ID: 901108872

View in Genome Browser
Species Human (GRCh38)
Location 1:6779436-6779458
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
901108867_901108872 20 Left 901108867 1:6779393-6779415 CCAAGGAGGGTCTCTGGAGAGCA No data
Right 901108872 1:6779436-6779458 ATGTAATAGCTGGATGATGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr