ID: 901104341

View in Genome Browser
Species Human (GRCh38)
Location 1:6743678-6743700
Sequence CCAGCCGAGCGCTACCAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901104341_901104346 -10 Left 901104341 1:6743678-6743700 CCCTCCTGGTAGCGCTCGGCTGG No data
Right 901104346 1:6743691-6743713 GCTCGGCTGGGCCCTGCAGCTGG No data
901104341_901104347 -6 Left 901104341 1:6743678-6743700 CCCTCCTGGTAGCGCTCGGCTGG No data
Right 901104347 1:6743695-6743717 GGCTGGGCCCTGCAGCTGGCTGG No data
901104341_901104351 0 Left 901104341 1:6743678-6743700 CCCTCCTGGTAGCGCTCGGCTGG No data
Right 901104351 1:6743701-6743723 GCCCTGCAGCTGGCTGGGGGAGG No data
901104341_901104354 11 Left 901104341 1:6743678-6743700 CCCTCCTGGTAGCGCTCGGCTGG No data
Right 901104354 1:6743712-6743734 GGCTGGGGGAGGCCTCTCTGTGG No data
901104341_901104349 -4 Left 901104341 1:6743678-6743700 CCCTCCTGGTAGCGCTCGGCTGG No data
Right 901104349 1:6743697-6743719 CTGGGCCCTGCAGCTGGCTGGGG No data
901104341_901104356 25 Left 901104341 1:6743678-6743700 CCCTCCTGGTAGCGCTCGGCTGG No data
Right 901104356 1:6743726-6743748 TCTCTGTGGCCACACGCCTGAGG No data
901104341_901104350 -3 Left 901104341 1:6743678-6743700 CCCTCCTGGTAGCGCTCGGCTGG No data
Right 901104350 1:6743698-6743720 TGGGCCCTGCAGCTGGCTGGGGG No data
901104341_901104348 -5 Left 901104341 1:6743678-6743700 CCCTCCTGGTAGCGCTCGGCTGG No data
Right 901104348 1:6743696-6743718 GCTGGGCCCTGCAGCTGGCTGGG No data
901104341_901104357 30 Left 901104341 1:6743678-6743700 CCCTCCTGGTAGCGCTCGGCTGG No data
Right 901104357 1:6743731-6743753 GTGGCCACACGCCTGAGGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901104341 Original CRISPR CCAGCCGAGCGCTACCAGGA GGG (reversed) Intergenic
No off target data available for this crispr