ID: 901105124

View in Genome Browser
Species Human (GRCh38)
Location 1:6749445-6749467
Sequence AAGGAGAAGAAGGAGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901105124_901105130 11 Left 901105124 1:6749445-6749467 CCCTCCTCCTCCTTCTTCTCCTT No data
Right 901105130 1:6749479-6749501 TTCTTCTTCTTCTTTTGAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901105124 Original CRISPR AAGGAGAAGAAGGAGGAGGA GGG (reversed) Intergenic
No off target data available for this crispr