ID: 901104977

View in Genome Browser
Species Human (GRCh38)
Location 1:6748163-6748185
Sequence CTGTTTATATAGACAAAGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901104977_901104978 -2 Left 901104977 1:6748163-6748185 CCAAGCTTTGTCTATATAAACAG No data
Right 901104978 1:6748184-6748206 AGTTGCAAACTTCTACACTTTGG No data
901104977_901104979 20 Left 901104977 1:6748163-6748185 CCAAGCTTTGTCTATATAAACAG No data
Right 901104979 1:6748206-6748228 GAGCACTGACTTCCATTCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901104977 Original CRISPR CTGTTTATATAGACAAAGCT TGG (reversed) Intergenic
No off target data available for this crispr