAAGACCTACGGGG No data
901101546_901101547 3 Left 901101546 1:6722953-6722975 CCAGGTCTTGGAGTGGTAGGAAC No data
Right 901101547 1:6722979-6723001 TCATGCAATTTTTCCGAAATTGG No data
901101546_901101549 24 Left 901101546 1:6722953-6722975 CCAGGTCTTGGAGTGGTAGGAAC No data
Right 901101549 1:6723000-6723022 GGCCAAAGCTTCAAGACCTACGG No data
901101546_901101550 25 Left 901101546 1:6722953-6722975 CCAGGTCTTGGAGTGGTAGGAAC No data
Right 901101550 1:6723001-6723023 GCCAAAGCTTCAAGACCTACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901101546 Original CRISPR GTTCCTACCACTCCAAGACC TGG (reversed) Intergenic
No off target data available for this crispr