ID: 901101829

View in Genome Browser
Species Human (GRCh38)
Location 1:6725107-6725129
Sequence GTTTAGTCATTGGCAAAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901101825_901101829 4 Left 901101825 1:6725080-6725102 CCGATGTGCACAGACTTCTCCAA No data
Right 901101829 1:6725107-6725129 GTTTAGTCATTGGCAAAAACAGG No data
901101824_901101829 19 Left 901101824 1:6725065-6725087 CCAAGGACATAGCGACCGATGTG No data
Right 901101829 1:6725107-6725129 GTTTAGTCATTGGCAAAAACAGG No data
901101823_901101829 25 Left 901101823 1:6725059-6725081 CCAGAACCAAGGACATAGCGACC No data
Right 901101829 1:6725107-6725129 GTTTAGTCATTGGCAAAAACAGG No data
901101822_901101829 29 Left 901101822 1:6725055-6725077 CCTGCCAGAACCAAGGACATAGC No data
Right 901101829 1:6725107-6725129 GTTTAGTCATTGGCAAAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901101829 Original CRISPR GTTTAGTCATTGGCAAAAAC AGG Intergenic
No off target data available for this crispr